Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_018673 Leuconostoc carnosum JB16, complete sequence 1 crisprs cas3,DEDDh,csa3 0 0 1 0
NC_018674 Leuconostoc carnosum JB16 plasmid pKLC1, complete sequence 0 crisprs NA 0 0 0 0
NC_018698 Leuconostoc carnosum JB16 plasmid pKLC2, complete sequence 0 crisprs NA 0 0 1 0
NC_018699 Leuconostoc carnosum JB16 plasmid pKLC4, complete sequence 1 crisprs NA 0 1 0 0
NC_018675 Leuconostoc carnosum JB16 plasmid pKLC3, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_018673
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018673_1 781790-781874 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1044382 : 1053137 9 Cyanophage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_018698
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8687 : 15465 10 Staphylococcus_phage(33.33%) integrase,transposase attL 9266:9279|attR 12883:12896
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_018699
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018699_1 9494-9596 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_018699_1 1.1|9531|29|NC_018699|CRISPRCasFinder 9531-9559 29 NC_018699 Leuconostoc carnosum JB16 plasmid pKLC4, complete sequence 9531-9559 0 1.0
NC_018699_1 1.1|9531|29|NC_018699|CRISPRCasFinder 9531-9559 29 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 612749-612777 6 0.793
NC_018699_1 1.1|9531|29|NC_018699|CRISPRCasFinder 9531-9559 29 NZ_CP018877 Bacillus megaterium strain JX285 plasmid 4, complete sequence 18767-18795 6 0.793
NC_018699_1 1.1|9531|29|NC_018699|CRISPRCasFinder 9531-9559 29 NZ_CP048424 Rhizobium daejeonense strain KACC 13094 plasmid unnamed1, complete sequence 173555-173583 7 0.759
NC_018699_1 1.1|9531|29|NC_018699|CRISPRCasFinder 9531-9559 29 NZ_CP041715 Legionella geestiana strain HL-0438-4026 plasmid unnamed2, complete sequence 11894-11922 8 0.724

1. spacer 1.1|9531|29|NC_018699|CRISPRCasFinder matches to NC_018699 (Leuconostoc carnosum JB16 plasmid pKLC4, complete sequence) position: , mismatch: 0, identity: 1.0

agaacttgtattatttgctgtttctggaa	CRISPR spacer
agaacttgtattatttgctgtttctggaa	Protospacer
*****************************

2. spacer 1.1|9531|29|NC_018699|CRISPRCasFinder matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.793

agaacttgtattatttgctgtttctggaa	CRISPR spacer
agaagttgtattacttgctgtttcattat	Protospacer
**** ********.**********   * 

3. spacer 1.1|9531|29|NC_018699|CRISPRCasFinder matches to NZ_CP018877 (Bacillus megaterium strain JX285 plasmid 4, complete sequence) position: , mismatch: 6, identity: 0.793

agaacttgtattatttgctgtttctggaa	CRISPR spacer
agaacttgtaatattggctgttttagaga	Protospacer
********** **** *******. *..*

4. spacer 1.1|9531|29|NC_018699|CRISPRCasFinder matches to NZ_CP048424 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

agaacttgtattatttgctgtttctggaa	CRISPR spacer
tttacttgttttatttgctgtttcttgcc	Protospacer
   ****** *************** *  

5. spacer 1.1|9531|29|NC_018699|CRISPRCasFinder matches to NZ_CP041715 (Legionella geestiana strain HL-0438-4026 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.724

agaacttgtattatttgctgtttctggaa	CRISPR spacer
gtgccttgtattatttggtgtttctgtgc	Protospacer
. . ************* ******** . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage