Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_018589 Listeria monocytogenes SLCC2479, complete genome 4 crisprs DinG,cas3,WYL,casR,DEDDh,csa3 0 1 6 0

Results visualization

1. NC_018589
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018589_1 210278-210429 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018589_2 497560-498144 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018589_3 543107-543395 Orphan I-A
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018589_4 2807341-2807451 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_018589_3 3.3|543266|35|NC_018589|PILER-CR,CRISPRCasFinder,CRT 543266-543300 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10173 1 0.971
NC_018589_3 3.3|543266|35|NC_018589|PILER-CR,CRISPRCasFinder,CRT 543266-543300 35 NC_009813 Listeria phage B054, complete genome 10139-10173 2 0.943

1. spacer 3.3|543266|35|NC_018589|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.971

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaa	Protospacer
*****************.*****************

2. spacer 3.3|543266|35|NC_018589|PILER-CR,CRISPRCasFinder,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.943

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaa	Protospacer
*****************.**.**************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 120653 : 127178 10 Listeria_phage(33.33%) tail NA
DBSCAN-SWA_2 1122626 : 1130049 8 Hokovirus(33.33%) NA NA
DBSCAN-SWA_3 1244094 : 1324478 104 Listeria_phage(77.05%) tRNA,holin,terminase,protease,capsid,tail,portal,integrase attL 1243977:1243993|attR 1286775:1286791
DBSCAN-SWA_4 1858093 : 1866379 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 2381186 : 2420374 61 Listeria_phage(88.24%) tail,holin,terminase NA
DBSCAN-SWA_6 2563667 : 2571511 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage