Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_018014 Terriglobus roseus DSM 18391, complete sequence 11 crisprs csa3,Cas9_archaeal,cas3,WYL,DinG 1 1 1 0

Results visualization

1. NC_018014
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018014_1 120943-121019 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018014_2 242626-242715 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018014_3 1418825-1419178 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018014_4 1609963-1610053 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018014_5 1711179-1711271 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018014_6 2133077-2133170 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018014_7 2140774-2140863 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018014_8 3773094-3773410 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018014_9 4025654-4025875 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018014_10 4157153-4157217 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018014_11 4276908-4277007 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_018014_10 10.1|4157176|19|NC_018014|CRISPRCasFinder 4157176-4157194 19 NC_018014.1 4737090-4737108 2 0.895

1. spacer 10.1|4157176|19|NC_018014|CRISPRCasFinder matches to position: 4737090-4737108, mismatch: 2, identity: 0.895

gagttttcggtatgactgc	CRISPR spacer
gagttttcggtctgagtgc	Protospacer
*********** *** ***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_018014_8 8.5|3773359|29|NC_018014|CRISPRCasFinder 3773359-3773387 29 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 97625-97653 8 0.724
NC_018014_8 8.5|3773359|29|NC_018014|CRISPRCasFinder 3773359-3773387 29 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 94269-94297 8 0.724

1. spacer 8.5|3773359|29|NC_018014|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 8, identity: 0.724

attcgcctcggaagggcgcctcagactca	CRISPR spacer
cggcgcctcggaagggcgcatcaggtact	Protospacer
   **************** ****.. * 

2. spacer 8.5|3773359|29|NC_018014|CRISPRCasFinder matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.724

attcgcctcggaagggcgcctcagactca	CRISPR spacer
cggcgcctcggaagggcgcatcaggtact	Protospacer
   **************** ****.. * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1900161 : 1907911 7 Yellowstone_lake_phycodnavirus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage