Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_018265 Melissococcus plutonius DAT561 plasmid 1, complete sequence 1 crisprs NA 0 1 0 0
NC_016938 Melissococcus plutonius DAT561 chromosome 1, complete sequence 1 crisprs cas3,cas5,cas8c,cas7,cas4,cas1,csa3 0 1 3 0

Results visualization

1. NC_018265
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018265_1 119602-119688 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP006684 Melissococcus plutonius S1 plasmid pMEPL_178, complete sequence 72811-72843 0 1.0
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_AP021886 Melissococcus plutonius strain DAT1033 plasmid pMP1, complete sequence 72809-72841 0 1.0
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_AP018525 Melissococcus plutonius strain DAT585 plasmid pMP1, complete sequence 72911-72943 0 1.0
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NC_018265 Melissococcus plutonius DAT561 plasmid 1, complete sequence 119629-119661 0 1.0
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP017620 Salmonella enterica subsp. enterica serovar Typhimurium strain 22792 plasmid unnamed1, complete sequence 69518-69550 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP041027 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 plasmid pSA20143792.1, complete sequence 19402-19434 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP017618 Salmonella enterica subsp. enterica serovar Typhimurium strain 22495 plasmid unnamed1, complete sequence 61854-61886 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP014980 Salmonella enterica subsp. enterica serovar Typhimurium str. CDC H2662 plasmid pSTY1-H2662, complete sequence 63290-63322 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP014970 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1808 isolate ST1126-1 plasmid pSTY1-1808, complete sequence 63252-63284 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP014968 Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 plasmid pSTY1-2011K-1702, complete sequence 63254-63286 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP037873 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014854 plasmid pPNCS014854_S1, complete sequence 57557-57589 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP040669 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20082869 plasmid pSA20082869.1, complete sequence 102162-102194 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP014973 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY2-1898, complete sequence 63189-63221 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 CP038435 Salmonella enterica subsp. enterica serovar Typhimurium strain E40V plasmid unnamed, complete sequence 57545-57577 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP014976 Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-1640 plasmid pSTY1-2009K-1640, complete sequence 63266-63298 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NC_017054 Salmonella enterica subsp. enterica serovar Typhimurium str. 798 plasmid p798_93, complete sequence 63114-63146 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP047324 Salmonella enterica subsp. enterica serovar Typhimurium strain RM13672 plasmid pRM13672, complete sequence 63168-63200 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP014537 Salmonella enterica subsp. enterica serovar Typhimurium strain SO3 isolate SOHS 02-68 plasmid pSO3_STV, complete sequence 63180-63212 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NC_022570 Salmonella enterica subsp. enterica serovar Typhimurium str. DT104 unnamed plasmid, complete sequence 63271-63303 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP039560 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.2, complete sequence 93134-93166 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP039586 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014859 plasmid p11-0225.1, complete sequence 93223-93255 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_LN999012 Salmonella enterica subsp. enterica serovar Typhimurium str. DT2 plasmid pSLT, complete sequence 63180-63212 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 CP038433 Salmonella enterica subsp. enterica serovar Typhimurium strain E40 plasmid unnamed, complete sequence 57545-57577 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP016390 Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid pSLT931, complete sequence 63191-63223 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP025556 Salmonella enterica subsp. enterica serovar Typhimurium strain PIR00538 plasmid pPIR00538, complete sequence 10556-10588 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP039855 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014864 plasmid p11-0972.1, complete sequence 93193-93225 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP034231 Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028 plasmid pATCC14028, complete sequence 12249-12281 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NC_014476 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pYT1 DNA, complete sequence 79073-79105 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP017729 Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 plasmid pSARA13, complete sequence 48394-48426 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP008745 Salmonella enterica subsp. enterica serovar Typhimurium strain VNP20009 plasmid pSLT_VNP20009, complete sequence 63168-63200 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP007582 Salmonella enterica subsp. enterica serovar Typhimurium strain 138736 plasmid, complete sequence 61805-61837 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP039566 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014849 plasmid p08-7727.1, complete sequence 93134-93166 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NC_013437 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSLT-BT, complete sequence 82979-83011 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NC_019001 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pYT2, complete sequence 99245-99277 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 CP051281 Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Junco_ST-35 plasmid pST35-99574.1A, complete sequence 75716-75748 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_AP014566 Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553 plasmid pST3553, complete sequence 99014-99046 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 LN794247 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSBLT, complete sequence 97834-97866 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP041974 Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 plasmid unnamed1, complete sequence 25556-25588 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP039580 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014857 plasmid p10-3881.1, complete sequence 110229-110261 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP039583 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014858 plasmid p10-8609.1, complete sequence 93296-93328 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP044969 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS007087.2, complete sequence 91520-91552 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP039596 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014865 plasmid p12-4331.1, complete sequence 93134-93166 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP039592 Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014862 plasmid p11-0500.1, complete sequence 93294-93326 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP039568 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014850 plasmid p08-8136.1, complete sequence 93133-93165 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 CP014577 Salmonella enterica subsp. enterica serovar Typhimurium strain RM9437 plasmid pRM9437, complete sequence 63187-63219 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 CP013721 Salmonella enterica subsp. enterica serovar Typhimurium strain RM10607 plasmid pRM10607, complete sequence 63182-63214 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NC_016864 Salmonella enterica subsp. enterica serovar Typhimurium str. UK-1 plasmid pSTUK-100, complete sequence 44979-45011 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP020113 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 plasmid pSTY1-1810, complete sequence 109078-109110 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP014962 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 plasmid pSTY1-1899, complete sequence 63187-63219 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 CP053407 Salmonella enterica strain 87-0091 plasmid unnamed, complete sequence 32718-32750 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NC_016861 Salmonella enterica subsp. enterica serovar Typhimurium str. T000240 plasmid pSTMDT12_L, complete sequence 75774-75806 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP021464 Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_2, complete sequence 95843-95875 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP014050 Salmonella enterica strain FDAARGOS_94 plasmid unnamed, complete sequence 5666-5698 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP038848 Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014851 plasmid p09-0499.1, complete sequence 93158-93190 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP050736 Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-2, complete sequence 34401-34433 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP040565 Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7699 plasmid pCFSAN059544, complete sequence 12096-12128 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NC_003277 Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 plasmid pSLT, complete sequence 63188-63220 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP051268 Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Hawk_ST-33 plasmid pST33-93798, complete sequence 42823-42855 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NC_016855 Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S plasmid unnamed, complete sequence 63168-63200 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_LT855377 Salmonella enterica subsp. enterica serovar Typhimurium isolate STMU2UK plasmid 2 63198-63230 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP014359 Salmonella enterica subsp. enterica serovar Typhimurium strain YU15 plasmid pYU15_94, complete sequence 63277-63309 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP015158 Salmonella enterica subsp. enterica serovar Typhimurium strain NC983 plasmid unnamed, complete sequence 63165-63197 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP014357 Salmonella enterica subsp. enterica serovar Typhimurium strain SO2 isolate SOHS 02-20 plasmid pSO2_STV, complete sequence 63173-63205 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP023469 Salmonella enterica subsp. enterica strain BAA-1586 plasmid pSalMiami, complete sequence 64066-64098 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP050741 Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-2, complete sequence 19715-19747 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP040901 Salmonella enterica subsp. enterica serovar Typhimurium strain SAP18-6199 plasmid pCFSAN074387, complete sequence 57566-57598 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP040322 Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 plasmid p16-6397.1, complete sequence 93207-93239 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP015599 Salmonella enterica strain FORC_030 plasmid pFORC_030, complete sequence 58310-58342 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP026701 Salmonella enterica subsp. enterica serovar Typhimurium strain AR_0031 plasmid unitig_1_pilon, complete sequence 23282-23314 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 KX777254 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTV-Mu1, complete sequence 61237-61269 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP046282 Salmonella enterica strain FDAARGOS_687 plasmid unnamed1, complete sequence 46916-46948 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP035302 Salmonella enterica subsp. enterica strain ST1539 plasmid pST1539, complete sequence 58730-58762 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP040569 Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-8290 plasmid pCFSAN059542, complete sequence 25030-25062 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP037876 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S3, complete sequence 31858-31890 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP020923 Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed1, complete sequence 50562-50594 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP039577 Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014856 plasmid p10-3857.1, complete sequence 44063-44095 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP034480 Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 plasmid unnamed, complete sequence 48245-48277 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP050746 Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-1, complete sequence 60166-60198 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP053871 Salmonella enterica subsp. enterica serovar Typhimurium strain SS2017 plasmid pSS2017-1, complete sequence 31970-32002 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP053866 Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-1, complete sequence 30632-30664 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP041006 Salmonella enterica strain FDAARGOS_768 plasmid unnamed1, complete sequence 43731-43763 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP022137 Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 plasmid unnamed2, complete sequence 54466-54498 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP029594 Salmonella enterica strain DA34827 plasmid pDA34827-94, complete sequence 12503-12535 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 CP051287 Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Gull_ST-29 plasmid pST29-94038, complete sequence 41572-41604 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP034720 Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 plasmid pRSE04, complete sequence 48317-48349 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP029596 Salmonella enterica strain DA34833 plasmid pDA34833-94, complete sequence 39378-39410 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 CP051277 Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Sparrow_ST-87 plasmid pST87-92921, complete sequence 64932-64964 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_LS997974 Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 isolate D23580_liv plasmid D23580_liv_pSLT-BT 48221-48253 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP044959 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.2, complete sequence 48245-48277 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP029838 Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 plasmid p10ST07093B, complete sequence 8635-8667 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NC_019108 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal6919a, complete sequence 33421-33453 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NC_019109 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal8934b, complete sequence 33421-33453 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP018634 Salmonella enterica subsp. enterica serovar Enteritidis strain 49-2444 plasmid pSE49-2444, complete sequence 1896-1928 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP022071 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed1, complete sequence 12443-12475 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP029841 Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence 48245-48277 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP027413 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_320 plasmid unnamed2, complete sequence 44014-44046 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP027409 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence 42055-42087 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP018658 Salmonella enterica subsp. enterica serovar Enteritidis strain 92-0392 plasmid pSE92-0392, complete sequence 57287-57319 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP028200 Salmonella enterica subsp. enterica serovar Typhimurium strain CFSAN018746 plasmid pGMI14-001, complete sequence 339-371 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NC_021155 Salmonella enterica subsp. enterica serovar Typhimurium str. U288 plasmid pSTU288-1, complete sequence 73920-73952 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP028319 Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067216 plasmid pSC-09-1, complete sequence 59214-59246 9 0.727
NC_018265_1 1.1|119629|33|NC_018265|CRISPRCasFinder 119629-119661 33 NZ_CP045950 Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 plasmid pAUSMDU00010529_01, complete sequence 48257-48289 9 0.727

1. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP006684 (Melissococcus plutonius S1 plasmid pMEPL_178, complete sequence) position: , mismatch: 0, identity: 1.0

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
ggttttctctccgcccttttttccgttttcttc	Protospacer
*********************************

2. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_AP021886 (Melissococcus plutonius strain DAT1033 plasmid pMP1, complete sequence) position: , mismatch: 0, identity: 1.0

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
ggttttctctccgcccttttttccgttttcttc	Protospacer
*********************************

3. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_AP018525 (Melissococcus plutonius strain DAT585 plasmid pMP1, complete sequence) position: , mismatch: 0, identity: 1.0

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
ggttttctctccgcccttttttccgttttcttc	Protospacer
*********************************

4. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NC_018265 (Melissococcus plutonius DAT561 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
ggttttctctccgcccttttttccgttttcttc	Protospacer
*********************************

5. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP017620 (Salmonella enterica subsp. enterica serovar Typhimurium strain 22792 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

6. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP041027 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20143792 plasmid pSA20143792.1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

7. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP017618 (Salmonella enterica subsp. enterica serovar Typhimurium strain 22495 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

8. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP014980 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC H2662 plasmid pSTY1-H2662, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

9. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP014970 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1808 isolate ST1126-1 plasmid pSTY1-1808, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

10. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP014968 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 plasmid pSTY1-2011K-1702, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

11. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP037873 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014854 plasmid pPNCS014854_S1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

12. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP040669 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20082869 plasmid pSA20082869.1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

13. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP014973 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY2-1898, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

14. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to CP038435 (Salmonella enterica subsp. enterica serovar Typhimurium strain E40V plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

15. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP014976 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-1640 plasmid pSTY1-2009K-1640, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

16. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NC_017054 (Salmonella enterica subsp. enterica serovar Typhimurium str. 798 plasmid p798_93, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

17. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP047324 (Salmonella enterica subsp. enterica serovar Typhimurium strain RM13672 plasmid pRM13672, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

18. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP014537 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO3 isolate SOHS 02-68 plasmid pSO3_STV, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

19. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NC_022570 (Salmonella enterica subsp. enterica serovar Typhimurium str. DT104 unnamed plasmid, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

20. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP039560 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.2, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

21. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP039586 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014859 plasmid p11-0225.1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

22. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_LN999012 (Salmonella enterica subsp. enterica serovar Typhimurium str. DT2 plasmid pSLT, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

23. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to CP038433 (Salmonella enterica subsp. enterica serovar Typhimurium strain E40 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

24. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP016390 (Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid pSLT931, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

25. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP025556 (Salmonella enterica subsp. enterica serovar Typhimurium strain PIR00538 plasmid pPIR00538, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

26. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP039855 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014864 plasmid p11-0972.1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

27. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP034231 (Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028 plasmid pATCC14028, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

28. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NC_014476 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pYT1 DNA, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

29. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP017729 (Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 plasmid pSARA13, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

30. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP008745 (Salmonella enterica subsp. enterica serovar Typhimurium strain VNP20009 plasmid pSLT_VNP20009, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

31. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP007582 (Salmonella enterica subsp. enterica serovar Typhimurium strain 138736 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

32. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP039566 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014849 plasmid p08-7727.1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

33. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NC_013437 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSLT-BT, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

34. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NC_019001 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pYT2, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

35. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to CP051281 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Junco_ST-35 plasmid pST35-99574.1A, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

36. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_AP014566 (Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553 plasmid pST3553, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

37. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to LN794247 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSBLT, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

38. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP041974 (Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

39. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP039580 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014857 plasmid p10-3881.1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

40. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP039583 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014858 plasmid p10-8609.1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

41. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP044969 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS007087.2, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

42. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP039596 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014865 plasmid p12-4331.1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

43. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP039592 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014862 plasmid p11-0500.1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

44. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP039568 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014850 plasmid p08-8136.1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

45. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to CP014577 (Salmonella enterica subsp. enterica serovar Typhimurium strain RM9437 plasmid pRM9437, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

46. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to CP013721 (Salmonella enterica subsp. enterica serovar Typhimurium strain RM10607 plasmid pRM10607, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

47. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NC_016864 (Salmonella enterica subsp. enterica serovar Typhimurium str. UK-1 plasmid pSTUK-100, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

48. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP020113 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 plasmid pSTY1-1810, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

49. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP014962 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 plasmid pSTY1-1899, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

50. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to CP053407 (Salmonella enterica strain 87-0091 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

51. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NC_016861 (Salmonella enterica subsp. enterica serovar Typhimurium str. T000240 plasmid pSTMDT12_L, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

52. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP021464 (Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_2, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

53. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP014050 (Salmonella enterica strain FDAARGOS_94 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

54. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP038848 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014851 plasmid p09-0499.1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

55. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP050736 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-2, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

56. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP040565 (Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7699 plasmid pCFSAN059544, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

57. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NC_003277 (Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 plasmid pSLT, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

58. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP051268 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Hawk_ST-33 plasmid pST33-93798, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

59. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NC_016855 (Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

60. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_LT855377 (Salmonella enterica subsp. enterica serovar Typhimurium isolate STMU2UK plasmid 2) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

61. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP014359 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU15 plasmid pYU15_94, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

62. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP015158 (Salmonella enterica subsp. enterica serovar Typhimurium strain NC983 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

63. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP014357 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO2 isolate SOHS 02-20 plasmid pSO2_STV, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

64. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP023469 (Salmonella enterica subsp. enterica strain BAA-1586 plasmid pSalMiami, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

65. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP050741 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-2, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

66. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP040901 (Salmonella enterica subsp. enterica serovar Typhimurium strain SAP18-6199 plasmid pCFSAN074387, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

67. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP040322 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 plasmid p16-6397.1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

68. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP015599 (Salmonella enterica strain FORC_030 plasmid pFORC_030, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

69. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP026701 (Salmonella enterica subsp. enterica serovar Typhimurium strain AR_0031 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

70. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to KX777254 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTV-Mu1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

71. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP046282 (Salmonella enterica strain FDAARGOS_687 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

72. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP035302 (Salmonella enterica subsp. enterica strain ST1539 plasmid pST1539, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

73. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP040569 (Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-8290 plasmid pCFSAN059542, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

74. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP037876 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S3, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

75. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP020923 (Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

76. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP039577 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014856 plasmid p10-3857.1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

77. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP034480 (Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

78. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP050746 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

79. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP053871 (Salmonella enterica subsp. enterica serovar Typhimurium strain SS2017 plasmid pSS2017-1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

80. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP053866 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

81. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP041006 (Salmonella enterica strain FDAARGOS_768 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

82. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP022137 (Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

83. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP029594 (Salmonella enterica strain DA34827 plasmid pDA34827-94, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

84. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to CP051287 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Gull_ST-29 plasmid pST29-94038, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

85. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP034720 (Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 plasmid pRSE04, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

86. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP029596 (Salmonella enterica strain DA34833 plasmid pDA34833-94, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

87. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to CP051277 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Sparrow_ST-87 plasmid pST87-92921, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

88. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_LS997974 (Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 isolate D23580_liv plasmid D23580_liv_pSLT-BT) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

89. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP044959 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.2, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

90. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP029838 (Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 plasmid p10ST07093B, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

91. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NC_019108 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal6919a, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

92. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NC_019109 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal8934b, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

93. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP018634 (Salmonella enterica subsp. enterica serovar Enteritidis strain 49-2444 plasmid pSE49-2444, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

94. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP022071 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

95. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP029841 (Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

96. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP027413 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_320 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

97. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

98. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP018658 (Salmonella enterica subsp. enterica serovar Enteritidis strain 92-0392 plasmid pSE92-0392, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

99. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP028200 (Salmonella enterica subsp. enterica serovar Typhimurium strain CFSAN018746 plasmid pGMI14-001, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

100. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NC_021155 (Salmonella enterica subsp. enterica serovar Typhimurium str. U288 plasmid pSTU288-1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

101. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP028319 (Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067216 plasmid pSC-09-1, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

102. spacer 1.1|119629|33|NC_018265|CRISPRCasFinder matches to NZ_CP045950 (Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 plasmid pAUSMDU00010529_01, complete sequence) position: , mismatch: 9, identity: 0.727

ggttttctctccgcccttttttccgttttcttc	CRISPR spacer
aggagcttccccgcccttttttcagttttctta	Protospacer
.*   ..**.************* ******** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_016938
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_016938_1 420406-421322 TypeI NA
13 spacers
cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_016938_1 1.3|420573|34|NC_016938|PILER-CR,CRISPRCasFinder,CRT 420573-420606 34 MH319754 Marine virus AG-345-L05 Ga0172272_11 genomic sequence 1043-1076 10 0.706

1. spacer 1.3|420573|34|NC_016938|PILER-CR,CRISPRCasFinder,CRT matches to MH319754 (Marine virus AG-345-L05 Ga0172272_11 genomic sequence) position: , mismatch: 10, identity: 0.706

agtgttggtggtgctagaataaataaagatggag	CRISPR spacer
agtgttgctggtgctagaataactattgcatact	Protospacer
******* ************** **  *   .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 604855 : 615133 13 Lactococcus_phage(40.0%) plate,holin,tail NA
DBSCAN-SWA_2 666429 : 675419 9 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_3 1458005 : 1466468 8 Streptococcus_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage