Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_018648 Clostridium botulinum B str. Eklund 17B (NRP), complete genome 4 crisprs cas3,csa3,DEDDh,DinG,RT,WYL 1 1 9 0
NC_018653 Clostridium botulinum B str. Eklund 17B (NRP) plasmid p17BNRP, complete sequence 2 crisprs NA 0 5 1 0

Results visualization

1. NC_018648
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018648_1 592472-592577 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018648_2 973905-974004 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018648_3 2143741-2144745 Orphan II-B
15 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018648_4 3372795-3372971 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_018648_3 3.2|2143835|36|NC_018648|CRISPRCasFinder,CRT 2143835-2143870 36 NC_018648.1 1998000-1998035 0 1.0

1. spacer 3.2|2143835|36|NC_018648|CRISPRCasFinder,CRT matches to position: 1998000-1998035, mismatch: 0, identity: 1.0

attttcataatgttttaatgtagtaattactatttg	CRISPR spacer
attttcataatgttttaatgtagtaattactatttg	Protospacer
************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_018648_3 3.11|2144421|34|NC_018648|CRISPRCasFinder,CRT 2144421-2144454 34 NC_015498 Glaciecola sp. 4H-3-7+YE-5 plasmid pGLAAG01, complete sequence 268855-268888 9 0.735
NC_018648_3 3.11|2144421|34|NC_018648|CRISPRCasFinder,CRT 2144421-2144454 34 NC_018492 Bacillus cereus FRI-35 plasmid p01, complete sequence 25432-25465 9 0.735
NC_018648_3 3.11|2144421|34|NC_018648|CRISPRCasFinder,CRT 2144421-2144454 34 NZ_CP016317 Bacillus cereus strain M3 plasmid pBCM301, complete sequence 224845-224878 9 0.735
NC_018648_3 3.11|2144421|34|NC_018648|CRISPRCasFinder,CRT 2144421-2144454 34 NZ_CP045274 Bacillus megaterium strain FDU301 plasmid pFDU301B, complete sequence 7126-7159 10 0.706
NC_018648_3 3.11|2144421|34|NC_018648|CRISPRCasFinder,CRT 2144421-2144454 34 NZ_MK275620 Clostridium perfringens strain JXJA17 plasmid p2, complete sequence 13577-13610 10 0.706
NC_018648_3 3.11|2144421|34|NC_018648|CRISPRCasFinder,CRT 2144421-2144454 34 NC_008265 Clostridium phage phiSM101, complete genome 19383-19416 10 0.706

1. spacer 3.11|2144421|34|NC_018648|CRISPRCasFinder,CRT matches to NC_015498 (Glaciecola sp. 4H-3-7+YE-5 plasmid pGLAAG01, complete sequence) position: , mismatch: 9, identity: 0.735

caggcgataatattaaagaaaaagtaagtataac	CRISPR spacer
ttgcaaataatatgaaggaaaaagtaagtatgaa	Protospacer
. *  .******* **.**************.* 

2. spacer 3.11|2144421|34|NC_018648|CRISPRCasFinder,CRT matches to NC_018492 (Bacillus cereus FRI-35 plasmid p01, complete sequence) position: , mismatch: 9, identity: 0.735

caggcgataatattaaagaaaaagtaagtataac	CRISPR spacer
tagatgaaattattaaagaaaaagtaagtggagt	Protospacer
.**..** * *******************. *..

3. spacer 3.11|2144421|34|NC_018648|CRISPRCasFinder,CRT matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 9, identity: 0.735

caggcgataatattaaagaaaaagtaagtataac	CRISPR spacer
tagatgaaattattaaagaaaaagtaagtggagt	Protospacer
.**..** * *******************. *..

4. spacer 3.11|2144421|34|NC_018648|CRISPRCasFinder,CRT matches to NZ_CP045274 (Bacillus megaterium strain FDU301 plasmid pFDU301B, complete sequence) position: , mismatch: 10, identity: 0.706

caggcgataatattaaagaaaaagtaagtataac	CRISPR spacer
ataaagataatattaaagaaataataagtcaatc	Protospacer
  .. **************** *.*****  * *

5. spacer 3.11|2144421|34|NC_018648|CRISPRCasFinder,CRT matches to NZ_MK275620 (Clostridium perfringens strain JXJA17 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706

caggcgataatattaaagaaaaagtaagtataac	CRISPR spacer
cttttaaaaattttaaagaaaaagtaagaatagt	Protospacer
*   ..* *** **************** ***..

6. spacer 3.11|2144421|34|NC_018648|CRISPRCasFinder,CRT matches to NC_008265 (Clostridium phage phiSM101, complete genome) position: , mismatch: 10, identity: 0.706

caggcgataatattaaagaaaaagtaagtataac	CRISPR spacer
cttataaaaattttaaagaaaaagtaagaatagt	Protospacer
*  ...* *** **************** ***..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 17535 : 45420 24 Clostridium_phage(33.33%) tRNA,protease,head,terminase,tail,integrase,portal,capsid attL 35638:35656|attR 52063:52081
DBSCAN-SWA_2 585662 : 594017 12 Clostridium_phage(33.33%) integrase attL 589647:589663|attR 601737:601753
DBSCAN-SWA_3 916608 : 967917 60 Clostridium_phage(63.33%) tRNA,coat,terminase,head,protease,tail,integrase,portal,capsid attL 920170:920185|attR 955359:955374
DBSCAN-SWA_4 1127458 : 1137693 7 Prochlorococcus_phage(28.57%) NA NA
DBSCAN-SWA_5 1988427 : 1996564 12 Clostridium_phage(71.43%) tail,plate NA
DBSCAN-SWA_6 2001172 : 2025187 40 Clostridium_phage(50.0%) portal NA
DBSCAN-SWA_7 2325825 : 2363952 59 Clostridium_phage(41.38%) tRNA,head,protease,terminase,coat,tail,portal,capsid NA
DBSCAN-SWA_8 2811614 : 2874243 88 uncultured_Caudovirales_phage(34.04%) terminase,coat,plate,tail,integrase,portal,holin,capsid attL 2818825:2818843|attR 2876160:2876178
DBSCAN-SWA_9 3398034 : 3408384 8 Enterobacteria_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_018653
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018653_1 12964-13339 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018653_2 27618-27744 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_018653_1 1.3|13265|29|NC_018653|CRISPRCasFinder 13265-13293 29 NZ_KJ776576 Clostridium botulinum strain Eklund2B plasmid pEklund2B, complete sequence 13282-13310 0 1.0
NC_018653_1 1.3|13265|29|NC_018653|CRISPRCasFinder 13265-13293 29 NC_018653 Clostridium botulinum B str. Eklund 17B (NRP) plasmid p17BNRP, complete sequence 13265-13293 0 1.0
NC_018653_1 1.3|13265|29|NC_018653|CRISPRCasFinder 13265-13293 29 NC_010680 Clostridium botulinum B str. Eklund 17B (NRP) plasmid pCLL, complete sequence 47376-47404 0 1.0
NC_018653_2 2.1|27643|20|NC_018653|CRISPRCasFinder 27643-27662 20 NZ_KT901798 Clostridium botulinum strain GA0702E1CS plasmid pGA0702E1CS, complete sequence 30644-30663 0 1.0
NC_018653_2 2.1|27643|20|NC_018653|CRISPRCasFinder 27643-27662 20 NZ_KJ776576 Clostridium botulinum strain Eklund2B plasmid pEklund2B, complete sequence 27660-27679 0 1.0
NC_018653_2 2.1|27643|20|NC_018653|CRISPRCasFinder 27643-27662 20 NZ_KJ776581 Clostridium botulinum strain IFR_05/025 plasmid p05/025, complete sequence 33675-33694 0 1.0
NC_018653_2 2.1|27643|20|NC_018653|CRISPRCasFinder 27643-27662 20 NC_018653 Clostridium botulinum B str. Eklund 17B (NRP) plasmid p17BNRP, complete sequence 27643-27662 0 1.0
NC_018653_2 2.1|27643|20|NC_018653|CRISPRCasFinder 27643-27662 20 NC_010680 Clostridium botulinum B str. Eklund 17B (NRP) plasmid pCLL, complete sequence 14112-14131 0 1.0
NC_018653_2 2.2|27688|32|NC_018653|CRISPRCasFinder 27688-27719 32 NZ_KT901798 Clostridium botulinum strain GA0702E1CS plasmid pGA0702E1CS, complete sequence 39023-39054 0 1.0
NC_018653_2 2.2|27688|32|NC_018653|CRISPRCasFinder 27688-27719 32 NZ_KJ776576 Clostridium botulinum strain Eklund2B plasmid pEklund2B, complete sequence 27705-27736 0 1.0
NC_018653_2 2.2|27688|32|NC_018653|CRISPRCasFinder 27688-27719 32 NC_018653 Clostridium botulinum B str. Eklund 17B (NRP) plasmid p17BNRP, complete sequence 27688-27719 0 1.0
NC_018653_2 2.2|27688|32|NC_018653|CRISPRCasFinder 27688-27719 32 NC_010680 Clostridium botulinum B str. Eklund 17B (NRP) plasmid pCLL, complete sequence 14157-14188 0 1.0
NC_018653_1 1.3|13265|29|NC_018653|CRISPRCasFinder 13265-13293 29 NZ_KJ776585 Clostridium botulinum strain DB2 plasmid pDB2, complete sequence 13042-13070 1 0.966
NC_018653_1 1.3|13265|29|NC_018653|CRISPRCasFinder 13265-13293 29 NZ_KJ776583 Clostridium botulinum strain KapchunkaB3 plasmid pKAPB3, complete sequence 13051-13079 1 0.966
NC_018653_1 1.3|13265|29|NC_018653|CRISPRCasFinder 13265-13293 29 NZ_KJ776581 Clostridium botulinum strain IFR_05/025 plasmid p05/025, complete sequence 19123-19151 1 0.966
NC_018653_1 1.3|13265|29|NC_018653|CRISPRCasFinder 13265-13293 29 NZ_KJ776579 Clostridium botulinum strain KapchunkaB2 plasmid pKAPB2, complete sequence 13051-13079 1 0.966
NC_018653_2 2.2|27688|32|NC_018653|CRISPRCasFinder 27688-27719 32 NZ_KJ776581 Clostridium botulinum strain IFR_05/025 plasmid p05/025, complete sequence 33720-33751 1 0.969
NC_018653_1 1.3|13265|29|NC_018653|CRISPRCasFinder 13265-13293 29 NZ_KT901798 Clostridium botulinum strain GA0702E1CS plasmid pGA0702E1CS, complete sequence 16240-16268 2 0.931
NC_018653_2 2.2|27688|32|NC_018653|CRISPRCasFinder 27688-27719 32 NZ_KT901798 Clostridium botulinum strain GA0702E1CS plasmid pGA0702E1CS, complete sequence 30689-30720 2 0.938
NC_018653_2 2.2|27688|32|NC_018653|CRISPRCasFinder 27688-27719 32 NZ_KJ776585 Clostridium botulinum strain DB2 plasmid pDB2, complete sequence 27461-27492 2 0.938
NC_018653_2 2.2|27688|32|NC_018653|CRISPRCasFinder 27688-27719 32 NZ_KJ776583 Clostridium botulinum strain KapchunkaB3 plasmid pKAPB3, complete sequence 27470-27501 2 0.938
NC_018653_2 2.2|27688|32|NC_018653|CRISPRCasFinder 27688-27719 32 NZ_KJ776579 Clostridium botulinum strain KapchunkaB2 plasmid pKAPB2, complete sequence 27470-27501 2 0.938
NC_018653_1 1.3|13265|29|NC_018653|CRISPRCasFinder 13265-13293 29 NZ_KT901798 Clostridium botulinum strain GA0702E1CS plasmid pGA0702E1CS, complete sequence 16165-16193 3 0.897
NC_018653_2 2.2|27688|32|NC_018653|CRISPRCasFinder 27688-27719 32 NZ_CP024873 Leptospira mayottensis 200901116 plasmid p1_L200901116, complete sequence 92245-92276 8 0.75
NC_018653_2 2.2|27688|32|NC_018653|CRISPRCasFinder 27688-27719 32 LR214957 Mycoplasma fermentans strain NCTC10117 genome assembly, plasmid: 3 13692-13723 9 0.719
NC_018653_2 2.2|27688|32|NC_018653|CRISPRCasFinder 27688-27719 32 NZ_LR215006 Mycoplasma conjunctivae strain NCTC10147 plasmid 10 8258-8289 9 0.719
NC_018653_2 2.2|27688|32|NC_018653|CRISPRCasFinder 27688-27719 32 MH598801 Pelagibacter phage HTVC200P, complete genome 27397-27428 9 0.719
NC_018653_1 1.2|13145|74|NC_018653|CRISPRCasFinder 13145-13218 74 NZ_KJ776576 Clostridium botulinum strain Eklund2B plasmid pEklund2B, complete sequence 13162-13235 14 0.811
NC_018653_1 1.2|13145|74|NC_018653|CRISPRCasFinder 13145-13218 74 NZ_KJ776576 Clostridium botulinum strain Eklund2B plasmid pEklund2B, complete sequence 13222-13295 14 0.811
NC_018653_1 1.2|13145|74|NC_018653|CRISPRCasFinder 13145-13218 74 NC_018653 Clostridium botulinum B str. Eklund 17B (NRP) plasmid p17BNRP, complete sequence 13145-13218 14 0.811
NC_018653_1 1.2|13145|74|NC_018653|CRISPRCasFinder 13145-13218 74 NC_018653 Clostridium botulinum B str. Eklund 17B (NRP) plasmid p17BNRP, complete sequence 13205-13278 14 0.811
NC_018653_1 1.2|13145|74|NC_018653|CRISPRCasFinder 13145-13218 74 NC_010680 Clostridium botulinum B str. Eklund 17B (NRP) plasmid pCLL, complete sequence 47256-47329 14 0.811
NC_018653_1 1.2|13145|74|NC_018653|CRISPRCasFinder 13145-13218 74 NC_010680 Clostridium botulinum B str. Eklund 17B (NRP) plasmid pCLL, complete sequence 47316-47389 14 0.811
NC_018653_1 1.2|13145|74|NC_018653|CRISPRCasFinder 13145-13218 74 NZ_KJ776576 Clostridium botulinum strain Eklund2B plasmid pEklund2B, complete sequence 13297-13370 26 0.649
NC_018653_1 1.2|13145|74|NC_018653|CRISPRCasFinder 13145-13218 74 NC_018653 Clostridium botulinum B str. Eklund 17B (NRP) plasmid p17BNRP, complete sequence 13280-13353 26 0.649
NC_018653_1 1.2|13145|74|NC_018653|CRISPRCasFinder 13145-13218 74 NC_010680 Clostridium botulinum B str. Eklund 17B (NRP) plasmid pCLL, complete sequence 47391-47464 26 0.649
NC_018653_1 1.2|13145|74|NC_018653|CRISPRCasFinder 13145-13218 74 NZ_KT901798 Clostridium botulinum strain GA0702E1CS plasmid pGA0702E1CS, complete sequence 16255-16328 26 0.649
NC_018653_1 1.1|13010|89|NC_018653|CRISPRCasFinder 13010-13098 89 NZ_KT901798 Clostridium botulinum strain GA0702E1CS plasmid pGA0702E1CS, complete sequence 15970-16058 29 0.674
NC_018653_1 1.1|13010|89|NC_018653|CRISPRCasFinder 13010-13098 89 NZ_KJ776576 Clostridium botulinum strain Eklund2B plasmid pEklund2B, complete sequence 13027-13115 29 0.674
NC_018653_1 1.1|13010|89|NC_018653|CRISPRCasFinder 13010-13098 89 NC_018653 Clostridium botulinum B str. Eklund 17B (NRP) plasmid p17BNRP, complete sequence 13010-13098 29 0.674
NC_018653_1 1.1|13010|89|NC_018653|CRISPRCasFinder 13010-13098 89 NC_010680 Clostridium botulinum B str. Eklund 17B (NRP) plasmid pCLL, complete sequence 47121-47209 29 0.674
NC_018653_1 1.1|13010|89|NC_018653|CRISPRCasFinder 13010-13098 89 NZ_KJ776581 Clostridium botulinum strain IFR_05/025 plasmid p05/025, complete sequence 18853-18941 30 0.663

1. spacer 1.3|13265|29|NC_018653|CRISPRCasFinder matches to NZ_KJ776576 (Clostridium botulinum strain Eklund2B plasmid pEklund2B, complete sequence) position: , mismatch: 0, identity: 1.0

atctaaaccctaaatcagacggaactaaa	CRISPR spacer
atctaaaccctaaatcagacggaactaaa	Protospacer
*****************************

2. spacer 1.3|13265|29|NC_018653|CRISPRCasFinder matches to NC_018653 (Clostridium botulinum B str. Eklund 17B (NRP) plasmid p17BNRP, complete sequence) position: , mismatch: 0, identity: 1.0

atctaaaccctaaatcagacggaactaaa	CRISPR spacer
atctaaaccctaaatcagacggaactaaa	Protospacer
*****************************

3. spacer 1.3|13265|29|NC_018653|CRISPRCasFinder matches to NC_010680 (Clostridium botulinum B str. Eklund 17B (NRP) plasmid pCLL, complete sequence) position: , mismatch: 0, identity: 1.0

atctaaaccctaaatcagacggaactaaa	CRISPR spacer
atctaaaccctaaatcagacggaactaaa	Protospacer
*****************************

4. spacer 2.1|27643|20|NC_018653|CRISPRCasFinder matches to NZ_KT901798 (Clostridium botulinum strain GA0702E1CS plasmid pGA0702E1CS, complete sequence) position: , mismatch: 0, identity: 1.0

acaaggaatgaaattcttaa	CRISPR spacer
acaaggaatgaaattcttaa	Protospacer
********************

5. spacer 2.1|27643|20|NC_018653|CRISPRCasFinder matches to NZ_KJ776576 (Clostridium botulinum strain Eklund2B plasmid pEklund2B, complete sequence) position: , mismatch: 0, identity: 1.0

acaaggaatgaaattcttaa	CRISPR spacer
acaaggaatgaaattcttaa	Protospacer
********************

6. spacer 2.1|27643|20|NC_018653|CRISPRCasFinder matches to NZ_KJ776581 (Clostridium botulinum strain IFR_05/025 plasmid p05/025, complete sequence) position: , mismatch: 0, identity: 1.0

acaaggaatgaaattcttaa	CRISPR spacer
acaaggaatgaaattcttaa	Protospacer
********************

7. spacer 2.1|27643|20|NC_018653|CRISPRCasFinder matches to NC_018653 (Clostridium botulinum B str. Eklund 17B (NRP) plasmid p17BNRP, complete sequence) position: , mismatch: 0, identity: 1.0

acaaggaatgaaattcttaa	CRISPR spacer
acaaggaatgaaattcttaa	Protospacer
********************

8. spacer 2.1|27643|20|NC_018653|CRISPRCasFinder matches to NC_010680 (Clostridium botulinum B str. Eklund 17B (NRP) plasmid pCLL, complete sequence) position: , mismatch: 0, identity: 1.0

acaaggaatgaaattcttaa	CRISPR spacer
acaaggaatgaaattcttaa	Protospacer
********************

9. spacer 2.2|27688|32|NC_018653|CRISPRCasFinder matches to NZ_KT901798 (Clostridium botulinum strain GA0702E1CS plasmid pGA0702E1CS, complete sequence) position: , mismatch: 0, identity: 1.0

taaaaatgcagatttaagagattgtgttatat	CRISPR spacer
taaaaatgcagatttaagagattgtgttatat	Protospacer
********************************

10. spacer 2.2|27688|32|NC_018653|CRISPRCasFinder matches to NZ_KJ776576 (Clostridium botulinum strain Eklund2B plasmid pEklund2B, complete sequence) position: , mismatch: 0, identity: 1.0

taaaaatgcagatttaagagattgtgttatat	CRISPR spacer
taaaaatgcagatttaagagattgtgttatat	Protospacer
********************************

11. spacer 2.2|27688|32|NC_018653|CRISPRCasFinder matches to NC_018653 (Clostridium botulinum B str. Eklund 17B (NRP) plasmid p17BNRP, complete sequence) position: , mismatch: 0, identity: 1.0

taaaaatgcagatttaagagattgtgttatat	CRISPR spacer
taaaaatgcagatttaagagattgtgttatat	Protospacer
********************************

12. spacer 2.2|27688|32|NC_018653|CRISPRCasFinder matches to NC_010680 (Clostridium botulinum B str. Eklund 17B (NRP) plasmid pCLL, complete sequence) position: , mismatch: 0, identity: 1.0

taaaaatgcagatttaagagattgtgttatat	CRISPR spacer
taaaaatgcagatttaagagattgtgttatat	Protospacer
********************************

13. spacer 1.3|13265|29|NC_018653|CRISPRCasFinder matches to NZ_KJ776585 (Clostridium botulinum strain DB2 plasmid pDB2, complete sequence) position: , mismatch: 1, identity: 0.966

atctaaaccctaaatcagacggaactaaa	CRISPR spacer
atctaaatcctaaatcagacggaactaaa	Protospacer
*******.*********************

14. spacer 1.3|13265|29|NC_018653|CRISPRCasFinder matches to NZ_KJ776583 (Clostridium botulinum strain KapchunkaB3 plasmid pKAPB3, complete sequence) position: , mismatch: 1, identity: 0.966

atctaaaccctaaatcagacggaactaaa	CRISPR spacer
atctaaatcctaaatcagacggaactaaa	Protospacer
*******.*********************

15. spacer 1.3|13265|29|NC_018653|CRISPRCasFinder matches to NZ_KJ776581 (Clostridium botulinum strain IFR_05/025 plasmid p05/025, complete sequence) position: , mismatch: 1, identity: 0.966

atctaaaccctaaatcagacggaactaaa	CRISPR spacer
atctaaatcctaaatcagacggaactaaa	Protospacer
*******.*********************

16. spacer 1.3|13265|29|NC_018653|CRISPRCasFinder matches to NZ_KJ776579 (Clostridium botulinum strain KapchunkaB2 plasmid pKAPB2, complete sequence) position: , mismatch: 1, identity: 0.966

atctaaaccctaaatcagacggaactaaa	CRISPR spacer
atctaaatcctaaatcagacggaactaaa	Protospacer
*******.*********************

17. spacer 2.2|27688|32|NC_018653|CRISPRCasFinder matches to NZ_KJ776581 (Clostridium botulinum strain IFR_05/025 plasmid p05/025, complete sequence) position: , mismatch: 1, identity: 0.969

taaaaatgcagatttaagagattgtgttatat	CRISPR spacer
caaaaatgcagatttaagagattgtgttatat	Protospacer
.*******************************

18. spacer 1.3|13265|29|NC_018653|CRISPRCasFinder matches to NZ_KT901798 (Clostridium botulinum strain GA0702E1CS plasmid pGA0702E1CS, complete sequence) position: , mismatch: 2, identity: 0.931

atctaaaccctaaatcagacggaactaaa	CRISPR spacer
atttaaatcctaaatcagacggaactaaa	Protospacer
**.****.*********************

19. spacer 2.2|27688|32|NC_018653|CRISPRCasFinder matches to NZ_KT901798 (Clostridium botulinum strain GA0702E1CS plasmid pGA0702E1CS, complete sequence) position: , mismatch: 2, identity: 0.938

taaaaatgcagatttaagagattgtgttatat	CRISPR spacer
caaaaatgcagatttaagagattgtgtcatat	Protospacer
.**************************.****

20. spacer 2.2|27688|32|NC_018653|CRISPRCasFinder matches to NZ_KJ776585 (Clostridium botulinum strain DB2 plasmid pDB2, complete sequence) position: , mismatch: 2, identity: 0.938

taaaaatgcagatttaagagattgtgttatat	CRISPR spacer
cagaaatgcagatttaagagattgtgttatat	Protospacer
.*.*****************************

21. spacer 2.2|27688|32|NC_018653|CRISPRCasFinder matches to NZ_KJ776583 (Clostridium botulinum strain KapchunkaB3 plasmid pKAPB3, complete sequence) position: , mismatch: 2, identity: 0.938

taaaaatgcagatttaagagattgtgttatat	CRISPR spacer
cagaaatgcagatttaagagattgtgttatat	Protospacer
.*.*****************************

22. spacer 2.2|27688|32|NC_018653|CRISPRCasFinder matches to NZ_KJ776579 (Clostridium botulinum strain KapchunkaB2 plasmid pKAPB2, complete sequence) position: , mismatch: 2, identity: 0.938

taaaaatgcagatttaagagattgtgttatat	CRISPR spacer
cagaaatgcagatttaagagattgtgttatat	Protospacer
.*.*****************************

23. spacer 1.3|13265|29|NC_018653|CRISPRCasFinder matches to NZ_KT901798 (Clostridium botulinum strain GA0702E1CS plasmid pGA0702E1CS, complete sequence) position: , mismatch: 3, identity: 0.897

atctaaaccctaaatcagacggaactaaa	CRISPR spacer
atctaaaccctgaatcagatggaactaga	Protospacer
***********.*******.*******.*

24. spacer 2.2|27688|32|NC_018653|CRISPRCasFinder matches to NZ_CP024873 (Leptospira mayottensis 200901116 plasmid p1_L200901116, complete sequence) position: , mismatch: 8, identity: 0.75

taaaaatgcagatttaagagatt------gtgttatat	CRISPR spacer
taaaaatgcagatttaggatatttaaggggtg------	Protospacer
****************.** ***      ***      

25. spacer 2.2|27688|32|NC_018653|CRISPRCasFinder matches to LR214957 (Mycoplasma fermentans strain NCTC10117 genome assembly, plasmid: 3) position: , mismatch: 9, identity: 0.719

taaaaatgcagatttaagagattgtgttatat	CRISPR spacer
tgaaaatgcagaattaagagatggtaaattca	Protospacer
*.********** ********* **.   *  

26. spacer 2.2|27688|32|NC_018653|CRISPRCasFinder matches to NZ_LR215006 (Mycoplasma conjunctivae strain NCTC10147 plasmid 10) position: , mismatch: 9, identity: 0.719

taaaaatgcagatttaagagattgtgttatat	CRISPR spacer
tgaaaatgcagaattaagagatggtaaattca	Protospacer
*.********** ********* **.   *  

27. spacer 2.2|27688|32|NC_018653|CRISPRCasFinder matches to MH598801 (Pelagibacter phage HTVC200P, complete genome) position: , mismatch: 9, identity: 0.719

taaaaatgcagatttaagagattgtgttatat	CRISPR spacer
taaaattgtagatttaagagattttaaaaata	Protospacer
***** **.************** *.  *   

28. spacer 1.2|13145|74|NC_018653|CRISPRCasFinder matches to NZ_KJ776576 (Clostridium botulinum strain Eklund2B plasmid pEklund2B, complete sequence) position: , mismatch: 14, identity: 0.811

tctgtaatgatagtggaaaaatgcttaatggttggattaatgataatggcaactggtatt	CRISPR spacer
tctgtaatgatagtggaaaaatgcttaatggttggattaatgataatggcaactggtatt	Protospacer
************************************************************

29. spacer 1.2|13145|74|NC_018653|CRISPRCasFinder matches to NZ_KJ776576 (Clostridium botulinum strain Eklund2B plasmid pEklund2B, complete sequence) position: , mismatch: 14, identity: 0.811

tctgtaatgatagtggaaaaatgcttaatggttggattaatgataatggcaactggtatt	CRISPR spacer
tctgtaatgatagtggaaaaatgcttaatggttggattaatgataatggcaactggtatt	Protospacer
************************************************************

30. spacer 1.2|13145|74|NC_018653|CRISPRCasFinder matches to NC_018653 (Clostridium botulinum B str. Eklund 17B (NRP) plasmid p17BNRP, complete sequence) position: , mismatch: 14, identity: 0.811

tctgtaatgatagtggaaaaatgcttaatggttggattaatgataatggcaactggtatt	CRISPR spacer
tctgtaatgatagtggaaaaatgcttaatggttggattaatgataatggcaactggtatt	Protospacer
************************************************************

31. spacer 1.2|13145|74|NC_018653|CRISPRCasFinder matches to NC_018653 (Clostridium botulinum B str. Eklund 17B (NRP) plasmid p17BNRP, complete sequence) position: , mismatch: 14, identity: 0.811

tctgtaatgatagtggaaaaatgcttaatggttggattaatgataatggcaactggtatt	CRISPR spacer
tctgtaatgatagtggaaaaatgcttaatggttggattaatgataatggcaactggtatt	Protospacer
************************************************************

32. spacer 1.2|13145|74|NC_018653|CRISPRCasFinder matches to NC_010680 (Clostridium botulinum B str. Eklund 17B (NRP) plasmid pCLL, complete sequence) position: , mismatch: 14, identity: 0.811

tctgtaatgatagtggaaaaatgcttaatggttggattaatgataatggcaactggtatt	CRISPR spacer
tctgtaatgatagtggaaaaatgcttaatggttggattaatgataatggcaactggtatt	Protospacer
************************************************************

33. spacer 1.2|13145|74|NC_018653|CRISPRCasFinder matches to NC_010680 (Clostridium botulinum B str. Eklund 17B (NRP) plasmid pCLL, complete sequence) position: , mismatch: 14, identity: 0.811

tctgtaatgatagtggaaaaatgcttaatggttggattaatgataatggcaactggtatt	CRISPR spacer
tctgtaatgatagtggaaaaatgcttaatggttggattaatgataatggcaactggtatt	Protospacer
************************************************************

34. spacer 1.2|13145|74|NC_018653|CRISPRCasFinder matches to NZ_KJ776576 (Clostridium botulinum strain Eklund2B plasmid pEklund2B, complete sequence) position: , mismatch: 26, identity: 0.649

tctgtaatgatagtggaaaaatgcttaatggttggattaatgataatggcaactggtatt	CRISPR spacer
cagacggaactaaaggaaaaatgcttaatggttggattaatgataatggcaactggtatt	Protospacer
.  .... . **. **********************************************

35. spacer 1.2|13145|74|NC_018653|CRISPRCasFinder matches to NC_018653 (Clostridium botulinum B str. Eklund 17B (NRP) plasmid p17BNRP, complete sequence) position: , mismatch: 26, identity: 0.649

tctgtaatgatagtggaaaaatgcttaatggttggattaatgataatggcaactggtatt	CRISPR spacer
cagacggaactaaaggaaaaatgcttaatggttggattaatgataatggcaactggtatt	Protospacer
.  .... . **. **********************************************

36. spacer 1.2|13145|74|NC_018653|CRISPRCasFinder matches to NC_010680 (Clostridium botulinum B str. Eklund 17B (NRP) plasmid pCLL, complete sequence) position: , mismatch: 26, identity: 0.649

tctgtaatgatagtggaaaaatgcttaatggttggattaatgataatggcaactggtatt	CRISPR spacer
cagacggaactaaaggaaaaatgcttaatggttggattaatgataatggcaactggtatt	Protospacer
.  .... . **. **********************************************

37. spacer 1.2|13145|74|NC_018653|CRISPRCasFinder matches to NZ_KT901798 (Clostridium botulinum strain GA0702E1CS plasmid pGA0702E1CS, complete sequence) position: , mismatch: 26, identity: 0.649

tctgtaatgatagtggaaaaatgcttaatggttggattaatgataatggcaactggtatt	CRISPR spacer
cagacggaactaaaggaaaaatgcttaatggttggattaatgataatggcaactggtatt	Protospacer
.  .... . **. **********************************************

38. spacer 1.1|13010|89|NC_018653|CRISPRCasFinder matches to NZ_KT901798 (Clostridium botulinum strain GA0702E1CS plasmid pGA0702E1CS, complete sequence) position: , mismatch: 29, identity: 0.674

attttgattcatttggagtaatgcaaacaggatggcaatgtatagataatgaatggtatt	CRISPR spacer
attttgattcatttggagtaatgcaaacaggatggcaatgtatagataatgaatggtatt	Protospacer
************************************************************

39. spacer 1.1|13010|89|NC_018653|CRISPRCasFinder matches to NZ_KJ776576 (Clostridium botulinum strain Eklund2B plasmid pEklund2B, complete sequence) position: , mismatch: 29, identity: 0.674

attttgattcatttggagtaatgcaaacaggatggcaatgtatagataatgaatggtatt	CRISPR spacer
attttgattcatttggagtaatgcaaacaggatggcaatgtatagataatgaatggtatt	Protospacer
************************************************************

40. spacer 1.1|13010|89|NC_018653|CRISPRCasFinder matches to NC_018653 (Clostridium botulinum B str. Eklund 17B (NRP) plasmid p17BNRP, complete sequence) position: , mismatch: 29, identity: 0.674

attttgattcatttggagtaatgcaaacaggatggcaatgtatagataatgaatggtatt	CRISPR spacer
attttgattcatttggagtaatgcaaacaggatggcaatgtatagataatgaatggtatt	Protospacer
************************************************************

41. spacer 1.1|13010|89|NC_018653|CRISPRCasFinder matches to NC_010680 (Clostridium botulinum B str. Eklund 17B (NRP) plasmid pCLL, complete sequence) position: , mismatch: 29, identity: 0.674

attttgattcatttggagtaatgcaaacaggatggcaatgtatagataatgaatggtatt	CRISPR spacer
attttgattcatttggagtaatgcaaacaggatggcaatgtatagataatgaatggtatt	Protospacer
************************************************************

42. spacer 1.1|13010|89|NC_018653|CRISPRCasFinder matches to NZ_KJ776581 (Clostridium botulinum strain IFR_05/025 plasmid p05/025, complete sequence) position: , mismatch: 30, identity: 0.663

attttgattcatttggagtaatgcaaacaggatggcaatgtatagataatgaatggtatt	CRISPR spacer
attttgattcatttggagtaatgcaaacaggatggcaatatatagataatgaatggtatt	Protospacer
***************************************.********************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 33436 : 46087 7 Clostridium_botulinum_D_phage(42.86%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage