Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017044 Rickettsia parkeri str. Portsmouth, complete genome 1 crisprs PD-DExK,cas3,DEDDh 3 1 0 0

Results visualization

1. NC_017044
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017044_1 887821-887970 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_017044_1 1.1|887842|18|NC_017044|CRT 887842-887859 18 NC_017044.1 887971-887988 0 1.0
NC_017044_1 1.2|887881|30|NC_017044|CRT 887881-887910 30 NC_017044.1 887959-887988 0 1.0
NC_017044_1 1.3|887932|18|NC_017044|CRT 887932-887949 18 NC_017044.1 887971-887988 0 1.0

1. spacer 1.1|887842|18|NC_017044|CRT matches to position: 887971-887988, mismatch: 0, identity: 1.0

gtgttattttccggtaaa	CRISPR spacer
gtgttattttccggtaaa	Protospacer
******************

2. spacer 1.2|887881|30|NC_017044|CRT matches to position: 887959-887988, mismatch: 0, identity: 1.0

ggtggtgatggagtgttattttccggtaaa	CRISPR spacer
ggtggtgatggagtgttattttccggtaaa	Protospacer
******************************

3. spacer 1.3|887932|18|NC_017044|CRT matches to position: 887971-887988, mismatch: 0, identity: 1.0

gtgttattttccggtaaa	CRISPR spacer
gtgttattttccggtaaa	Protospacer
******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017044_1 1.2|887881|30|NC_017044|CRT 887881-887910 30 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 285236-285265 7 0.767

1. spacer 1.2|887881|30|NC_017044|CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 7, identity: 0.767

ggtggtgatggagtgttattttccggtaaa	CRISPR spacer
tggaaagatggagtgatattttccagtaaa	Protospacer
 * .. ********* ********.*****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage