Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 3 crisprs csa3 0 3 2 0
NC_014311 Ralstonia solanacearum PSI07, complete genome 0 crisprs DEDDh,RT,cas3,WYL,csa3,DinG 0 0 4 0

Results visualization

1. NC_014310
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014310_1 425757-425917 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014310_2 684623-684702 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014310_3 2082709-2082810 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 684646-684679 0 1.0
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 587407-587440 0 1.0
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 646231-646264 0 1.0
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 586522-586555 0 1.0
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 585308-585341 0 1.0
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 585298-585331 0 1.0
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 587395-587428 0 1.0
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 587414-587447 0 1.0
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 587392-587425 0 1.0
NC_014310_3 3.1|2082733|25|NC_014310|PILER-CR 2082733-2082757 25 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1986097-1986121 0 1.0
NC_014310_3 3.1|2082733|25|NC_014310|PILER-CR 2082733-2082757 25 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 2082729-2082753 0 1.0
NC_014310_3 3.1|2082733|25|NC_014310|PILER-CR 2082733-2082757 25 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1882148-1882172 0 1.0
NC_014310_3 3.1|2082733|25|NC_014310|PILER-CR 2082733-2082757 25 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 2032659-2032683 0 1.0
NC_014310_3 3.1|2082733|25|NC_014310|PILER-CR 2082733-2082757 25 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1881168-1881192 0 1.0
NC_014310_3 3.1|2082733|25|NC_014310|PILER-CR 2082733-2082757 25 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1984006-1984030 0 1.0
NC_014310_3 3.1|2082733|25|NC_014310|PILER-CR 2082733-2082757 25 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1984008-1984032 0 1.0
NC_014310_3 3.1|2082733|25|NC_014310|PILER-CR 2082733-2082757 25 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1881492-1881516 0 1.0
NC_014310_3 3.1|2082733|25|NC_014310|PILER-CR 2082733-2082757 25 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1881541-1881565 0 1.0
NC_014310_3 3.1|2082733|25|NC_014310|PILER-CR 2082733-2082757 25 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1882128-1882152 0 1.0
NC_014310_3 3.1|2082733|25|NC_014310|PILER-CR 2082733-2082757 25 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1986291-1986315 0 1.0
NC_014310_3 3.1|2082733|25|NC_014310|PILER-CR 2082733-2082757 25 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1986289-1986313 0 1.0
NC_014310_3 3.1|2082733|25|NC_014310|PILER-CR 2082733-2082757 25 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1986253-1986277 0 1.0
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 692043-692076 1 0.971
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 692101-692134 1 0.971
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 692101-692134 1 0.971
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 692090-692123 1 0.971
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1282883-1282916 8 0.765
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 816277-816310 8 0.765
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1128235-1128268 8 0.765
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 636664-636697 8 0.765
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 656773-656806 9 0.735
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 661340-661373 9 0.735
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1530776-1530809 10 0.706
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1397899-1397932 10 0.706
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1460092-1460125 10 0.706
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1396921-1396954 10 0.706
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1441458-1441491 10 0.706
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1441449-1441482 10 0.706
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1397891-1397924 10 0.706
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1397244-1397277 10 0.706
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1397882-1397915 10 0.706
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1475431-1475464 10 0.706
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1475586-1475619 10 0.706
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1475567-1475600 10 0.706
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1475550-1475583 10 0.706
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1300403-1300436 10 0.706
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1286896-1286929 10 0.706
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 542504-542537 10 0.706
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 887904-887937 10 0.706
NC_014310_2 2.1|684646|34|NC_014310|CRISPRCasFinder 684646-684679 34 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 887882-887915 10 0.706
NC_014310_1 1.1|425798|79|NC_014310|CRISPRCasFinder 425798-425876 79 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 425798-425876 19 0.759
NC_014310_1 1.1|425798|79|NC_014310|CRISPRCasFinder 425798-425876 79 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 410042-410120 19 0.759
NC_014310_1 1.1|425798|79|NC_014310|CRISPRCasFinder 425798-425876 79 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 410032-410110 19 0.759
NC_014310_1 1.1|425798|79|NC_014310|CRISPRCasFinder 425798-425876 79 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 414611-414689 20 0.747
NC_014310_1 1.1|425798|79|NC_014310|CRISPRCasFinder 425798-425876 79 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 414611-414689 20 0.747
NC_014310_1 1.1|425798|79|NC_014310|CRISPRCasFinder 425798-425876 79 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 414623-414701 20 0.747
NC_014310_1 1.1|425798|79|NC_014310|CRISPRCasFinder 425798-425876 79 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 414644-414722 20 0.747
NC_014310_1 1.1|425798|79|NC_014310|CRISPRCasFinder 425798-425876 79 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 414610-414688 20 0.747

1. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 0, identity: 1.0

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cgggcgacatcacgccgatggcaccgatggacac	Protospacer
**********************************

2. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cgggcgacatcacgccgatggcaccgatggacac	Protospacer
**********************************

3. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cgggcgacatcacgccgatggcaccgatggacac	Protospacer
**********************************

4. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 0, identity: 1.0

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cgggcgacatcacgccgatggcaccgatggacac	Protospacer
**********************************

5. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cgggcgacatcacgccgatggcaccgatggacac	Protospacer
**********************************

6. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cgggcgacatcacgccgatggcaccgatggacac	Protospacer
**********************************

7. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cgggcgacatcacgccgatggcaccgatggacac	Protospacer
**********************************

8. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cgggcgacatcacgccgatggcaccgatggacac	Protospacer
**********************************

9. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cgggcgacatcacgccgatggcaccgatggacac	Protospacer
**********************************

10. spacer 3.1|2082733|25|NC_014310|PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgatttccgtgggccctctattcat	CRISPR spacer
cgatttccgtgggccctctattcat	Protospacer
*************************

11. spacer 3.1|2082733|25|NC_014310|PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 0, identity: 1.0

cgatttccgtgggccctctattcat	CRISPR spacer
cgatttccgtgggccctctattcat	Protospacer
*************************

12. spacer 3.1|2082733|25|NC_014310|PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgatttccgtgggccctctattcat	CRISPR spacer
cgatttccgtgggccctctattcat	Protospacer
*************************

13. spacer 3.1|2082733|25|NC_014310|PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgatttccgtgggccctctattcat	CRISPR spacer
cgatttccgtgggccctctattcat	Protospacer
*************************

14. spacer 3.1|2082733|25|NC_014310|PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 0, identity: 1.0

cgatttccgtgggccctctattcat	CRISPR spacer
cgatttccgtgggccctctattcat	Protospacer
*************************

15. spacer 3.1|2082733|25|NC_014310|PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgatttccgtgggccctctattcat	CRISPR spacer
cgatttccgtgggccctctattcat	Protospacer
*************************

16. spacer 3.1|2082733|25|NC_014310|PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgatttccgtgggccctctattcat	CRISPR spacer
cgatttccgtgggccctctattcat	Protospacer
*************************

17. spacer 3.1|2082733|25|NC_014310|PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgatttccgtgggccctctattcat	CRISPR spacer
cgatttccgtgggccctctattcat	Protospacer
*************************

18. spacer 3.1|2082733|25|NC_014310|PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgatttccgtgggccctctattcat	CRISPR spacer
cgatttccgtgggccctctattcat	Protospacer
*************************

19. spacer 3.1|2082733|25|NC_014310|PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgatttccgtgggccctctattcat	CRISPR spacer
cgatttccgtgggccctctattcat	Protospacer
*************************

20. spacer 3.1|2082733|25|NC_014310|PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgatttccgtgggccctctattcat	CRISPR spacer
cgatttccgtgggccctctattcat	Protospacer
*************************

21. spacer 3.1|2082733|25|NC_014310|PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgatttccgtgggccctctattcat	CRISPR spacer
cgatttccgtgggccctctattcat	Protospacer
*************************

22. spacer 3.1|2082733|25|NC_014310|PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgatttccgtgggccctctattcat	CRISPR spacer
cgatttccgtgggccctctattcat	Protospacer
*************************

23. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.971

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cgggcgacattacgccgatggcaccgatggacac	Protospacer
**********.***********************

24. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.971

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cgggcgacattacgccgatggcaccgatggacac	Protospacer
**********.***********************

25. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.971

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cgggcgacattacgccgatggcaccgatggacac	Protospacer
**********.***********************

26. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.971

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cgggcgacattacgccgatggcaccgatggacac	Protospacer
**********.***********************

27. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.765

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cgctcaacagcacgccgatcgcaccgatggcgaa	Protospacer
**  *.*** ********* **********  * 

28. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.765

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cgctcaacagcacgccaatggcaccgatggcgaa	Protospacer
**  *.*** ******.*************  * 

29. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.765

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cgctcaacagcacgccgatcgcaccgatggcgaa	Protospacer
**  *.*** ********* **********  * 

30. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 8, identity: 0.765

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cgctcaacagcacgccaatggcaccgatggcgaa	Protospacer
**  *.*** ******.*************  * 

31. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.735

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cgcgcgacatcacgccgatggcgccatccgatgt	Protospacer
** *******************.**. . **...

32. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 9, identity: 0.735

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
cactcaacagcacgccgatcgcaccgatggcgaa	Protospacer
*.  *.*** ********* **********  * 

33. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
tgacgaagctcgcgccgatggcaccgatggccag	Protospacer
.*.  .*  **.****************** ** 

34. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
tgacgaagctcgcgccgatggcaccgatggccag	Protospacer
.*.  .*  **.****************** ** 

35. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
tgacgaagctcgcgccgatggcaccgatggccag	Protospacer
.*.  .*  **.****************** ** 

36. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
tgacgaagctcgcgccgatggcaccgatggccag	Protospacer
.*.  .*  **.****************** ** 

37. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
tgacgaagctcgcgccgatggcaccgatggccag	Protospacer
.*.  .*  **.****************** ** 

38. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
tgacgaagctcgcgccgatggcaccgatggccag	Protospacer
.*.  .*  **.****************** ** 

39. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
tgacgaagctcgcgccgatggcaccgatggccag	Protospacer
.*.  .*  **.****************** ** 

40. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
tgacgaagctcgcgccgatggcaccgatggccag	Protospacer
.*.  .*  **.****************** ** 

41. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
tgacgaagctcgcgccgatggcaccgatggccag	Protospacer
.*.  .*  **.****************** ** 

42. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
tgacgaagctcgcgccgatggcaccgatggccag	Protospacer
.*.  .*  **.****************** ** 

43. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
tgacgaagctcgcgccgatggcaccgatggccag	Protospacer
.*.  .*  **.****************** ** 

44. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
tgacgaagctcgcgccgatggcaccgatggccag	Protospacer
.*.  .*  **.****************** ** 

45. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
tgacgaagctcgcgccgatggcaccgatggccag	Protospacer
.*.  .*  **.****************** ** 

46. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
tgacgaagctcgcgccgatggcaccgatggccag	Protospacer
.*.  .*  **.****************** ** 

47. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
tgacgaagctcgcgccgatggcaccgatggccag	Protospacer
.*.  .*  **.****************** ** 

48. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
tgacgaagctcgcgccgatggcaccgatggccag	Protospacer
.*.  .*  **.****************** ** 

49. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
tgacgaagctcgcgccgatggcaccgatggccag	Protospacer
.*.  .*  **.****************** ** 

50. spacer 2.1|684646|34|NC_014310|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgacatcacgccgatggcaccgatggacac	CRISPR spacer
tgacgaagctcgcgccgatggcaccgatggccag	Protospacer
.*.  .*  **.****************** ** 

51. spacer 1.1|425798|79|NC_014310|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 19, identity: 0.759

aggcgcgaaggccggcagcaagttcgatccgtacacggacggtgcgctcgcgcgcgttgg	CRISPR spacer
aggcgcgaaggccggcagcaagttcgatccgtacacggacggtgcgctcgcgcgcgttgg	Protospacer
************************************************************

52. spacer 1.1|425798|79|NC_014310|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 19, identity: 0.759

aggcgcgaaggccggcagcaagttcgatccgtacacggacggtgcgctcgcgcgcgttgg	CRISPR spacer
aggcgcgaaggccggcagcaagttcgatccgtacacggacggtgcgctcgcgcgcgttgg	Protospacer
************************************************************

53. spacer 1.1|425798|79|NC_014310|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 19, identity: 0.759

aggcgcgaaggccggcagcaagttcgatccgtacacggacggtgcgctcgcgcgcgttgg	CRISPR spacer
aggcgcgaaggccggcagcaagttcgatccgtacacggacggtgcgctcgcgcgcgttgg	Protospacer
************************************************************

54. spacer 1.1|425798|79|NC_014310|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 20, identity: 0.747

aggcgcgaaggccggcagcaagttcgatccgtacacggacggtgcgctcgcgcgcgttgg	CRISPR spacer
aggcgcgaaggccggcagcaagttcgatccgtacacggacggtgcgctcgcgcgcgtcgg	Protospacer
*********************************************************.**

55. spacer 1.1|425798|79|NC_014310|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 20, identity: 0.747

aggcgcgaaggccggcagcaagttcgatccgtacacggacggtgcgctcgcgcgcgttgg	CRISPR spacer
aggcgcgaaggccggcagcaagttcgatccgtacacggacggtgcgctcgcgcgcgtcgg	Protospacer
*********************************************************.**

56. spacer 1.1|425798|79|NC_014310|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 20, identity: 0.747

aggcgcgaaggccggcagcaagttcgatccgtacacggacggtgcgctcgcgcgcgttgg	CRISPR spacer
aggcgcgaaggccggcagcaagttcgatccgtacacggacggtgcgctcgcgcgcgtcgg	Protospacer
*********************************************************.**

57. spacer 1.1|425798|79|NC_014310|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 20, identity: 0.747

aggcgcgaaggccggcagcaagttcgatccgtacacggacggtgcgctcgcgcgcgttgg	CRISPR spacer
aggcgcgaaggccggcagcaagttcgatccgtacacggacggtgcgctcgcgcgcgtcgg	Protospacer
*********************************************************.**

58. spacer 1.1|425798|79|NC_014310|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 20, identity: 0.747

aggcgcgaaggccggcagcaagttcgatccgtacacggacggtgcgctcgcgcgcgttgg	CRISPR spacer
aggcgcgaaggccggcagcaagttcgatccgtacacggacggtgcgctcgcgcgcgtcgg	Protospacer
*********************************************************.**

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 802793 : 825798 17 Vibrio_phage(50.0%) plate,transposase NA
DBSCAN-SWA_2 1149791 : 1194060 27 Haemophilus_phage(25.0%) protease,coat,tail,integrase attL 1135615:1135630|attR 1168252:1168267
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_014311
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 209824 : 242180 41 Acidithiobacillus_phage(58.06%) portal,capsid,terminase,head NA
DBSCAN-SWA_2 252407 : 261439 9 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_3 889640 : 899771 9 Hokovirus(14.29%) NA NA
DBSCAN-SWA_4 2581467 : 2589700 8 Bacillus_virus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage