1. spacer 1.2|4475391|25|NC_017531|CRISPRCasFinder matches to NZ_CP022991 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence) position: , mismatch: 3, identity: 0.88
cgcaggtgaagagagcagccagatg CRISPR spacer
cgcaggtgaagagagcagccatcag Protospacer
********************* *
2. spacer 1.10|4475775|25|NC_017531|CRISPRCasFinder matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.88
ggcgggtgacgacagctccctgatc CRISPR spacer
ggccggtgacgacggctccctgagc Protospacer
*** *********.********* *
3. spacer 1.10|4475775|25|NC_017531|CRISPRCasFinder matches to NC_003276 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence) position: , mismatch: 3, identity: 0.88
ggcgggtgacgacagctccctgatc CRISPR spacer
ggcgggtgacgagagttccctgaac Protospacer
************ **.******* *
4. spacer 1.10|4475775|25|NC_017531|CRISPRCasFinder matches to NC_003276 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence) position: , mismatch: 3, identity: 0.88
ggcgggtgacgacagctccctgatc CRISPR spacer
ggcgggtgacgagagttccctgaac Protospacer
************ **.******* *
5. spacer 1.10|4475775|25|NC_017531|CRISPRCasFinder matches to NC_003276 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence) position: , mismatch: 3, identity: 0.88
ggcgggtgacgacagctccctgatc CRISPR spacer
ggcgggtgacgagagttccctgaac Protospacer
************ **.******* *
6. spacer 1.21|4476303|25|NC_017531|CRISPRCasFinder matches to NZ_CP014682 (Kozakia baliensis strain NBRC 16680 plasmid pKB16680_1, complete sequence) position: , mismatch: 3, identity: 0.88
ggcgcaggagggcagcgatctcacc CRISPR spacer
ggcgcaggagcgcagcgatctcgcg Protospacer
********** ***********.*
7. spacer 1.21|4476303|25|NC_017531|CRISPRCasFinder matches to NZ_CP014675 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence) position: , mismatch: 3, identity: 0.88
ggcgcaggagggcagcgatctcacc CRISPR spacer
ggcgcaggagcgcagcgatctcgcg Protospacer
********** ***********.*
8. spacer 1.5|4475535|25|NC_017531|CRISPRCasFinder matches to AP014720 (Arthrobacter sp. Hiyo8 plasmid pHiyo8-1 DNA, complete genome, strain: Hiyo8) position: , mismatch: 4, identity: 0.84
ggcaggcgaagacagctcgctgaca CRISPR spacer
ggcaggcgaagccagctcgttgatt Protospacer
*********** *******.***.
9. spacer 1.6|4475583|25|NC_017531|CRISPRCasFinder matches to NZ_CP048425 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cgcgcagaagggcagcgatcttacc CRISPR spacer
cgcgctgaagggcagcgatcttcgg Protospacer
***** ****************
10. spacer 1.6|4475583|25|NC_017531|CRISPRCasFinder matches to MK290737 (Pectobacterium phage Arno162, complete genome) position: , mismatch: 4, identity: 0.84
cgcgcagaagggcagcgatcttacc CRISPR spacer
ccatcagaagggcagcggtcttacc Protospacer
* *************.*******
11. spacer 1.6|4475583|25|NC_017531|CRISPRCasFinder matches to MN270892 (Pectobacterium phage Wc4-1, complete genome) position: , mismatch: 4, identity: 0.84
cgcgcagaagggcagcgatcttacc CRISPR spacer
ccatcagaagggcagcggtcttacc Protospacer
* *************.*******
12. spacer 1.6|4475583|25|NC_017531|CRISPRCasFinder matches to MN270891 (Pectobacterium phage Wc4, complete genome) position: , mismatch: 4, identity: 0.84
cgcgcagaagggcagcgatcttacc CRISPR spacer
ccatcagaagggcagcggtcttacc Protospacer
* *************.*******
13. spacer 1.8|4475679|25|NC_017531|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 4, identity: 0.84
ggccggggaagaaagcacccagaca CRISPR spacer
ggccgcggaagaaatcacccagatc Protospacer
***** ******** ********.
14. spacer 1.8|4475679|25|NC_017531|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 4, identity: 0.84
ggccggggaagaaagcacccagaca CRISPR spacer
ggccgcggaagaaatcacccagatc Protospacer
***** ******** ********.
15. spacer 1.8|4475679|25|NC_017531|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 4, identity: 0.84
ggccggggaagaaagcacccagaca CRISPR spacer
ggccgcggaagaaatcacccagatc Protospacer
***** ******** ********.
16. spacer 1.8|4475679|25|NC_017531|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 4, identity: 0.84
ggccggggaagaaagcacccagaca CRISPR spacer
ggccgcggaagaaatcacccagatc Protospacer
***** ******** ********.
17. spacer 1.8|4475679|25|NC_017531|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 4, identity: 0.84
ggccggggaagaaagcacccagaca CRISPR spacer
ggccgcggaagaaatcacccagatc Protospacer
***** ******** ********.
18. spacer 1.8|4475679|25|NC_017531|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 4, identity: 0.84
ggccggggaagaaagcacccagaca CRISPR spacer
ggccgcggaagaaatcacccagatc Protospacer
***** ******** ********.
19. spacer 1.9|4475727|25|NC_017531|CRISPRCasFinder matches to MN484601 (Gordonia phage Sixama, complete genome) position: , mismatch: 4, identity: 0.84
cgcgcagaagggcagcgaccttacg CRISPR spacer
cgcgcagaagggcggcgaccataat Protospacer
*************.****** **
20. spacer 1.11|4475823|25|NC_017531|CRISPRCasFinder matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.84
ggcgggcgaagacagctcgctgaca CRISPR spacer
ggcgggtgaagacagctcgccgagg Protospacer
******.*************.** .
21. spacer 1.12|4475871|25|NC_017531|CRISPRCasFinder matches to NZ_CP048425 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cgcgcagaagggcagcgatcttact CRISPR spacer
cgcgctgaagggcagcgatcttcgg Protospacer
***** ****************
22. spacer 1.15|4476015|25|NC_017531|CRISPRCasFinder matches to MN484601 (Gordonia phage Sixama, complete genome) position: , mismatch: 4, identity: 0.84
cgcgcagaagggcagcgaccttacg CRISPR spacer
cgcgcagaagggcggcgaccataat Protospacer
*************.****** **
23. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
24. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
25. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
26. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
27. spacer 1.53|4476879|28|NC_017531|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
28. spacer 1.53|4476879|28|NC_017531|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
29. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
30. spacer 1.53|4476879|28|NC_017531|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
31. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
32. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
33. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
34. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
35. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
36. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
37. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
38. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
39. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
40. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
41. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
42. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
43. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
44. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
45. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
46. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
47. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
48. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
49. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
50. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
51. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
52. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
53. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
54. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
55. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
56. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
57. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
58. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
59. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
60. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
61. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
62. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
63. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
64. spacer 1.53|4476879|28|NC_017531|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
65. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
66. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
67. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
68. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
69. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
70. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
71. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
72. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
73. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
74. spacer 1.53|4476879|28|NC_017531|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
75. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
76. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
77. spacer 1.53|4476879|28|NC_017531|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
78. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
79. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
80. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
81. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
82. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
83. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
84. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
85. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
86. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
87. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
88. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
89. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
90. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
91. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
92. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
93. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
94. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
95. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
96. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
97. spacer 1.53|4476879|28|NC_017531|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
98. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
99. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
100. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
101. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
102. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
103. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
104. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
105. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
106. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
107. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
108. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP014682 (Kozakia baliensis strain NBRC 16680 plasmid pKB16680_1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
ggcgcaggagcgcagcgatctcgcgaag Protospacer
********************* .* * *
109. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP014675 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
ggcgcaggagcgcagcgatctcgcgaag Protospacer
********************* .* * *
110. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
111. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
112. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
113. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
114. spacer 1.59|4477167|28|NC_017531|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
115. spacer 1.59|4477167|28|NC_017531|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
116. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
117. spacer 1.59|4477167|28|NC_017531|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
118. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
119. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
120. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
121. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
122. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
123. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
124. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
125. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
126. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
127. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
128. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
129. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
130. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
131. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
132. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
133. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
134. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
135. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
136. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
137. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
138. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
139. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
140. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
141. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
142. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
143. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
144. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
145. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
146. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
147. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
148. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
149. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
150. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
151. spacer 1.59|4477167|28|NC_017531|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
152. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
153. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
154. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
155. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
156. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
157. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
158. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
159. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
160. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
161. spacer 1.59|4477167|28|NC_017531|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
162. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
163. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
164. spacer 1.59|4477167|28|NC_017531|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
165. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
166. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
167. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
168. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
169. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
170. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
171. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
172. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
173. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
174. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
175. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
176. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
177. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
178. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
179. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
180. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
181. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
182. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
183. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
184. spacer 1.59|4477167|28|NC_017531|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
185. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
186. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
187. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
188. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
189. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
190. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
191. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
192. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
193. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
194. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
195. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP014682 (Kozakia baliensis strain NBRC 16680 plasmid pKB16680_1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
ggcgcaggagcgcagcgatctcgcgaag Protospacer
********************* .* * *
196. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP014675 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
ggcgcaggagcgcagcgatctcgcgaag Protospacer
********************* .* * *
197. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
198. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
199. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
200. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
201. spacer 1.68|4477599|28|NC_017531|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
202. spacer 1.68|4477599|28|NC_017531|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
203. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
204. spacer 1.68|4477599|28|NC_017531|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
205. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
206. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
207. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
208. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
209. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
210. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
211. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
212. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
213. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
214. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
215. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
216. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
217. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
218. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
219. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
220. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
221. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
222. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
223. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
224. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
225. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
226. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
227. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
228. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
229. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
230. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
231. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
232. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
233. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
234. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
235. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
236. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
237. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
238. spacer 1.68|4477599|28|NC_017531|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
239. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
240. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
241. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
242. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
243. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
244. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
245. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
246. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
247. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
248. spacer 1.68|4477599|28|NC_017531|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
249. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
250. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
251. spacer 1.68|4477599|28|NC_017531|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
252. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
253. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
254. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
255. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
256. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
257. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
258. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
259. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
260. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
261. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
262. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
263. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
264. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
265. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
266. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
267. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
268. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
269. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
270. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
271. spacer 1.68|4477599|28|NC_017531|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
272. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
273. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
274. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
275. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
276. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
277. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
278. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
279. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
280. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
281. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgctggagcgcagcgacctgaccacc Protospacer
**** ************.********
282. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP014682 (Kozakia baliensis strain NBRC 16680 plasmid pKB16680_1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
ggcgcaggagcgcagcgatctcgcgaag Protospacer
********************* .* * *
283. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP014675 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence) position: , mismatch: 4, identity: 0.857
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
ggcgcaggagcgcagcgatctcgcgaag Protospacer
********************* .* * *
284. spacer 1.3|4475439|25|NC_017531|CRISPRCasFinder matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 5, identity: 0.8
cggcatgaaaggcagcgatctcacc CRISPR spacer
aattatgaaaggcagcgatctcaac Protospacer
. .******************* *
285. spacer 1.22|4475391|28|NC_017531|CRT matches to NZ_CP022991 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence) position: , mismatch: 5, identity: 0.821
cgcaggtgaagagagcagccagatggcg CRISPR spacer
cgcaggtgaagagagcagccatcagccc Protospacer
********************* * *
286. spacer 1.26|4475583|28|NC_017531|CRT matches to NZ_CP048425 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821
cgcgcagaagggcagcgatcttaccgcg CRISPR spacer
cgcgctgaagggcagcgatcttcgggtg Protospacer
***** **************** *.*
287. spacer 1.29|4475727|28|NC_017531|CRT matches to MN484601 (Gordonia phage Sixama, complete genome) position: , mismatch: 5, identity: 0.821
cgcgcagaagggcagcgaccttacggcc CRISPR spacer
cgcgcagaagggcggcgaccataatgac Protospacer
*************.****** ** * *
288. spacer 1.35|4476015|28|NC_017531|CRT matches to MN484601 (Gordonia phage Sixama, complete genome) position: , mismatch: 5, identity: 0.821
cgcgcagaagggcagcgaccttacggcc CRISPR spacer
cgcgcagaagggcggcgaccataatgac Protospacer
*************.****** ** * *
289. spacer 1.51|4476783|28|NC_017531|CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 5, identity: 0.821
cgccggtgccgacagctccctgattgca CRISPR spacer
gaccactgccgacggctccctgattgca Protospacer
.**. *******.**************
290. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 5, identity: 0.821
---ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
ctgggc---ggagcgcatcgatctgaccacc Protospacer
*** ******** ************
291. spacer 1.57|4477071|28|NC_017531|CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 5, identity: 0.821
cgccggtgccgacagctccctgattgca CRISPR spacer
gaccactgccgacggctccctgattgca Protospacer
.**. *******.**************
292. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 5, identity: 0.821
---ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
ctgggc---ggagcgcatcgatctgaccacc Protospacer
*** ******** ************
293. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 5, identity: 0.821
---ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
ctgggc---ggagcgcatcgatctgaccacc Protospacer
*** ******** ************
294. spacer 1.71|4477743|28|NC_017531|CRT matches to NC_011889 (Methylobacterium nodulans ORS 2060 plasmid pMNOD06, complete sequence) position: , mismatch: 5, identity: 0.821
ggcgcaggagaatagcgatctgacgacc CRISPR spacer
gctgcaggagaatagcgatctgatgttc Protospacer
* .********************.* .*
295. spacer 1.19|4476207|25|NC_017531|CRISPRCasFinder matches to KM659097 (Paracoccus yeei plasmid pLM20P5, complete sequence) position: , mismatch: 6, identity: 0.76
cgccggcgccgacagttccctgatt CRISPR spacer
gaagcgcgccgacagttccctgatc Protospacer
. *******************.
296. spacer 1.23|4475439|28|NC_017531|CRT matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 6, identity: 0.786
cggcatgaaaggcagcgatctcaccgcc CRISPR spacer
aattatgaaaggcagcgatctcaacgac Protospacer
. .******************* ** *
297. spacer 1.28|4475679|28|NC_017531|CRT matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 6, identity: 0.786
ggccggggaagaaagcacccagacagcc CRISPR spacer
ggccgcggaagaaatcacccagatcccg Protospacer
***** ******** ********. *
298. spacer 1.28|4475679|28|NC_017531|CRT matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 6, identity: 0.786
ggccggggaagaaagcacccagacagcc CRISPR spacer
ggccgcggaagaaatcacccagatcccg Protospacer
***** ******** ********. *
299. spacer 1.28|4475679|28|NC_017531|CRT matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 6, identity: 0.786
ggccggggaagaaagcacccagacagcc CRISPR spacer
ggccgcggaagaaatcacccagatcccg Protospacer
***** ******** ********. *
300. spacer 1.28|4475679|28|NC_017531|CRT matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 6, identity: 0.786
ggccggggaagaaagcacccagacagcc CRISPR spacer
ggccgcggaagaaatcacccagatcccg Protospacer
***** ******** ********. *
301. spacer 1.28|4475679|28|NC_017531|CRT matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 6, identity: 0.786
ggccggggaagaaagcacccagacagcc CRISPR spacer
ggccgcggaagaaatcacccagatcccg Protospacer
***** ******** ********. *
302. spacer 1.28|4475679|28|NC_017531|CRT matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 6, identity: 0.786
ggccggggaagaaagcacccagacagcc CRISPR spacer
ggccgcggaagaaatcacccagatcccg Protospacer
***** ******** ********. *
303. spacer 1.30|4475775|28|NC_017531|CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgggtgacgacagctccctgatcgcc CRISPR spacer
ggccggtgacgacggctccctgagcaga Protospacer
*** *********.********* *.
304. spacer 1.30|4475775|28|NC_017531|CRT matches to NC_003276 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgggtgacgacagctccctgatcgcc CRISPR spacer
ggcgggtgacgagagttccctgaacagt Protospacer
************ **.******* *. .
305. spacer 1.30|4475775|28|NC_017531|CRT matches to NC_003276 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgggtgacgacagctccctgatcgcc CRISPR spacer
ggcgggtgacgagagttccctgaacagt Protospacer
************ **.******* *. .
306. spacer 1.30|4475775|28|NC_017531|CRT matches to NC_003276 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgggtgacgacagctccctgatcgcc CRISPR spacer
ggcgggtgacgagagttccctgaacagt Protospacer
************ **.******* *. .
307. spacer 1.31|4475823|28|NC_017531|CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgggcgaagacagctcgctgacagcc CRISPR spacer
ggcgggtgaagacagctcgccgagggtg Protospacer
******.*************.** .*.
308. spacer 1.32|4475871|28|NC_017531|CRT matches to NZ_CP048425 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
cgcgcagaagggcagcgatcttactgca CRISPR spacer
cgcgctgaagggcagcgatcttcgggtg Protospacer
***** **************** *..
309. spacer 1.38|4476159|28|NC_017531|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgcgcgaacagagtgtgctgacgacc CRISPR spacer
tctgcgcgaacaaagtgtgccgacgacg Protospacer
.*********.*******.******
310. spacer 1.41|4476303|28|NC_017531|CRT matches to NZ_CP014682 (Kozakia baliensis strain NBRC 16680 plasmid pKB16680_1, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgcaggagggcagcgatctcaccgca CRISPR spacer
ggcgcaggagcgcagcgatctcgcgaag Protospacer
********** ***********.* . .
311. spacer 1.41|4476303|28|NC_017531|CRT matches to NZ_CP014675 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgcaggagggcagcgatctcaccgca CRISPR spacer
ggcgcaggagcgcagcgatctcgcgaag Protospacer
********** ***********.* . .
312. spacer 1.42|4476351|28|NC_017531|CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 6, identity: 0.786
cgccggtgccgacagctccctgattgcg CRISPR spacer
gaccactgccgacggctccctgattgca Protospacer
.**. *******.*************.
313. spacer 1.44|4476447|28|NC_017531|CRT matches to NZ_CP014682 (Kozakia baliensis strain NBRC 16680 plasmid pKB16680_1, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgcaggagggcagcgatctcaccgca CRISPR spacer
ggcgcaggagcgcagcgatctcgcgaag Protospacer
********** ***********.* . .
314. spacer 1.44|4476447|28|NC_017531|CRT matches to NZ_CP014675 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgcaggagggcagcgatctcaccgca CRISPR spacer
ggcgcaggagcgcagcgatctcgcgaag Protospacer
********** ***********.* . .
315. spacer 1.45|4476495|28|NC_017531|CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 6, identity: 0.786
cgccggtgccgacagctccctgattgcg CRISPR spacer
gaccactgccgacggctccctgattgca Protospacer
.**. *******.*************.
316. spacer 1.47|4476591|28|NC_017531|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgcgcgaacagagtgtgctgacgacc CRISPR spacer
tctgcgcgaacaaagtgtgccgacgacg Protospacer
.*********.*******.******
317. spacer 1.50|4476735|28|NC_017531|CRT matches to NZ_CP014682 (Kozakia baliensis strain NBRC 16680 plasmid pKB16680_1, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgcaggagggcagcgatctcaccgca CRISPR spacer
ggcgcaggagcgcagcgatctcgcgaag Protospacer
********** ***********.* . .
318. spacer 1.50|4476735|28|NC_017531|CRT matches to NZ_CP014675 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgcaggagggcagcgatctcaccgca CRISPR spacer
ggcgcaggagcgcagcgatctcgcgaag Protospacer
********** ***********.* . .
319. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgcaggagcgcatcgagctgaccgtc Protospacer
************* *** ******..
320. spacer 1.53|4476879|28|NC_017531|CRT matches to CP027479 (Pseudomonas koreensis strain P19E3 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgcaggagcgaagcgatctggtcaga Protospacer
*********** *********..** .
321. spacer 1.54|4476927|28|NC_017531|CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 6, identity: 0.786
cgccggtgccgacagctccctgattgcg CRISPR spacer
gaccactgccgacggctccctgattgca Protospacer
.**. *******.*************.
322. spacer 1.56|4477023|28|NC_017531|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgcgcgaacagagtgtgctgacgacc CRISPR spacer
tctgcgcgaacaaagtgtgccgacgacg Protospacer
.*********.*******.******
323. spacer 1.58|4477119|28|NC_017531|CRT matches to NZ_CP019439 (Thioclava nitratireducens strain 25B10_4 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggat Protospacer
** *** ***************** .
324. spacer 1.58|4477119|28|NC_017531|CRT matches to NZ_CP021915 (Sagittula sp. P11 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggag Protospacer
** *** *****************
325. spacer 1.58|4477119|28|NC_017531|CRT matches to NZ_CP031599 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggat Protospacer
** *** ***************** .
326. spacer 1.58|4477119|28|NC_017531|CRT matches to NZ_CP045390 (Roseivivax sp. THAF30 plasmid pTHAF30_a, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggag Protospacer
** *** *****************
327. spacer 1.58|4477119|28|NC_017531|CRT matches to NZ_CP045362 (Roseivivax sp. THAF40 plasmid pTHAF40_b, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggag Protospacer
** *** *****************
328. spacer 1.58|4477119|28|NC_017531|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
caccgcgtacaacaacatcctgacggcc Protospacer
.* * *******.*************
329. spacer 1.58|4477119|28|NC_017531|CRT matches to NZ_CP010870 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6001, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggat Protospacer
** *** ***************** .
330. spacer 1.58|4477119|28|NC_017531|CRT matches to NC_009957 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI03, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggat Protospacer
** *** ***************** .
331. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgcaggagcgcatcgagctgaccgtc Protospacer
************* *** ******..
332. spacer 1.59|4477167|28|NC_017531|CRT matches to CP027479 (Pseudomonas koreensis strain P19E3 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgcaggagcgaagcgatctggtcaga Protospacer
*********** *********..** .
333. spacer 1.60|4477215|28|NC_017531|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.786
cgccggcgccgacagttctctgatcgcg CRISPR spacer
gcccggcgccgacagctctctggtcgat Protospacer
*************.******.***
334. spacer 1.60|4477215|28|NC_017531|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 6, identity: 0.786
cgccggcgccgacagttctctgatcgcg CRISPR spacer
gcccggcgccgacagctctctggtcgat Protospacer
*************.******.***
335. spacer 1.61|4477263|28|NC_017531|CRT matches to NZ_CP019439 (Thioclava nitratireducens strain 25B10_4 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggat Protospacer
** *** ***************** .
336. spacer 1.61|4477263|28|NC_017531|CRT matches to NZ_CP021915 (Sagittula sp. P11 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggag Protospacer
** *** *****************
337. spacer 1.61|4477263|28|NC_017531|CRT matches to NZ_CP031599 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggat Protospacer
** *** ***************** .
338. spacer 1.61|4477263|28|NC_017531|CRT matches to NZ_CP045390 (Roseivivax sp. THAF30 plasmid pTHAF30_a, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggag Protospacer
** *** *****************
339. spacer 1.61|4477263|28|NC_017531|CRT matches to NZ_CP045362 (Roseivivax sp. THAF40 plasmid pTHAF40_b, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggag Protospacer
** *** *****************
340. spacer 1.61|4477263|28|NC_017531|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
caccgcgtacaacaacatcctgacggcc Protospacer
.* * *******.*************
341. spacer 1.61|4477263|28|NC_017531|CRT matches to NZ_CP010870 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6001, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggat Protospacer
** *** ***************** .
342. spacer 1.61|4477263|28|NC_017531|CRT matches to NC_009957 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI03, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggat Protospacer
** *** ***************** .
343. spacer 1.64|4477407|28|NC_017531|CRT matches to NZ_CP019439 (Thioclava nitratireducens strain 25B10_4 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggat Protospacer
** *** ***************** .
344. spacer 1.64|4477407|28|NC_017531|CRT matches to NZ_CP021915 (Sagittula sp. P11 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggag Protospacer
** *** *****************
345. spacer 1.64|4477407|28|NC_017531|CRT matches to NZ_CP031599 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggat Protospacer
** *** ***************** .
346. spacer 1.64|4477407|28|NC_017531|CRT matches to NZ_CP045390 (Roseivivax sp. THAF30 plasmid pTHAF30_a, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggag Protospacer
** *** *****************
347. spacer 1.64|4477407|28|NC_017531|CRT matches to NZ_CP045362 (Roseivivax sp. THAF40 plasmid pTHAF40_b, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggag Protospacer
** *** *****************
348. spacer 1.64|4477407|28|NC_017531|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
caccgcgtacaacaacatcctgacggcc Protospacer
.* * *******.*************
349. spacer 1.64|4477407|28|NC_017531|CRT matches to NZ_CP010870 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6001, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggat Protospacer
** *** ***************** .
350. spacer 1.64|4477407|28|NC_017531|CRT matches to NC_009957 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI03, complete sequence) position: , mismatch: 6, identity: 0.786
agcgggttacaacagcatcctgacggcc CRISPR spacer
cgcccgttccaacagcatcctgacggat Protospacer
** *** ***************** .
351. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgcaggagcgcatcgagctgaccgtc Protospacer
************* *** ******..
352. spacer 1.68|4477599|28|NC_017531|CRT matches to CP027479 (Pseudomonas koreensis strain P19E3 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.786
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cgcgcaggagcgaagcgatctggtcaga Protospacer
*********** *********..** .
353. spacer 1.25|4475535|28|NC_017531|CRT matches to AP014720 (Arthrobacter sp. Hiyo8 plasmid pHiyo8-1 DNA, complete genome, strain: Hiyo8) position: , mismatch: 7, identity: 0.75
ggcaggcgaagacagctcgctgacagcc CRISPR spacer
ggcaggcgaagccagctcgttgatttgt Protospacer
*********** *******.***. .
354. spacer 1.26|4475583|28|NC_017531|CRT matches to MK290737 (Pectobacterium phage Arno162, complete genome) position: , mismatch: 7, identity: 0.75
cgcgcagaagggcagcgatcttaccgcg CRISPR spacer
ccatcagaagggcagcggtcttaccaga Protospacer
* *************.*******. .
355. spacer 1.26|4475583|28|NC_017531|CRT matches to MN270892 (Pectobacterium phage Wc4-1, complete genome) position: , mismatch: 7, identity: 0.75
cgcgcagaagggcagcgatcttaccgcg CRISPR spacer
ccatcagaagggcagcggtcttaccaga Protospacer
* *************.*******. .
356. spacer 1.26|4475583|28|NC_017531|CRT matches to MN270891 (Pectobacterium phage Wc4, complete genome) position: , mismatch: 7, identity: 0.75
cgcgcagaagggcagcgatcttaccgcg CRISPR spacer
ccatcagaagggcagcggtcttaccaga Protospacer
* *************.*******. .
357. spacer 1.32|4475871|28|NC_017531|CRT matches to NZ_CP014350 (Borrelia hermsii HS1 isolate Browne Mountain plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.75
cgcgcagaagggcagcgatcttactgca CRISPR spacer
taacccaaagggcagtgatcttactgca Protospacer
.. * .********.************
358. spacer 1.32|4475871|28|NC_017531|CRT matches to NZ_CP014350 (Borrelia hermsii HS1 isolate Browne Mountain plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.75
cgcgcagaagggcagcgatcttactgca CRISPR spacer
taatccaaagggcagtgatcttactgca Protospacer
.. * .********.************
359. spacer 1.36|4476063|28|NC_017531|CRT matches to AP013928 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5-MedDCM-OCT-S29-C96, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.75
ggcaggctcggacagctcaatcattgca CRISPR spacer
cttcagctcgaacagctcaatgattgca Protospacer
. .*****.********** ******
360. spacer 1.42|4476351|28|NC_017531|CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 7, identity: 0.75
cgccggtgccgacagctccctgattgcg CRISPR spacer
gctcgatgccgacagcaccctgattggc Protospacer
.**.********** *********
361. spacer 1.42|4476351|28|NC_017531|CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 7, identity: 0.75
cgccggtgccgacagctccctgattgcg CRISPR spacer
gctcgatgccgacagcaccctgattggc Protospacer
.**.********** *********
362. spacer 1.45|4476495|28|NC_017531|CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 7, identity: 0.75
cgccggtgccgacagctccctgattgcg CRISPR spacer
gctcgatgccgacagcaccctgattggc Protospacer
.**.********** *********
363. spacer 1.45|4476495|28|NC_017531|CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 7, identity: 0.75
cgccggtgccgacagctccctgattgcg CRISPR spacer
gctcgatgccgacagcaccctgattggc Protospacer
.**.********** *********
364. spacer 1.51|4476783|28|NC_017531|CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 7, identity: 0.75
cgccggtgccgacagctccctgattgca CRISPR spacer
gctcgatgccgacagcaccctgattggc Protospacer
.**.********** *********
365. spacer 1.51|4476783|28|NC_017531|CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 7, identity: 0.75
cgccggtgccgacagctccctgattgca CRISPR spacer
gctcgatgccgacagcaccctgattggc Protospacer
.**.********** *********
366. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
367. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
368. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
369. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
370. spacer 1.53|4476879|28|NC_017531|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
371. spacer 1.53|4476879|28|NC_017531|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
372. spacer 1.53|4476879|28|NC_017531|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
373. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacattgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
374. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
375. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
376. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
377. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
378. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
379. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
380. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
381. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
382. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
383. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
384. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
385. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
386. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
387. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
388. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
389. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
390. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
391. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
392. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
393. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
394. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacattgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
395. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
396. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
397. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
398. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
399. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacattgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
400. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacattgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
401. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacattgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
402. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
403. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
404. spacer 1.53|4476879|28|NC_017531|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
405. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
406. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
407. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
408. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
409. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
410. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
411. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
412. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
413. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
414. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
415. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
416. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
417. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
418. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
419. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
420. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
421. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
422. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
423. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
424. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
425. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
426. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
427. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
428. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
429. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
430. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
431. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
432. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
433. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
434. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
435. spacer 1.53|4476879|28|NC_017531|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
436. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
437. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
438. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
439. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
440. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
441. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
442. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
443. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
444. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
445. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
446. spacer 1.53|4476879|28|NC_017531|CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cagccaggaacgcagcgatctgcccacc Protospacer
. *****.************ ****
447. spacer 1.54|4476927|28|NC_017531|CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 7, identity: 0.75
cgccggtgccgacagctccctgattgcg CRISPR spacer
gctcgatgccgacagcaccctgattggc Protospacer
.**.********** *********
448. spacer 1.54|4476927|28|NC_017531|CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 7, identity: 0.75
cgccggtgccgacagctccctgattgcg CRISPR spacer
gctcgatgccgacagcaccctgattggc Protospacer
.**.********** *********
449. spacer 1.57|4477071|28|NC_017531|CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 7, identity: 0.75
cgccggtgccgacagctccctgattgca CRISPR spacer
gctcgatgccgacagcaccctgattggc Protospacer
.**.********** *********
450. spacer 1.57|4477071|28|NC_017531|CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 7, identity: 0.75
cgccggtgccgacagctccctgattgca CRISPR spacer
gctcgatgccgacagcaccctgattggc Protospacer
.**.********** *********
451. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
452. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
453. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
454. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
455. spacer 1.59|4477167|28|NC_017531|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
456. spacer 1.59|4477167|28|NC_017531|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
457. spacer 1.59|4477167|28|NC_017531|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
458. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacattgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
459. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
460. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
461. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
462. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
463. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
464. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
465. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
466. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
467. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
468. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
469. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
470. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
471. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
472. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
473. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
474. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
475. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
476. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
477. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
478. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
479. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacattgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
480. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
481. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
482. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
483. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
484. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacattgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
485. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacattgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
486. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacattgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
487. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
488. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
489. spacer 1.59|4477167|28|NC_017531|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
490. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
491. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
492. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
493. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
494. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
495. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
496. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
497. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
498. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
499. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
500. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
501. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
502. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
503. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
504. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
505. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
506. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
507. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
508. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
509. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
510. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
511. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
512. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
513. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
514. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
515. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
516. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
517. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
518. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
519. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
520. spacer 1.59|4477167|28|NC_017531|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
521. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
522. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
523. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
524. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
525. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
526. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
527. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
528. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
529. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
530. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
531. spacer 1.59|4477167|28|NC_017531|CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cagccaggaacgcagcgatctgcccacc Protospacer
. *****.************ ****
532. spacer 1.60|4477215|28|NC_017531|CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
cgccggcgccgacagttctctgatcgcg CRISPR spacer
atagagcgccgacagttctcgcatcgcg Protospacer
.*************** ******
533. spacer 1.62|4477311|28|NC_017531|CRT matches to NC_011889 (Methylobacterium nodulans ORS 2060 plasmid pMNOD06, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagaatagcgatctgaccacg CRISPR spacer
gctgcaggagaatagcgatctgatgttc Protospacer
* .********************. .
534. spacer 1.65|4477455|28|NC_017531|CRT matches to NC_011889 (Methylobacterium nodulans ORS 2060 plasmid pMNOD06, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagaatagcgatctgaccacg CRISPR spacer
gctgcaggagaatagcgatctgatgttc Protospacer
* .********************. .
535. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
536. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
537. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
538. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
539. spacer 1.68|4477599|28|NC_017531|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
540. spacer 1.68|4477599|28|NC_017531|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
541. spacer 1.68|4477599|28|NC_017531|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
542. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacattgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
543. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
544. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
545. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
546. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
547. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
548. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
549. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
550. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
551. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
552. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
553. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
554. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
555. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
556. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
557. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
558. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
559. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
560. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
561. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
562. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
563. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacattgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
564. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
565. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
566. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
567. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
568. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacattgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
569. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacattgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
570. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacattgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
571. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
572. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
573. spacer 1.68|4477599|28|NC_017531|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
574. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
575. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
576. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
577. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
578. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
579. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
580. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
581. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
582. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
583. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
584. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
585. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
586. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
587. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
588. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
589. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
590. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
591. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
592. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
593. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
594. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
595. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
596. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
597. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
598. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
599. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
600. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
601. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
602. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
603. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
604. spacer 1.68|4477599|28|NC_017531|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
605. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
606. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
607. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
608. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
609. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
610. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
611. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
612. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
613. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
614. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
gaacatcgagcgcagcgacctgaccacg Protospacer
*. ***********.*********
615. spacer 1.68|4477599|28|NC_017531|CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
ggcgcaggagcgcagcgatctgaccacg CRISPR spacer
cagccaggaacgcagcgatctgcccacc Protospacer
. *****.************ ****
616. spacer 1.69|4477647|28|NC_017531|CRT matches to NZ_AP017310 (Leptolyngbya sp. NIES-3755 plasmid plasmid2 DNA, complete genome) position: , mismatch: 7, identity: 0.75
ggcaggccccgacagttccctgatcgcg CRISPR spacer
tccaggtgccgacagttccctgatccgt Protospacer
****. *****************