Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_020052 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.04, complete sequence 0 crisprs NA 0 0 0 0
NC_019750 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.03, complete sequence 0 crisprs csa3 0 0 0 0
NC_019748 Stanieria cyanosphaera PCC 7437, complete sequence 9 crisprs RT,Cas14u_CAS-V,cas14k,WYL,csx18,cas1,csx1,cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cas2,c2c9_V-U4,cas14j,csa3,Cas14c_CAS-V-F,DEDDh,cas5,cas7,cas8b3,cas3,cas6,DinG,cas4 0 2 2 0
NC_019749 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.02, complete sequence 0 crisprs NA 0 0 0 0
NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 2 crisprs c2c9_V-U4,cas2,cas1,cas4,cas6,csc1gr5,csc2gr7,cas10d,cas3,WYL,cas14j,Cas14c_CAS-V-F 0 43 1 0
NC_019766 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.05, complete sequence 0 crisprs Cas14c_CAS-V-F 0 0 0 0

Results visualization

1. NC_019765
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019765_1 31939-32557 TypeI-D NA
8 spacers
cas2,cas1,cas4,cas6,csc1gr5,csc2gr7,cas10d,cas3,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019765_2 32592-35193 TypeI-D NA
35 spacers
cas2,cas1,cas4,cas6,csc1gr5,csc2gr7,cas10d,cas3,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_019765_1 1.1|31976|33|NC_019765|CRT 31976-32008 33 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 31976-32008 0 1.0
NC_019765_1 1.2|32046|35|NC_019765|CRT,PILER-CR,CRISPRCasFinder 32046-32080 35 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 32046-32080 0 1.0
NC_019765_1 1.3|32118|35|NC_019765|CRT,PILER-CR,CRISPRCasFinder 32118-32152 35 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 32118-32152 0 1.0
NC_019765_1 1.4|32190|39|NC_019765|CRT,PILER-CR,CRISPRCasFinder 32190-32228 39 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 32190-32228 0 1.0
NC_019765_1 1.5|32266|36|NC_019765|CRT,PILER-CR,CRISPRCasFinder 32266-32301 36 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 32266-32301 0 1.0
NC_019765_1 1.6|32339|36|NC_019765|CRT,PILER-CR,CRISPRCasFinder 32339-32374 36 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 32339-32374 0 1.0
NC_019765_1 1.7|32412|35|NC_019765|CRT,PILER-CR,CRISPRCasFinder 32412-32446 35 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 32412-32446 0 1.0
NC_019765_1 1.8|32484|36|NC_019765|CRT,CRISPRCasFinder 32484-32519 36 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 32484-32519 0 1.0
NC_019765_2 2.1|32629|33|NC_019765|CRT 32629-32661 33 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 32629-32661 0 1.0
NC_019765_2 2.2|32699|38|NC_019765|CRT,PILER-CR,CRISPRCasFinder 32699-32736 38 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 32699-32736 0 1.0
NC_019765_2 2.3|32774|34|NC_019765|CRT,PILER-CR,CRISPRCasFinder 32774-32807 34 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 32774-32807 0 1.0
NC_019765_2 2.4|32845|40|NC_019765|CRT,CRISPRCasFinder 32845-32884 40 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 32845-32884 0 1.0
NC_019765_2 2.5|32922|37|NC_019765|CRT,CRISPRCasFinder 32922-32958 37 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 32922-32958 0 1.0
NC_019765_2 2.6|32996|40|NC_019765|CRT,CRISPRCasFinder,PILER-CR 32996-33035 40 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 32996-33035 0 1.0
NC_019765_2 2.7|33073|36|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33073-33108 36 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 33073-33108 0 1.0
NC_019765_2 2.8|33146|35|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33146-33180 35 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 33146-33180 0 1.0
NC_019765_2 2.9|33218|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33218-33251 34 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 33218-33251 0 1.0
NC_019765_2 2.10|33289|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33289-33322 34 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 33289-33322 0 1.0
NC_019765_2 2.11|33360|40|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33360-33399 40 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 33360-33399 0 1.0
NC_019765_2 2.12|33437|36|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33437-33472 36 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 33437-33472 0 1.0
NC_019765_2 2.13|33510|42|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33510-33551 42 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 33510-33551 0 1.0
NC_019765_2 2.14|33589|35|NC_019765|CRT,CRISPRCasFinder 33589-33623 35 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 33589-33623 0 1.0
NC_019765_2 2.15|33661|33|NC_019765|CRT,CRISPRCasFinder 33661-33693 33 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 33661-33693 0 1.0
NC_019765_2 2.16|33731|37|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33731-33767 37 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 33731-33767 0 1.0
NC_019765_2 2.17|33805|35|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33805-33839 35 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 33805-33839 0 1.0
NC_019765_2 2.18|33877|37|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33877-33913 37 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 33877-33913 0 1.0
NC_019765_2 2.19|33951|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33951-33984 34 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 33951-33984 0 1.0
NC_019765_2 2.20|34022|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR 34022-34055 34 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 34022-34055 0 1.0
NC_019765_2 2.21|34093|37|NC_019765|CRT,CRISPRCasFinder,PILER-CR 34093-34129 37 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 34093-34129 0 1.0
NC_019765_2 2.22|34167|35|NC_019765|CRT,CRISPRCasFinder,PILER-CR 34167-34201 35 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 34167-34201 0 1.0
NC_019765_2 2.23|34239|35|NC_019765|CRT,CRISPRCasFinder,PILER-CR 34239-34273 35 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 34239-34273 0 1.0
NC_019765_2 2.24|34311|35|NC_019765|CRT,CRISPRCasFinder,PILER-CR 34311-34345 35 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 34311-34345 0 1.0
NC_019765_2 2.25|34383|38|NC_019765|CRT,CRISPRCasFinder,PILER-CR 34383-34420 38 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 34383-34420 0 1.0
NC_019765_2 2.26|34458|35|NC_019765|CRT,CRISPRCasFinder,PILER-CR 34458-34492 35 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 34458-34492 0 1.0
NC_019765_2 2.27|34530|35|NC_019765|CRT,CRISPRCasFinder,PILER-CR 34530-34564 35 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 34530-34564 0 1.0
NC_019765_2 2.28|34602|41|NC_019765|CRT,CRISPRCasFinder,PILER-CR 34602-34642 41 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 34602-34642 0 1.0
NC_019765_2 2.29|34680|37|NC_019765|CRT,CRISPRCasFinder,PILER-CR 34680-34716 37 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 34680-34716 0 1.0
NC_019765_2 2.30|34754|38|NC_019765|CRT,CRISPRCasFinder,PILER-CR 34754-34791 38 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 34754-34791 0 1.0
NC_019765_2 2.31|34829|33|NC_019765|CRT,CRISPRCasFinder,PILER-CR 34829-34861 33 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 34829-34861 0 1.0
NC_019765_2 2.32|34899|36|NC_019765|CRT,CRISPRCasFinder,PILER-CR 34899-34934 36 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 34899-34934 0 1.0
NC_019765_2 2.33|34972|36|NC_019765|CRT,CRISPRCasFinder,PILER-CR 34972-35007 36 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 34972-35007 0 1.0
NC_019765_2 2.34|35045|37|NC_019765|CRT,CRISPRCasFinder,PILER-CR 35045-35081 37 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 35045-35081 0 1.0
NC_019765_2 2.35|35119|38|NC_019765|CRT,CRISPRCasFinder,PILER-CR 35119-35156 38 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 35119-35156 0 1.0
NC_019765_2 2.1|32629|33|NC_019765|CRT 32629-32661 33 NC_019765 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence 32559-32591 6 0.818
NC_019765_2 2.10|33289|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33289-33322 34 MW084976 Bacillus phage Kirov, complete genome 100093-100126 8 0.765
NC_019765_2 2.10|33289|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33289-33322 34 MK448933 Streptococcus phage Javan420, complete genome 28980-29013 8 0.765
NC_019765_2 2.23|34239|35|NC_019765|CRT,CRISPRCasFinder,PILER-CR 34239-34273 35 AP014044 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12-MedDCM-OCT-S24-C146, *** SEQUENCING IN PROGRESS *** 1903-1937 8 0.771
NC_019765_2 2.23|34239|35|NC_019765|CRT,CRISPRCasFinder,PILER-CR 34239-34273 35 AP014047 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12-MedDCM-OCT-S39-C144, *** SEQUENCING IN PROGRESS *** 5416-5450 8 0.771
NC_019765_2 2.9|33218|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33218-33251 34 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1533128-1533161 9 0.735
NC_019765_2 2.10|33289|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33289-33322 34 KT070867 Bacillus phage PBC2, complete genome 65912-65945 9 0.735
NC_019765_2 2.12|33437|36|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33437-33472 36 NC_018265 Melissococcus plutonius DAT561 plasmid 1, complete sequence 190958-190993 9 0.75
NC_019765_2 2.12|33437|36|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33437-33472 36 NZ_CP006684 Melissococcus plutonius S1 plasmid pMEPL_178, complete sequence 8074-8109 9 0.75
NC_019765_2 2.12|33437|36|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33437-33472 36 NZ_AP021886 Melissococcus plutonius strain DAT1033 plasmid pMP1, complete sequence 8074-8109 9 0.75
NC_019765_2 2.12|33437|36|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33437-33472 36 NZ_AP018525 Melissococcus plutonius strain DAT585 plasmid pMP1, complete sequence 8090-8125 9 0.75
NC_019765_2 2.19|33951|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33951-33984 34 NZ_CP017255 Clostridium taeniosporum strain 1/k plasmid pCt2, complete sequence 44252-44285 10 0.706
NC_019765_2 2.19|33951|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33951-33984 34 MT774395 CrAssphage cr52_1, complete genome 86560-86593 11 0.676
NC_019765_2 2.19|33951|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR 33951-33984 34 MT774403 CrAssphage cr113_1, complete genome 2475-2508 11 0.676

1. spacer 1.1|31976|33|NC_019765|CRT matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

ttgaaactttcgtagaagctgagaatcgtaata	CRISPR spacer
ttgaaactttcgtagaagctgagaatcgtaata	Protospacer
*********************************

2. spacer 1.2|32046|35|NC_019765|CRT,PILER-CR,CRISPRCasFinder matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

ttttatcttttctcaatcaattgataaaggtcgta	CRISPR spacer
ttttatcttttctcaatcaattgataaaggtcgta	Protospacer
***********************************

3. spacer 1.3|32118|35|NC_019765|CRT,PILER-CR,CRISPRCasFinder matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

aatgagtttaaagatttgcttatggcgcaagtttg	CRISPR spacer
aatgagtttaaagatttgcttatggcgcaagtttg	Protospacer
***********************************

4. spacer 1.4|32190|39|NC_019765|CRT,PILER-CR,CRISPRCasFinder matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

atagatggaaattcctctttcttcggaaaaaattatcga	CRISPR spacer
atagatggaaattcctctttcttcggaaaaaattatcga	Protospacer
***************************************

5. spacer 1.5|32266|36|NC_019765|CRT,PILER-CR,CRISPRCasFinder matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

attgtttctcagcaaacgtaattggttgccagtcat	CRISPR spacer
attgtttctcagcaaacgtaattggttgccagtcat	Protospacer
************************************

6. spacer 1.6|32339|36|NC_019765|CRT,PILER-CR,CRISPRCasFinder matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

gtgctacgttcgtaaacttgcgtttcaaaagtccct	CRISPR spacer
gtgctacgttcgtaaacttgcgtttcaaaagtccct	Protospacer
************************************

7. spacer 1.7|32412|35|NC_019765|CRT,PILER-CR,CRISPRCasFinder matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

gtgagggaattgatatgtttgctcgtaaaggtgat	CRISPR spacer
gtgagggaattgatatgtttgctcgtaaaggtgat	Protospacer
***********************************

8. spacer 1.8|32484|36|NC_019765|CRT,CRISPRCasFinder matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

caatccccccttcgtcgaggagcaatacagagttag	CRISPR spacer
caatccccccttcgtcgaggagcaatacagagttag	Protospacer
************************************

9. spacer 2.1|32629|33|NC_019765|CRT matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

tattctgggtattatgttattgaggataaataa	CRISPR spacer
tattctgggtattatgttattgaggataaataa	Protospacer
*********************************

10. spacer 2.2|32699|38|NC_019765|CRT,PILER-CR,CRISPRCasFinder matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

agttcgtcgtgcaactaaggtgcagaaataatggaatt	CRISPR spacer
agttcgtcgtgcaactaaggtgcagaaataatggaatt	Protospacer
**************************************

11. spacer 2.3|32774|34|NC_019765|CRT,PILER-CR,CRISPRCasFinder matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

ccattagcagcaaaccaattcaaaccacgaagac	CRISPR spacer
ccattagcagcaaaccaattcaaaccacgaagac	Protospacer
**********************************

12. spacer 2.4|32845|40|NC_019765|CRT,CRISPRCasFinder matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

gttttaagctcttcaatagtttcatcaatttgctctttat	CRISPR spacer
gttttaagctcttcaatagtttcatcaatttgctctttat	Protospacer
****************************************

13. spacer 2.5|32922|37|NC_019765|CRT,CRISPRCasFinder matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

atttataacgattgtttgcaatatggcgtaggtaaag	CRISPR spacer
atttataacgattgtttgcaatatggcgtaggtaaag	Protospacer
*************************************

14. spacer 2.6|32996|40|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

acttaaacgaatccgaccccgtaaaagttgacctgtcctt	CRISPR spacer
acttaaacgaatccgaccccgtaaaagttgacctgtcctt	Protospacer
****************************************

15. spacer 2.7|33073|36|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

aaatttggcgatcgctcgataaaaagtagctgaaga	CRISPR spacer
aaatttggcgatcgctcgataaaaagtagctgaaga	Protospacer
************************************

16. spacer 2.8|33146|35|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

ttgatggaatggttcggagtcgaattttttctgat	CRISPR spacer
ttgatggaatggttcggagtcgaattttttctgat	Protospacer
***********************************

17. spacer 2.9|33218|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

aaatttgcccgtgttcgagcgtctgtccaatcca	CRISPR spacer
aaatttgcccgtgttcgagcgtctgtccaatcca	Protospacer
**********************************

18. spacer 2.10|33289|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

atagttctcgcttctgcttcgattttttgaattt	CRISPR spacer
atagttctcgcttctgcttcgattttttgaattt	Protospacer
**********************************

19. spacer 2.11|33360|40|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

actgctggtcgtattgctttccataattggtcacaggcta	CRISPR spacer
actgctggtcgtattgctttccataattggtcacaggcta	Protospacer
****************************************

20. spacer 2.12|33437|36|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

taataaaaatctagatcaagatgatttaaatgtact	CRISPR spacer
taataaaaatctagatcaagatgatttaaatgtact	Protospacer
************************************

21. spacer 2.13|33510|42|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

gtaggtagcaagatttgatcgacttcggggttggcgttgata	CRISPR spacer
gtaggtagcaagatttgatcgacttcggggttggcgttgata	Protospacer
******************************************

22. spacer 2.14|33589|35|NC_019765|CRT,CRISPRCasFinder matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

ttagagagaatttagattacaatcgcaatctttta	CRISPR spacer
ttagagagaatttagattacaatcgcaatctttta	Protospacer
***********************************

23. spacer 2.15|33661|33|NC_019765|CRT,CRISPRCasFinder matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

tatcttccgtcgatcgcgatttgagttcttttg	CRISPR spacer
tatcttccgtcgatcgcgatttgagttcttttg	Protospacer
*********************************

24. spacer 2.16|33731|37|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

atcggctgcatctaatgcaggtgcagcactcctggct	CRISPR spacer
atcggctgcatctaatgcaggtgcagcactcctggct	Protospacer
*************************************

25. spacer 2.17|33805|35|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

cgattcaaaagtaaatacctcagaatactttattt	CRISPR spacer
cgattcaaaagtaaatacctcagaatactttattt	Protospacer
***********************************

26. spacer 2.18|33877|37|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

gtaagtactgagcgaacattttacttagttcttcttt	CRISPR spacer
gtaagtactgagcgaacattttacttagttcttcttt	Protospacer
*************************************

27. spacer 2.19|33951|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

ttcaagatttatttgaagatgttactgattctaa	CRISPR spacer
ttcaagatttatttgaagatgttactgattctaa	Protospacer
**********************************

28. spacer 2.20|34022|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

agtggagaatgaaactaaagtagcttggtatgct	CRISPR spacer
agtggagaatgaaactaaagtagcttggtatgct	Protospacer
**********************************

29. spacer 2.21|34093|37|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

gtagtacatactcagtagtaccatcatcggcggtata	CRISPR spacer
gtagtacatactcagtagtaccatcatcggcggtata	Protospacer
*************************************

30. spacer 2.22|34167|35|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

ttaataactggaaaaatattaaagggtttaactac	CRISPR spacer
ttaataactggaaaaatattaaagggtttaactac	Protospacer
***********************************

31. spacer 2.23|34239|35|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

ttgaaaatatatattttctccttcttcccaatttt	CRISPR spacer
ttgaaaatatatattttctccttcttcccaatttt	Protospacer
***********************************

32. spacer 2.24|34311|35|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

ctatcccagttatctttttgatcaaaccaatcaat	CRISPR spacer
ctatcccagttatctttttgatcaaaccaatcaat	Protospacer
***********************************

33. spacer 2.25|34383|38|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

ccagaaaaataagctagatttgctattgtatatttagt	CRISPR spacer
ccagaaaaataagctagatttgctattgtatatttagt	Protospacer
**************************************

34. spacer 2.26|34458|35|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

catttgagaattagagagagcaagagcaatagatc	CRISPR spacer
catttgagaattagagagagcaagagcaatagatc	Protospacer
***********************************

35. spacer 2.27|34530|35|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

tggaaactacagcaccagtagaactacaagcttct	CRISPR spacer
tggaaactacagcaccagtagaactacaagcttct	Protospacer
***********************************

36. spacer 2.28|34602|41|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

tagacagatcgattaaattttgaactgttttaattgcggcc	CRISPR spacer
tagacagatcgattaaattttgaactgttttaattgcggcc	Protospacer
*****************************************

37. spacer 2.29|34680|37|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

tcaagtcttaccacagcagcttgagccgtatccgcag	CRISPR spacer
tcaagtcttaccacagcagcttgagccgtatccgcag	Protospacer
*************************************

38. spacer 2.30|34754|38|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

acaaagtagttgattatttagaaattgattttactttt	CRISPR spacer
acaaagtagttgattatttagaaattgattttactttt	Protospacer
**************************************

39. spacer 2.31|34829|33|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

gattttttcaatggctggctgtagctttttgag	CRISPR spacer
gattttttcaatggctggctgtagctttttgag	Protospacer
*********************************

40. spacer 2.32|34899|36|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

tatttcattcaatgggcgcactactccaccagaaat	CRISPR spacer
tatttcattcaatgggcgcactactccaccagaaat	Protospacer
************************************

41. spacer 2.33|34972|36|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

acatggtaattcaaccgttgccgtatcattggaagt	CRISPR spacer
acatggtaattcaaccgttgccgtatcattggaagt	Protospacer
************************************

42. spacer 2.34|35045|37|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

tagctgaaactttagcagaattatggggagcaatttt	CRISPR spacer
tagctgaaactttagcagaattatggggagcaatttt	Protospacer
*************************************

43. spacer 2.35|35119|38|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 0, identity: 1.0

taatcaagttgtaaataaagattagttgtagttcccaa	CRISPR spacer
taatcaagttgtaaataaagattagttgtagttcccaa	Protospacer
**************************************

44. spacer 2.1|32629|33|NC_019765|CRT matches to NC_019765 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.01, complete sequence) position: , mismatch: 6, identity: 0.818

tattctgggtattatgttattgaggataaataa	CRISPR spacer
ttgataaggtattatgttattgaggataaataa	Protospacer
*   . .**************************

45. spacer 2.10|33289|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 8, identity: 0.765

-atagttctcgcttctgcttcgattttttgaattt	CRISPR spacer
tgtaa-gcgtgcttctgcttcgattttttggatta	Protospacer
 .**.  * .********************.*** 

46. spacer 2.10|33289|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to MK448933 (Streptococcus phage Javan420, complete genome) position: , mismatch: 8, identity: 0.765

atagttctcgcttctgcttcgattttttgaattt	CRISPR spacer
atttatttggctactgcttcgattttttgatttc	Protospacer
**   *.* *** ***************** **.

47. spacer 2.23|34239|35|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to AP014044 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12-MedDCM-OCT-S24-C146, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.771

ttgaaaatatatattttctccttcttcccaatttt	CRISPR spacer
atctaaatacatattttctcctttttcccaccatt	Protospacer
 *  *****.*************.****** . **

48. spacer 2.23|34239|35|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to AP014047 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C12-MedDCM-OCT-S39-C144, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.771

ttgaaaatatatattttctccttcttcccaatttt	CRISPR spacer
atctaaatacatattttctcctttttcccaccatt	Protospacer
 *  *****.*************.****** . **

49. spacer 2.9|33218|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 9, identity: 0.735

aaatttgcccgtgttcgagcgtctgtccaatcca	CRISPR spacer
caatttgcccgtgttcgggcggctgagccatggc	Protospacer
 ****************.*** ***  * **   

50. spacer 2.10|33289|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to KT070867 (Bacillus phage PBC2, complete genome) position: , mismatch: 9, identity: 0.735

atagttctcgcttctgcttcgattttttgaattt	CRISPR spacer
ttcaagcgtgcttctgcttcgattttttggatta	Protospacer
 * .  * .********************.*** 

51. spacer 2.12|33437|36|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NC_018265 (Melissococcus plutonius DAT561 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.75

taataaaaatctagatcaagatgattt-aaatgtact	CRISPR spacer
ataaaaaaatctagattaatatgatttaaaatacat-	Protospacer
  * ************.** ******* ****..*. 

52. spacer 2.12|33437|36|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP006684 (Melissococcus plutonius S1 plasmid pMEPL_178, complete sequence) position: , mismatch: 9, identity: 0.75

taataaaaatctagatcaagatgattt-aaatgtact	CRISPR spacer
ataaaaaaatctagattaatatgatttaaaatacat-	Protospacer
  * ************.** ******* ****..*. 

53. spacer 2.12|33437|36|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP021886 (Melissococcus plutonius strain DAT1033 plasmid pMP1, complete sequence) position: , mismatch: 9, identity: 0.75

taataaaaatctagatcaagatgattt-aaatgtact	CRISPR spacer
ataaaaaaatctagattaatatgatttaaaatacat-	Protospacer
  * ************.** ******* ****..*. 

54. spacer 2.12|33437|36|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP018525 (Melissococcus plutonius strain DAT585 plasmid pMP1, complete sequence) position: , mismatch: 9, identity: 0.75

taataaaaatctagatcaagatgattt-aaatgtact	CRISPR spacer
ataaaaaaatctagattaatatgatttaaaatacat-	Protospacer
  * ************.** ******* ****..*. 

55. spacer 2.19|33951|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP017255 (Clostridium taeniosporum strain 1/k plasmid pCt2, complete sequence) position: , mismatch: 10, identity: 0.706

ttcaagatttatttgaagatgttactgattctaa	CRISPR spacer
cagaagatttatttgaagttgctactgcacttga	Protospacer
.  *************** **.*****  ..*.*

56. spacer 2.19|33951|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to MT774395 (CrAssphage cr52_1, complete genome) position: , mismatch: 11, identity: 0.676

ttcaagatttatttgaagatgttactgattctaa	CRISPR spacer
aggaagatttattagaacatgttactggacacta	Protospacer
   ********** *** *********. . . *

57. spacer 2.19|33951|34|NC_019765|CRT,CRISPRCasFinder,PILER-CR matches to MT774403 (CrAssphage cr113_1, complete genome) position: , mismatch: 11, identity: 0.676

ttcaagatttatttgaagatgttactgattctaa	CRISPR spacer
aggaagatttattagaacatgttactggacacta	Protospacer
   ********** *** *********. . . *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12994 : 132427 110 Microcystis_virus(21.74%) protease,transposase,integrase attL 12909:12968|attR 130621:132501
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_019748
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019748_1 534533-535100 TypeIII-B NA
7 spacers
cas2,cmr3gr5,cmr4gr7,cmr5gr11,cmr6gr7,csx1,cas1,csx18,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019748_2 536594-537916 TypeIII-B NA
17 spacers
cas2,cmr3gr5,cmr4gr7,cmr5gr11,cmr6gr7,csx1,cas1,csx18,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019748_3 1074051-1074159 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019748_4 2796866-2796970 TypeV NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019748_5 2872261-2872502 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019748_6 3071472-3072157 Unclear I-A,I-B,II-B
9 spacers
cas2,cas1,cas5,cas7,cas8b3,cas3,cas6,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019748_7 3434760-3434873 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019748_8 3529794-3529902 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019748_9 4485921-4486141 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_019748_2 2.5|536936|37|NC_019748|PILER-CR,CRISPRCasFinder,CRT 536936-536972 37 NZ_CP017109 Lactobacillus salivarius strain CICC23174 plasmid pLS_2 sequence 29750-29786 9 0.757
NC_019748_2 2.5|536936|37|NC_019748|PILER-CR,CRISPRCasFinder,CRT 536936-536972 37 NZ_CP017108 Lactobacillus salivarius strain CICC23174 plasmid pLS_1 sequence 27160-27196 9 0.757
NC_019748_2 2.5|536936|37|NC_019748|PILER-CR,CRISPRCasFinder,CRT 536936-536972 37 NZ_CP017108 Lactobacillus salivarius strain CICC23174 plasmid pLS_1 sequence 275102-275138 9 0.757
NC_019748_2 2.8|537159|37|NC_019748|PILER-CR,CRISPRCasFinder,CRT 537159-537195 37 NZ_CP017109 Lactobacillus salivarius strain CICC23174 plasmid pLS_2 sequence 29750-29786 9 0.757
NC_019748_2 2.8|537159|37|NC_019748|PILER-CR,CRISPRCasFinder,CRT 537159-537195 37 NZ_CP017108 Lactobacillus salivarius strain CICC23174 plasmid pLS_1 sequence 27160-27196 9 0.757
NC_019748_2 2.8|537159|37|NC_019748|PILER-CR,CRISPRCasFinder,CRT 537159-537195 37 NZ_CP017108 Lactobacillus salivarius strain CICC23174 plasmid pLS_1 sequence 275102-275138 9 0.757

1. spacer 2.5|536936|37|NC_019748|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017109 (Lactobacillus salivarius strain CICC23174 plasmid pLS_2 sequence) position: , mismatch: 9, identity: 0.757

ttttttgtttaaatattctgagatta----attgtcgtcat	CRISPR spacer
ttttttgttaaaatattctgaaattattctattaact----	Protospacer
********* ***********.****    ***. *     

2. spacer 2.5|536936|37|NC_019748|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017108 (Lactobacillus salivarius strain CICC23174 plasmid pLS_1 sequence) position: , mismatch: 9, identity: 0.757

ttttttgtttaaatattctgagatta----attgtcgtcat	CRISPR spacer
ttttttgttaaaatattctgaaattattctattaact----	Protospacer
********* ***********.****    ***. *     

3. spacer 2.5|536936|37|NC_019748|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017108 (Lactobacillus salivarius strain CICC23174 plasmid pLS_1 sequence) position: , mismatch: 9, identity: 0.757

ttttttgtttaaatattctgagatta----attgtcgtcat	CRISPR spacer
ttttttgttaaaatattctgaaattattctattaact----	Protospacer
********* ***********.****    ***. *     

4. spacer 2.8|537159|37|NC_019748|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017109 (Lactobacillus salivarius strain CICC23174 plasmid pLS_2 sequence) position: , mismatch: 9, identity: 0.757

ttttttgtttaaatattctgagatta----attgtcgtcat	CRISPR spacer
ttttttgttaaaatattctgaaattattctattaact----	Protospacer
********* ***********.****    ***. *     

5. spacer 2.8|537159|37|NC_019748|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017108 (Lactobacillus salivarius strain CICC23174 plasmid pLS_1 sequence) position: , mismatch: 9, identity: 0.757

ttttttgtttaaatattctgagatta----attgtcgtcat	CRISPR spacer
ttttttgttaaaatattctgaaattattctattaact----	Protospacer
********* ***********.****    ***. *     

6. spacer 2.8|537159|37|NC_019748|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017108 (Lactobacillus salivarius strain CICC23174 plasmid pLS_1 sequence) position: , mismatch: 9, identity: 0.757

ttttttgtttaaatattctgagatta----attgtcgtcat	CRISPR spacer
ttttttgttaaaatattctgaaattattctattaact----	Protospacer
********* ***********.****    ***. *     

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3347267 : 3355584 10 Synechococcus_phage(28.57%) NA NA
DBSCAN-SWA_2 4304761 : 4349668 43 Tupanvirus(20.0%) integrase,tRNA,transposase attL 4330135:4330157|attR 4352035:4352057
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage