Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_018938 Helicobacter pylori Rif2, complete sequence 4 crisprs cas2,cas14j,DEDDh 1 1 1 0

Results visualization

1. NC_018938
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018938_1 350475-350601 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018938_2 556181-556468 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018938_3 980288-980429 Orphan I-B
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_018938_4 1166569-1166657 TypeV NA
1 spacers
cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_018938_2 2.1|556244|54|NC_018938|PILER-CR 556244-556297 54 NC_018938.1 555914-555967 1 0.981

1. spacer 2.1|556244|54|NC_018938|PILER-CR matches to position: 555914-555967, mismatch: 1, identity: 0.981

cattcctagctcttgatacgcagtccaaataagccttaatgcttttcttaactt	CRISPR spacer
cattcctagctcttgatacgcagtccaaataagccttaacgcttttcttaactt	Protospacer
***************************************.**************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_018938_3 3.2|980376|23|NC_018938|PILER-CR 980376-980398 23 NZ_CP010123 Escherichia coli strain C5 plasmid A, complete genome 183244-183266 3 0.87

1. spacer 3.2|980376|23|NC_018938|PILER-CR matches to NZ_CP010123 (Escherichia coli strain C5 plasmid A, complete genome) position: , mismatch: 3, identity: 0.87

acgccagctttgataacgacacc	CRISPR spacer
gcgccagctttgatatcgacacg	Protospacer
.************** ****** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1018476 : 1062123 35 Helicobacter_phage(50.0%) protease,integrase,tRNA,transposase attL 1037831:1037846|attR 1058396:1058411
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage