Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_018676 Candidatus Portiera aleyrodidarum BT-QVLC, complete sequence 5 crisprs NA 1 2 0 0

Results visualization

1. NC_018676
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018676_1 126934-127013 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018676_2 187122-187356 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018676_3 269633-269751 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018676_4 293036-293129 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018676_5 331776-331862 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_018676_2 2.3|187274|15|NC_018676|CRISPRCasFinder 187274-187288 15 NC_018676.1 252592-252606 1 0.933

1. spacer 2.3|187274|15|NC_018676|CRISPRCasFinder matches to position: 252592-252606, mismatch: 1, identity: 0.933

gagttgtatggaaga	CRISPR spacer
gagttgtatagaaga	Protospacer
*********.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_018676_1 1.1|126958|32|NC_018676|CRISPRCasFinder 126958-126989 32 NZ_KU295134 Escherichia coli strain BK32602 plasmid pBK32602, complete sequence 40502-40533 7 0.781
NC_018676_1 1.1|126958|32|NC_018676|CRISPRCasFinder 126958-126989 32 NZ_CP020059 Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence 24278-24309 7 0.781
NC_018676_3 3.1|269677|31|NC_018676|CRISPRCasFinder 269677-269707 31 MN693311 Marine virus AFVG_25M388, complete genome 7585-7615 8 0.742
NC_018676_3 3.1|269677|31|NC_018676|CRISPRCasFinder 269677-269707 31 MN693313 Marine virus AFVG_25M387, complete genome 29099-29129 8 0.742
NC_018676_3 3.1|269677|31|NC_018676|CRISPRCasFinder 269677-269707 31 KM359505 Prochlorococcus phage P-TIM68, complete genome 157901-157931 8 0.742

1. spacer 1.1|126958|32|NC_018676|CRISPRCasFinder matches to NZ_KU295134 (Escherichia coli strain BK32602 plasmid pBK32602, complete sequence) position: , mismatch: 7, identity: 0.781

-aacatcacctcttaaatcttaaaagcaacctt	CRISPR spacer
tcacatt-ccttttaaatattaaaagcaaccca	Protospacer
  ****. ***.****** ************. 

2. spacer 1.1|126958|32|NC_018676|CRISPRCasFinder matches to NZ_CP020059 (Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence) position: , mismatch: 7, identity: 0.781

-aacatcacctcttaaatcttaaaagcaacctt	CRISPR spacer
tcacatt-ccttttaaatattaaaagcaaccca	Protospacer
  ****. ***.****** ************. 

3. spacer 3.1|269677|31|NC_018676|CRISPRCasFinder matches to MN693311 (Marine virus AFVG_25M388, complete genome) position: , mismatch: 8, identity: 0.742

aataactaacagataaccattttatttatta	CRISPR spacer
tgttcaaaacagataaacattttatttatga	Protospacer
 .*    ********* ************ *

4. spacer 3.1|269677|31|NC_018676|CRISPRCasFinder matches to MN693313 (Marine virus AFVG_25M387, complete genome) position: , mismatch: 8, identity: 0.742

aataactaacagataaccattttatttatta	CRISPR spacer
tgttcaaaacagataaacattttatttatga	Protospacer
 .*    ********* ************ *

5. spacer 3.1|269677|31|NC_018676|CRISPRCasFinder matches to KM359505 (Prochlorococcus phage P-TIM68, complete genome) position: , mismatch: 8, identity: 0.742

aataactaacagataaccattttatttatta	CRISPR spacer
cataattatcagataaccattttaaatgtgc	Protospacer
 ****.** ***************  *.*  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage