Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017096 Caldisericum exile AZM16c01, complete genome 2 crisprs csa3,cas6,cas8b2,cas7,cas5,cas3,cas4,cas1,cas2,DEDDh,Cas14b_CAS-V-F,cas10 0 2 1 0

Results visualization

1. NC_017096
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017096_1 14727-14834 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017096_2 269623-271081 Unclear I-A
22 spacers
cas2,cas1,cas4,cas3,cas5,cas7,cas8b2,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017096_2 2.6|269978|36|NC_017096|PILER-CR,CRISPRCasFinder,CRT 269978-270013 36 NZ_CP007066 Fusobacterium nucleatum subsp. vincentii 3_1_27 plasmid, complete sequence 9483-9518 7 0.806
NC_017096_2 2.4|269850|35|NC_017096|PILER-CR,CRISPRCasFinder,CRT 269850-269884 35 MN857617 Bacillus virus SRT01hs, complete genome 20239-20273 10 0.714

1. spacer 2.6|269978|36|NC_017096|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007066 (Fusobacterium nucleatum subsp. vincentii 3_1_27 plasmid, complete sequence) position: , mismatch: 7, identity: 0.806

gcaagaaatttaaaagtagaagcaagagatttaata	CRISPR spacer
gaaaaacaactaaaagaagcagcaagagatttaata	Protospacer
* **.* * .****** ** ****************

2. spacer 2.4|269850|35|NC_017096|PILER-CR,CRISPRCasFinder,CRT matches to MN857617 (Bacillus virus SRT01hs, complete genome) position: , mismatch: 10, identity: 0.714

caaaaagaaagat--------aggaggtgagaaaatggaatta	CRISPR spacer
--------aaggttctctgaaaggaggtgataaaatggaatta	Protospacer
        ***.*        ********* ************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1172727 : 1186793 15 uncultured_virus(22.22%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage