1. spacer 2.1|1241265|26|NC_018016|CRISPRCasFinder matches to MN856005 (Myoviridae sp. isolate 302, complete genome) position: , mismatch: 4, identity: 0.846
cggcattaagttgcttttaaaatgta CRISPR spacer
tggcatgaagttgcttttcaaatgtc Protospacer
.***** *********** ******
2. spacer 2.1|1241265|26|NC_018016|CRISPRCasFinder matches to NZ_CP045273 (Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence) position: , mismatch: 5, identity: 0.808
cggcattaagttgcttttaaaatgta CRISPR spacer
tttcatttacttgcttttaaaatgta Protospacer
. **** * ****************
3. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to CP041517 (Bacillus aryabhattai strain KNU10 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
ggggaagcactaactaaattaaaagaacag Protospacer
*.*.****** *.****************.
4. spacer 3.2|2221742|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NZ_CP010270 (Paenibacillus polymyxa strain Sb3-1 plasmid pSb31l, complete sequence) position: , mismatch: 6, identity: 0.8
cgaagggatcacaggattaaacttaggtta CRISPR spacer
cgaatggatcaaaggattaaacttactcca Protospacer
**** ****** ************* ..*
5. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to AP019525 (Tenacibaculum phage PTm5 DNA, complete genome) position: , mismatch: 6, identity: 0.8
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
tgtctagtaattaaaatagattaaaaatga Protospacer
* * *. *********************.
6. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to AP019524 (Tenacibaculum phage PTm1 DNA, complete genome) position: , mismatch: 6, identity: 0.8
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
tgtctagtaattaaaatagattaaaaatga Protospacer
* * *. *********************.
7. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MG592666 (Vibrio phage 2.096.O._10N.286.48.B5, partial genome) position: , mismatch: 6, identity: 0.8
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
caaattgcagaaactaaattaaaagaacaa Protospacer
*.* *** **.*****************
8. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MN694016 (Marine virus AFVG_250M811, complete genome) position: , mismatch: 6, identity: 0.8
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
gaagaagcaaaagctaaattaaatgaaaat Protospacer
**..***** ************* *** *
9. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MN694190 (Marine virus AFVG_250M608, complete genome) position: , mismatch: 6, identity: 0.8
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
gaagaagcaaaagctaaattagaagaaaat Protospacer
**..***** ***********.***** *
10. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MN693920 (Marine virus AFVG_250M810, complete genome) position: , mismatch: 6, identity: 0.8
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
gaagaagcaaaagctaaattaaatgaaaat Protospacer
**..***** ************* *** *
11. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MN693800 (Marine virus AFVG_250M813, complete genome) position: , mismatch: 6, identity: 0.8
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
gaagaagcaaaagctaaattaaatgaaaat Protospacer
**..***** ************* *** *
12. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MN694453 (Marine virus AFVG_250M327, complete genome) position: , mismatch: 6, identity: 0.8
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
gatgaagcaaaagctaaattaaatgaaaat Protospacer
** .***** ************* *** *
13. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MN694554 (Marine virus AFVG_250M812, complete genome) position: , mismatch: 6, identity: 0.8
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
gaagaagcaaaagctaaattaaatgaaaat Protospacer
**..***** ************* *** *
14. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NC_021772 (Salmonella phage FSL SP-058, complete genome) position: , mismatch: 6, identity: 0.8
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
gagaaagtccaagctaaattaaatggtgaa Protospacer
*******. ************** *. **
15. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NC_021782 (Salmonella phage FSL SP-076, complete genome) position: , mismatch: 6, identity: 0.8
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
gagaaagtccaagctaaattaaatggtgaa Protospacer
*******. ************** *. **
16. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MN693456 (Marine virus AFVG_25M411, complete genome) position: , mismatch: 7, identity: 0.767
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
acaaggtaaattaaaagagtttaaaaatgc Protospacer
. * *********** ** *********
17. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NZ_CP014570 (Campylobacter fetus subsp. venerealis strain 01/165 plasmid mp2, complete sequence) position: , mismatch: 7, identity: 0.767
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
tctccttaaattaaatttgattaaaaatgt Protospacer
*.* . ********* * ***********
18. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NZ_CP015177 (Bacillus thuringiensis serovar alesti strain BGSC 4C1 plasmid pBMB267, complete sequence) position: , mismatch: 7, identity: 0.767
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
catctaaaaattaaaacagattaaaagtgg Protospacer
. * *. *********.*********.***
19. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to CP029291 (Lactococcus lactis subsp. lactis KLDS 4.0325 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
attatataaattaaaagagattaagtaatg Protospacer
****.********** *******. * *
20. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NC_019349 (Lactococcus lactis subsp. cremoris plasmid pAF12, complete sequence) position: , mismatch: 7, identity: 0.767
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
attatataaattaaaagagattaagtaatg Protospacer
****.********** *******. * *
21. spacer 3.11|2222432|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MK250019 (Prevotella phage Lak-A2, complete genome) position: , mismatch: 7, identity: 0.767
---aaacttgaaaagattcgtttagactattta CRISPR spacer
agggaatt---aaaaattcgtttagactatttc Protospacer
.**.* ***.*****************
22. spacer 3.14|2222663|29|NC_018016|PILER-CR,CRISPRCasFinder matches to NZ_CP021658 (Aeromonas salmonicida strain O23A plasmid pO23AP4, complete sequence) position: , mismatch: 7, identity: 0.759
atcttctcgattaattaataacctcatac CRISPR spacer
gactcagcgatttattaataacctcatag Protospacer
. **. ***** ***************
23. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 7, identity: 0.767
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
gcatttacacaagctaaattaaaagaaaaa Protospacer
* . .******************** **
24. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NZ_CP004877 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB431, complete sequence) position: , mismatch: 7, identity: 0.767
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
aaaaaagcaaaagctgaattaaaagaaatt Protospacer
.*.****** *****.***********
25. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NZ_CP011350 (Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence) position: , mismatch: 7, identity: 0.767
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
aaaaaagcaaaagctgaattaaaagaaatt Protospacer
.*.****** *****.***********
26. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NZ_CP007616 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB400, complete sequence) position: , mismatch: 7, identity: 0.767
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
aaaaaagcaaaagctgaattaaaagaaatt Protospacer
.*.****** *****.***********
27. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NZ_CP004860 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB422, complete sequence) position: , mismatch: 7, identity: 0.767
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
aaaaaagcaaaagctgaattaaaagaaatt Protospacer
.*.****** *****.***********
28. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MF036692 (Serratia phage X20, complete genome) position: , mismatch: 7, identity: 0.767
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
attaaagctcaagcgaaattaaaagaaata Protospacer
. ***** ***** ************ *
29. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MN694632 (Marine virus AFVG_250M389, complete genome) position: , mismatch: 7, identity: 0.767
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
aaaaaagcacgagctaaattaaaatcagat Protospacer
.*.*******.************* * *
30. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to AP013517 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G21, isolate: uvMED-CGR-U-MedDCM-OCT-S30-C51) position: , mismatch: 7, identity: 0.767
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
ggcaaagcacaagctaatttaaacgatgta Protospacer
*. ************** ***** ** *
31. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NZ_CP007625 (Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
tttatttaaattaatatagattatcatgtt Protospacer
***** ******** ******** *
32. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NZ_CP009650 (Bacillus pseudomycoides strain BTZ plasmid pBTZ_1, complete sequence) position: , mismatch: 8, identity: 0.733
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
tttatttaaattaatatagattatcatgtt Protospacer
***** ******** ******** *
33. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MT601272 (Bacillus phage vB_BsuS-Goe11, complete genome) position: , mismatch: 8, identity: 0.733
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
atcatgtaaattaaaatacattgaaacaat Protospacer
*.*************** ***.*** .
34. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MT366947 (Bacillus phage Hyb2phi3Ts-SPbeta, complete genome) position: , mismatch: 8, identity: 0.733
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
atcatgtaaattaaaatacattgaaacaat Protospacer
*.*************** ***.*** .
35. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to KY030782 (Bacillus phage phi3T, complete genome) position: , mismatch: 8, identity: 0.733
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
atcatgtaaattaaaatacattgaaacaat Protospacer
*.*************** ***.*** .
36. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NC_001884 (Bacillus phage SPBc2, complete genome) position: , mismatch: 8, identity: 0.733
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
atcatgtaaattaaaatacattgaaacaat Protospacer
*.*************** ***.*** .
37. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to AF020713 (Bacteriophage SPBc2 complete genome) position: , mismatch: 8, identity: 0.733
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
atcatgtaaattaaaatacattgaaacaat Protospacer
*.*************** ***.*** .
38. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MT366946 (Bacillus phage Hyb1phi3Ts-SPbeta, complete genome) position: , mismatch: 8, identity: 0.733
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
atcatgtaaattaaaatacattgaaacaat Protospacer
*.*************** ***.*** .
39. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MT366948 (Bacillus phage Hyb3phi3Ts-SPbeta, complete genome) position: , mismatch: 8, identity: 0.733
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
atcatgtaaattaaaatacattgaaacaat Protospacer
*.*************** ***.*** .
40. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MT601274 (Bacillus phage vB_BsuS-Goe13, complete genome) position: , mismatch: 8, identity: 0.733
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
atcatgtaaattaaaatacattgaaacaat Protospacer
*.*************** ***.*** .
41. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to CP052843 (Bacillus phage Hybphi3Ts, partial sequence) position: , mismatch: 8, identity: 0.733
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
atcatgtaaattaaaatacattgaaacaat Protospacer
*.*************** ***.*** .
42. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MT601273 (Bacillus phage vB_BsuS-Goe12, complete genome) position: , mismatch: 8, identity: 0.733
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
atcatgtaaattaaaatacattgaaacaat Protospacer
*.*************** ***.*** .
43. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MT366945 (Bacillus phage phi3Ts, complete genome) position: , mismatch: 8, identity: 0.733
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
atcatgtaaattaaaatacattgaaacaat Protospacer
*.*************** ***.*** .
44. spacer 3.4|2221896|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NC_025249 (Lactococcus lactis subsp. cremoris MG1363 plasmid pFI430, complete sequence) position: , mismatch: 8, identity: 0.733
ttatagaatttgaagctgacgaggaatttc CRISPR spacer
aagaagaatttgaagctgaagagtaattaa Protospacer
. *************** *** ****
45. spacer 3.4|2221896|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NZ_CP041350 (Komagataeibacter xylinus strain CGMCC 17276 plasmid pB, complete sequence) position: , mismatch: 8, identity: 0.733
ttatagaatttgaagctgacgaggaatttc CRISPR spacer
gcaccaaatttgacgctgacgaggaatctg Protospacer
.*. .******* *************.*
46. spacer 3.4|2221896|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NZ_CP004365 (Komagataeibacter xylinus E25 plasmid pGX5, complete sequence) position: , mismatch: 8, identity: 0.733
ttatagaatttgaagctgacgaggaatttc CRISPR spacer
gcaccaaatttgacgctgacgaggaatctg Protospacer
.*. .******* *************.*
47. spacer 3.5|2221973|29|NC_018016|PILER-CR,CRISPRCasFinder matches to KF302032 (UNVERIFIED: Pseudoalteromonas phage HS5, complete genome) position: , mismatch: 8, identity: 0.724
aaatttcagaagctaagttaacgcacata CRISPR spacer
caatttcaaacgctaagttaacgcgatcg Protospacer
*******.* *************. ..
48. spacer 3.5|2221973|29|NC_018016|PILER-CR,CRISPRCasFinder matches to HM588722 (Pseudoalteromonas phage H105/1, complete genome) position: , mismatch: 8, identity: 0.724
aaatttcagaagctaagttaacgcacata CRISPR spacer
caatttcaaaagccaagttaacgcgatcg Protospacer
*******.****.**********. ..
49. spacer 3.5|2221973|29|NC_018016|PILER-CR,CRISPRCasFinder matches to KF302033 (UNVERIFIED: Pseudoalteromonas phage HS1, complete genome) position: , mismatch: 8, identity: 0.724
aaatttcagaagctaagttaacgcacata CRISPR spacer
caatttcaaacgctaagttaacgcgatcg Protospacer
*******.* *************. ..
50. spacer 3.12|2222509|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 8, identity: 0.733
aatctaaaagagcaaagtgatggaagactg CRISPR spacer
agcggaaaagagcatagtgctggaagacga Protospacer
*.. ********* **** ******** .
51. spacer 3.12|2222509|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 8, identity: 0.733
aatctaaaagagcaaagtgatggaagactg CRISPR spacer
agcggaaaagagcatagtgctggaagacga Protospacer
*.. ********* **** ******** .
52. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to LR214967 (Mycoplasma fermentans strain NCTC10117 genome assembly, plasmid: 13) position: , mismatch: 8, identity: 0.733
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
actaaagcagaagcaaaattaaaagaaatt Protospacer
. ****** **** ************
53. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to LR214967 (Mycoplasma fermentans strain NCTC10117 genome assembly, plasmid: 13) position: , mismatch: 8, identity: 0.733
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
actaaagcagaagcaaaattaaaagaaatt Protospacer
. ****** **** ************
54. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MF036691 (Serratia phage CBH8, complete genome) position: , mismatch: 8, identity: 0.733
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
attaaagctcaagcgaaattaaaagaaatg Protospacer
. ***** ***** ************ .
55. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to AP013616 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C26C-MedDCM-OCT-S40-C87, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
gctgcagcacaagctaaattaacagaattt Protospacer
* . ***************** ****.
56. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to AP013614 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C26B-MedDCM-OCT-S33-C167, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
gctgcagcacaagctaaattaacagaattt Protospacer
* . ***************** ****.
57. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MF036690 (Serratia phage CHI14, complete genome) position: , mismatch: 8, identity: 0.733
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
attaaagctcaagcgaaattaaaagaaatg Protospacer
. ***** ***** ************ .
58. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to AP013553 (Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C26B-MedDCM-OCT-S35-C55, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces) position: , mismatch: 8, identity: 0.733
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
gctgcagcacaagctaaattaacagaattt Protospacer
* . ***************** ****.
59. spacer 3.3|2221819|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MN694082 (Marine virus AFVG_250M1102, complete genome) position: , mismatch: 9, identity: 0.7
tttatgtaaattaaaatagattaaaaatgg CRISPR spacer
aggcagtaaattaaaattgattgaaaatac Protospacer
************ ****.*****.
60. spacer 3.6|2222049|29|NC_018016|PILER-CR,CRISPRCasFinder matches to NC_016571 (Pseudomonas phage OBP, complete genome) position: , mismatch: 9, identity: 0.69
caatttcttaattggtgataaccaacacc CRISPR spacer
ttctttcttaattggtgctaaccattctg Protospacer
. ************** ****** . .
61. spacer 3.7|2222125|30|NC_018016|PILER-CR,CRISPRCasFinder matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
aaatggtcagaatgtgacggatgtttatgt CRISPR spacer
ggtcggtcagcatgtgacggatgttgttac Protospacer
.. .****** ************** *..
62. spacer 3.12|2222509|30|NC_018016|PILER-CR,CRISPRCasFinder matches to MG878892 (Salmonella phage vB_SpuP_Spp16, complete genome) position: , mismatch: 9, identity: 0.7
aatctaaaagagcaaagtgatggaagactg CRISPR spacer
gtagtaagagagcaaagtgatagaagagct Protospacer
. ***.*************.***** .
63. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to KF669663 (Bacillus phage Staley, complete genome) position: , mismatch: 9, identity: 0.7
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
tgtaatgcacaagctaaattaaaactcgac Protospacer
. ** ****************** *
64. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to AP014488 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C31A-MedDCM-OCT-S45-C60, *** SEQUENCING IN PROGRESS ***, 7 ordered pieces) position: , mismatch: 9, identity: 0.7
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
ataaaagaacaagctaaattaaaatctaca Protospacer
. .**** **************** *
65. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to AP014487 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C31A-MedDCM-OCT-S34-C76, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 9, identity: 0.7
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
ataaaagaacaagctaaattaaaatctaca Protospacer
. .**** **************** *
66. spacer 3.15|2222739|30|NC_018016|PILER-CR,CRISPRCasFinder matches to AP014093 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C31A-MedDCM-OCT-S29-C126, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.7
gagaaagcacaagctaaattaaaagaacaa CRISPR spacer
ataaaagaacaagctaaattaaaatctaca Protospacer
. .**** **************** *