Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_019966 Mycobacterium sp. JS623, complete genome 3 crisprs csa3,WYL,cas3,c2c9_V-U4,RT,cas4,DEDDh,Cas14u_CAS-V,DinG 1 2 1 0
NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 0 crisprs NA 0 0 0 0
NC_019959 Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence 1 crisprs DEDDh,c2c9_V-U4,csf3gr5,csf2gr7,csf4gr11,csf1gr8 0 2 0 0
NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 1 crisprs DEDDh,cas6e,cas5,cas7,cse2gr11,cas8e,cas3,csf3gr5,csf2gr7,csf4gr11,csf1gr8 0 16 0 0

Results visualization

1. NC_019966
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019966_1 570915-570979 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019966_2 4132892-4132977 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019966_3 4713242-4713360 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_019966_1 1.1|570938|19|NC_019966|CRISPRCasFinder 570938-570956 19 NC_019966.1 5952646-5952664 2 0.895

1. spacer 1.1|570938|19|NC_019966|CRISPRCasFinder matches to position: 5952646-5952664, mismatch: 2, identity: 0.895

cccggccaaggccccggcc	CRISPR spacer
cccggccatggccccgacc	Protospacer
******** *******.**

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_019966_1 1.1|570938|19|NC_019966|CRISPRCasFinder 570938-570956 19 MK069556 Microcystis phage Me-ZS1, complete genome 9190-9208 0 1.0
NC_019966_1 1.1|570938|19|NC_019966|CRISPRCasFinder 570938-570956 19 NZ_CP023993 Streptomyces malaysiensis strain DSM 4137 plasmid unnamed, complete sequence 40423-40441 0 1.0
NC_019966_3 3.1|4713284|35|NC_019966|CRISPRCasFinder 4713284-4713318 35 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4489145-4489179 4 0.886

1. spacer 1.1|570938|19|NC_019966|CRISPRCasFinder matches to MK069556 (Microcystis phage Me-ZS1, complete genome) position: , mismatch: 0, identity: 1.0

cccggccaaggccccggcc	CRISPR spacer
cccggccaaggccccggcc	Protospacer
*******************

2. spacer 1.1|570938|19|NC_019966|CRISPRCasFinder matches to NZ_CP023993 (Streptomyces malaysiensis strain DSM 4137 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cccggccaaggccccggcc	CRISPR spacer
cccggccaaggccccggcc	Protospacer
*******************

3. spacer 3.1|4713284|35|NC_019966|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.886

cgaagacgagcgcgagtgaggatcgcagcgaggag	CRISPR spacer
cgaagacgatcgcgagcgaggatcgcagcgaggca	Protospacer
********* ******.**************** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2133016 : 2141556 10 Bacillus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_019958
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019958_1 94617-95134 TypeI-E I-E
8 spacers
cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_019958_1 1.1|94643|35|NC_019958|CRISPRCasFinder 94643-94677 35 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 94643-94677 0 1.0
NC_019958_1 1.2|94704|36|NC_019958|CRISPRCasFinder 94704-94739 36 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 94704-94739 0 1.0
NC_019958_1 1.3|94766|35|NC_019958|CRISPRCasFinder 94766-94800 35 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 94766-94800 0 1.0
NC_019958_1 1.4|94827|35|NC_019958|CRISPRCasFinder 94827-94861 35 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 94827-94861 0 1.0
NC_019958_1 1.5|94888|35|NC_019958|CRISPRCasFinder 94888-94922 35 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 94888-94922 0 1.0
NC_019958_1 1.6|94949|35|NC_019958|CRISPRCasFinder 94949-94983 35 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 94949-94983 0 1.0
NC_019958_1 1.7|95010|35|NC_019958|CRISPRCasFinder 95010-95044 35 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 95010-95044 0 1.0
NC_019958_1 1.8|95071|35|NC_019958|CRISPRCasFinder 95071-95105 35 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 95071-95105 0 1.0
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 94646-94677 0 1.0
NC_019958_1 1.10|94707|33|NC_019958|CRT 94707-94739 33 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 94707-94739 0 1.0
NC_019958_1 1.11|94769|32|NC_019958|CRT 94769-94800 32 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 94769-94800 0 1.0
NC_019958_1 1.12|94830|32|NC_019958|CRT 94830-94861 32 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 94830-94861 0 1.0
NC_019958_1 1.13|94891|32|NC_019958|CRT 94891-94922 32 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 94891-94922 0 1.0
NC_019958_1 1.14|94952|32|NC_019958|CRT 94952-94983 32 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 94952-94983 0 1.0
NC_019958_1 1.15|95013|32|NC_019958|CRT 95013-95044 32 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 95013-95044 0 1.0
NC_019958_1 1.16|95074|32|NC_019958|CRT 95074-95105 32 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 95074-95105 0 1.0
NC_019958_1 1.13|94891|32|NC_019958|CRT 94891-94922 32 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 105430-105461 5 0.844
NC_019958_1 1.14|94952|32|NC_019958|CRT 94952-94983 32 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 186827-186858 6 0.812
NC_019958_1 1.5|94888|35|NC_019958|CRISPRCasFinder 94888-94922 35 NC_019958 Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence 105430-105464 7 0.8
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 MN369761 Mycobacterium phage Malthus, complete genome 15259-15290 7 0.781
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 MK224497 Mycobacterium phage Henu3, complete genome 43628-43659 7 0.781
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 KJ944841 Mycobacterium phage Cheetobro, complete genome 15346-15377 7 0.781
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 AP018469 Mycobacterium phage Y10 DNA, complete genome, note: sample1 15335-15366 7 0.781
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 KY087992 Mycobacterium phage Mitti, complete genome 15259-15290 7 0.781
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 MF140402 Mycobacterium phage Chancellor, complete genome 15346-15377 7 0.781
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 MK524485 Mycobacterium phage MissDaisy, complete genome 15110-15141 7 0.781
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 AP018470 Mycobacterium phage Y2 DNA, complete genome 15335-15366 7 0.781
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 KT361920 Mycobacterium phage Slarp, complete genome 15346-15377 7 0.781
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 MH926058 Mycobacterium phage Reptar3000, complete genome 15088-15119 7 0.781
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 MT310882 Mycobacterium phage JF1, complete genome 15335-15366 7 0.781
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 AP018471 Mycobacterium phage Y10 DNA, complete genome, note: sample2 15335-15366 7 0.781
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 MH051258 Mycobacterium phage SamScheppers, complete genome 14862-14893 7 0.781
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 MK524488 Mycobacterium phage Patt, complete genome 15086-15117 7 0.781
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 MF140435 Mycobacterium phage Wintermute, complete genome 15335-15366 7 0.781
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 NC_027365 Mycobacterium virus Fionnbarth, complete genome 15336-15367 7 0.781
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 728716-728747 8 0.75
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1084355-1084386 8 0.75
NC_019958_1 1.10|94707|33|NC_019958|CRT 94707-94739 33 NC_021909 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1e, complete sequence 586061-586093 8 0.758
NC_019958_1 1.12|94830|32|NC_019958|CRT 94830-94861 32 NC_011887 Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence 360174-360205 8 0.75
NC_019958_1 1.13|94891|32|NC_019958|CRT 94891-94922 32 NC_008010 Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence 269145-269176 8 0.75
NC_019958_1 1.14|94952|32|NC_019958|CRT 94952-94983 32 NZ_CP030360 Salinibacter ruber strain SP38 plasmid pSR76, complete sequence 38133-38164 8 0.75
NC_019958_1 1.15|95013|32|NC_019958|CRT 95013-95044 32 NZ_CP017300 Rhodococcus sp. YL-1 plasmid pYLC1, complete sequence 165913-165944 8 0.75
NC_019958_1 1.15|95013|32|NC_019958|CRT 95013-95044 32 NZ_CP034154 Rhodococcus sp. NJ-530 plasmid unnamed2, complete sequence 122967-122998 8 0.75
NC_019958_1 1.12|94830|32|NC_019958|CRT 94830-94861 32 MK524505 Gordonia phage Dogfish, complete genome 12904-12935 9 0.719
NC_019958_1 1.13|94891|32|NC_019958|CRT 94891-94922 32 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 32606-32637 9 0.719
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 NZ_CP030355 Novosphingobium sp. P6W plasmid pP6W2, complete sequence 138953-138984 10 0.688
NC_019958_1 1.12|94830|32|NC_019958|CRT 94830-94861 32 NC_009670 Ochrobactrum anthropi ATCC 49188 plasmid pOANT02, complete sequence 7126-7157 10 0.688
NC_019958_1 1.12|94830|32|NC_019958|CRT 94830-94861 32 NZ_CP050081 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence 331791-331822 10 0.688
NC_019958_1 1.12|94830|32|NC_019958|CRT 94830-94861 32 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 330171-330202 10 0.688
NC_019958_1 1.12|94830|32|NC_019958|CRT 94830-94861 32 MK814750 Gordonia phage Ewald, complete genome 13166-13197 10 0.688
NC_019958_1 1.14|94952|32|NC_019958|CRT 94952-94983 32 NZ_CP030367 Salinibacter ruber strain M1 plasmid pSR61, complete sequence 29361-29392 10 0.688
NC_019958_1 1.16|95074|32|NC_019958|CRT 95074-95105 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 16348-16379 10 0.688
NC_019958_1 1.16|95074|32|NC_019958|CRT 95074-95105 32 NC_011961 Thermomicrobium roseum DSM 5159 plasmid unnamed, complete sequence 169315-169346 10 0.688
NC_019958_1 1.5|94888|35|NC_019958|CRISPRCasFinder 94888-94922 35 NC_008010 Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence 269145-269179 11 0.686
NC_019958_1 1.9|94646|32|NC_019958|CRT 94646-94677 32 NZ_CP025548 Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence 87977-88008 11 0.656
NC_019958_1 1.16|95074|32|NC_019958|CRT 95074-95105 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 6010802-6010833 11 0.656

1. spacer 1.1|94643|35|NC_019958|CRISPRCasFinder matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 0, identity: 1.0

gatagtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
gatagtgccgccggtccgctcagcaacgcgatcag	Protospacer
***********************************

2. spacer 1.2|94704|36|NC_019958|CRISPRCasFinder matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 0, identity: 1.0

gacaaacgcaccgcctccgaaccgagctggtaactc	CRISPR spacer
gacaaacgcaccgcctccgaaccgagctggtaactc	Protospacer
************************************

3. spacer 1.3|94766|35|NC_019958|CRISPRCasFinder matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 0, identity: 1.0

gacgaacgccttacccatcacagtcgcgcgcgatc	CRISPR spacer
gacgaacgccttacccatcacagtcgcgcgcgatc	Protospacer
***********************************

4. spacer 1.4|94827|35|NC_019958|CRISPRCasFinder matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 0, identity: 1.0

gactgtgccgccgatccactcagcgacgcgatcag	CRISPR spacer
gactgtgccgccgatccactcagcgacgcgatcag	Protospacer
***********************************

5. spacer 1.5|94888|35|NC_019958|CRISPRCasFinder matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 0, identity: 1.0

gacactatgccgggaacgcgcggccagatccactt	CRISPR spacer
gacactatgccgggaacgcgcggccagatccactt	Protospacer
***********************************

6. spacer 1.6|94949|35|NC_019958|CRISPRCasFinder matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 0, identity: 1.0

gacgtagccactgccgacgggctgtcccacatccc	CRISPR spacer
gacgtagccactgccgacgggctgtcccacatccc	Protospacer
***********************************

7. spacer 1.7|95010|35|NC_019958|CRISPRCasFinder matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 0, identity: 1.0

gacgagaccgtcaggctgcgcgggtattcctcccc	CRISPR spacer
gacgagaccgtcaggctgcgcgggtattcctcccc	Protospacer
***********************************

8. spacer 1.8|95071|35|NC_019958|CRISPRCasFinder matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 0, identity: 1.0

gacgacggcgcgccaccatgagacgccgccggatt	CRISPR spacer
gacgacggcgcgccaccatgagacgccgccggatt	Protospacer
***********************************

9. spacer 1.9|94646|32|NC_019958|CRT matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 0, identity: 1.0

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
agtgccgccggtccgctcagcaacgcgatcag	Protospacer
********************************

10. spacer 1.10|94707|33|NC_019958|CRT matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 0, identity: 1.0

aaacgcaccgcctccgaaccgagctggtaactc	CRISPR spacer
aaacgcaccgcctccgaaccgagctggtaactc	Protospacer
*********************************

11. spacer 1.11|94769|32|NC_019958|CRT matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 0, identity: 1.0

gaacgccttacccatcacagtcgcgcgcgatc	CRISPR spacer
gaacgccttacccatcacagtcgcgcgcgatc	Protospacer
********************************

12. spacer 1.12|94830|32|NC_019958|CRT matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgccgccgatccactcagcgacgcgatcag	CRISPR spacer
tgtgccgccgatccactcagcgacgcgatcag	Protospacer
********************************

13. spacer 1.13|94891|32|NC_019958|CRT matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 0, identity: 1.0

actatgccgggaacgcgcggccagatccactt	CRISPR spacer
actatgccgggaacgcgcggccagatccactt	Protospacer
********************************

14. spacer 1.14|94952|32|NC_019958|CRT matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 0, identity: 1.0

gtagccactgccgacgggctgtcccacatccc	CRISPR spacer
gtagccactgccgacgggctgtcccacatccc	Protospacer
********************************

15. spacer 1.15|95013|32|NC_019958|CRT matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 0, identity: 1.0

gagaccgtcaggctgcgcgggtattcctcccc	CRISPR spacer
gagaccgtcaggctgcgcgggtattcctcccc	Protospacer
********************************

16. spacer 1.16|95074|32|NC_019958|CRT matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 0, identity: 1.0

gacggcgcgccaccatgagacgccgccggatt	CRISPR spacer
gacggcgcgccaccatgagacgccgccggatt	Protospacer
********************************

17. spacer 1.13|94891|32|NC_019958|CRT matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 5, identity: 0.844

actatgccgggaacgcgcggccagatccactt	CRISPR spacer
cctatgccgggaacgcgcggccagatatgctg	Protospacer
 ************************* ..** 

18. spacer 1.14|94952|32|NC_019958|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812

gtagccactgccgacgggctgtcccacatccc	CRISPR spacer
gtcccctgtgccggcgggctgtcccacaaccc	Protospacer
**  **  *****.************** ***

19. spacer 1.5|94888|35|NC_019958|CRISPRCasFinder matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 7, identity: 0.8

gacactatgccgggaacgcgcggccagatccactt	CRISPR spacer
gcacctatgccgggaacgcgcggccagatatgctg	Protospacer
*   ************************* ..** 

20. spacer 1.9|94646|32|NC_019958|CRT matches to MN369761 (Mycobacterium phage Malthus, complete genome) position: , mismatch: 7, identity: 0.781

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
actgcgttcggtgcgctcggcaacgcgatcaa	Protospacer
* ***  .**** *****.************.

21. spacer 1.9|94646|32|NC_019958|CRT matches to MK224497 (Mycobacterium phage Henu3, complete genome) position: , mismatch: 7, identity: 0.781

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
actgcgttcggtgcgctcggcaacgcgatcaa	Protospacer
* ***  .**** *****.************.

22. spacer 1.9|94646|32|NC_019958|CRT matches to KJ944841 (Mycobacterium phage Cheetobro, complete genome) position: , mismatch: 7, identity: 0.781

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
actgcgttcggtgcgctcggcaacgcgatcaa	Protospacer
* ***  .**** *****.************.

23. spacer 1.9|94646|32|NC_019958|CRT matches to AP018469 (Mycobacterium phage Y10 DNA, complete genome, note: sample1) position: , mismatch: 7, identity: 0.781

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
actgcgttcggtgcgctcggcaacgcgatcaa	Protospacer
* ***  .**** *****.************.

24. spacer 1.9|94646|32|NC_019958|CRT matches to KY087992 (Mycobacterium phage Mitti, complete genome) position: , mismatch: 7, identity: 0.781

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
actgcgttcggtgcgctcggcaacgcgatcaa	Protospacer
* ***  .**** *****.************.

25. spacer 1.9|94646|32|NC_019958|CRT matches to MF140402 (Mycobacterium phage Chancellor, complete genome) position: , mismatch: 7, identity: 0.781

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
actgcgttcggtgcgctcggcaacgcgatcaa	Protospacer
* ***  .**** *****.************.

26. spacer 1.9|94646|32|NC_019958|CRT matches to MK524485 (Mycobacterium phage MissDaisy, complete genome) position: , mismatch: 7, identity: 0.781

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
actgcgttcggtgcgctcggcaacgcgatcaa	Protospacer
* ***  .**** *****.************.

27. spacer 1.9|94646|32|NC_019958|CRT matches to AP018470 (Mycobacterium phage Y2 DNA, complete genome) position: , mismatch: 7, identity: 0.781

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
actgcgttcggtgcgctcggcaacgcgatcaa	Protospacer
* ***  .**** *****.************.

28. spacer 1.9|94646|32|NC_019958|CRT matches to KT361920 (Mycobacterium phage Slarp, complete genome) position: , mismatch: 7, identity: 0.781

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
actgcgttcggtgcgctcggcaacgcgatcaa	Protospacer
* ***  .**** *****.************.

29. spacer 1.9|94646|32|NC_019958|CRT matches to MH926058 (Mycobacterium phage Reptar3000, complete genome) position: , mismatch: 7, identity: 0.781

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
actgcgttcggtgcgctcggcaacgcgatcaa	Protospacer
* ***  .**** *****.************.

30. spacer 1.9|94646|32|NC_019958|CRT matches to MT310882 (Mycobacterium phage JF1, complete genome) position: , mismatch: 7, identity: 0.781

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
actgcgttcggtgcgctcggcaacgcgatcaa	Protospacer
* ***  .**** *****.************.

31. spacer 1.9|94646|32|NC_019958|CRT matches to AP018471 (Mycobacterium phage Y10 DNA, complete genome, note: sample2) position: , mismatch: 7, identity: 0.781

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
actgcgttcggtgcgctcggcaacgcgatcaa	Protospacer
* ***  .**** *****.************.

32. spacer 1.9|94646|32|NC_019958|CRT matches to MH051258 (Mycobacterium phage SamScheppers, complete genome) position: , mismatch: 7, identity: 0.781

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
actgcgttcggtgcgctcggcaacgcgatcaa	Protospacer
* ***  .**** *****.************.

33. spacer 1.9|94646|32|NC_019958|CRT matches to MK524488 (Mycobacterium phage Patt, complete genome) position: , mismatch: 7, identity: 0.781

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
actgcgttcggtgcgctcggcaacgcgatcaa	Protospacer
* ***  .**** *****.************.

34. spacer 1.9|94646|32|NC_019958|CRT matches to MF140435 (Mycobacterium phage Wintermute, complete genome) position: , mismatch: 7, identity: 0.781

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
actgcgttcggtgcgctcggcaacgcgatcaa	Protospacer
* ***  .**** *****.************.

35. spacer 1.9|94646|32|NC_019958|CRT matches to NC_027365 (Mycobacterium virus Fionnbarth, complete genome) position: , mismatch: 7, identity: 0.781

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
actgcgttcggtgcgctcggcaacgcgatcaa	Protospacer
* ***  .**** *****.************.

36. spacer 1.9|94646|32|NC_019958|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
tcttccgccggtccgcccagcaccgcgccctg	Protospacer
  * ************.***** **** .* *

37. spacer 1.9|94646|32|NC_019958|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
tcttccgccggtccgcccagcaccgcgccctg	Protospacer
  * ************.***** **** .* *

38. spacer 1.10|94707|33|NC_019958|CRT matches to NC_021909 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1e, complete sequence) position: , mismatch: 8, identity: 0.758

aaacgcaccgcctccgaaccgagctggtaactc	CRISPR spacer
caacgcaccggctccgaaccgtgctcggcacgg	Protospacer
 ********* ********** *** *  **  

39. spacer 1.12|94830|32|NC_019958|CRT matches to NC_011887 (Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence) position: , mismatch: 8, identity: 0.75

tgtgccgccgatccactcagcgacgcgatcag	CRISPR spacer
tacgatggcgatcccctctgcgacgcgatcac	Protospacer
*..* .* ****** *** ************ 

40. spacer 1.13|94891|32|NC_019958|CRT matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 8, identity: 0.75

actatgccgggaacgcgcggccagatccactt	CRISPR spacer
tcaatgcctggaacgcgcggcccgatccctac	Protospacer
 * ***** ************* ***** . .

41. spacer 1.14|94952|32|NC_019958|CRT matches to NZ_CP030360 (Salinibacter ruber strain SP38 plasmid pSR76, complete sequence) position: , mismatch: 8, identity: 0.75

gtagcc----actgccgacgggctgtcccacatccc	CRISPR spacer
----cctcaaactgctggcgggctgtcccacatcgg	Protospacer
    **    *****.*.****************  

42. spacer 1.15|95013|32|NC_019958|CRT matches to NZ_CP017300 (Rhodococcus sp. YL-1 plasmid pYLC1, complete sequence) position: , mismatch: 8, identity: 0.75

gagaccgtcaggctgcgcgggtattcctcccc	CRISPR spacer
ggaaccgtcacgctgcgcggatattcccctta	Protospacer
*..******* *********.******.*.. 

43. spacer 1.15|95013|32|NC_019958|CRT matches to NZ_CP034154 (Rhodococcus sp. NJ-530 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

gagaccgtcaggctgcgcgggtattcctcccc	CRISPR spacer
ggaaccgtcacgctgcgcggatattcccctta	Protospacer
*..******* *********.******.*.. 

44. spacer 1.12|94830|32|NC_019958|CRT matches to MK524505 (Gordonia phage Dogfish, complete genome) position: , mismatch: 9, identity: 0.719

tgtgccgccgatccactcagcgacgcgatcag	CRISPR spacer
ctggccgccgatccactcggcgacgccagtga	Protospacer
.  ***************.******* * ...

45. spacer 1.13|94891|32|NC_019958|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 9, identity: 0.719

actatgccgggaacgcgcggccagatccactt	CRISPR spacer
aggctgccgggaacgcgccgcccgatcctagg	Protospacer
*   ************** *** *****    

46. spacer 1.9|94646|32|NC_019958|CRT matches to NZ_CP030355 (Novosphingobium sp. P6W plasmid pP6W2, complete sequence) position: , mismatch: 10, identity: 0.688

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
gtcgaagccggtccggtcagcagcgcgatgcc	Protospacer
. .*  ********* ******.******   

47. spacer 1.12|94830|32|NC_019958|CRT matches to NC_009670 (Ochrobactrum anthropi ATCC 49188 plasmid pOANT02, complete sequence) position: , mismatch: 10, identity: 0.688

tgtgccgccgatccactcagcgacgcgatcag	CRISPR spacer
gacatagccgatcaactcggcgacgcgatcgc	Protospacer
 .... ******* ****.***********. 

48. spacer 1.12|94830|32|NC_019958|CRT matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 10, identity: 0.688

tgtgccgccgatccactcagcgacgcgatcag	CRISPR spacer
gatgccgccgatccactcaacaacggcaaagc	Protospacer
 .*****************.*.***  *  . 

49. spacer 1.12|94830|32|NC_019958|CRT matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 10, identity: 0.688

tgtgccgccgatccactcagcgacgcgatcag	CRISPR spacer
gatgccgccgatccactcaacaacggcaaagc	Protospacer
 .*****************.*.***  *  . 

50. spacer 1.12|94830|32|NC_019958|CRT matches to MK814750 (Gordonia phage Ewald, complete genome) position: , mismatch: 10, identity: 0.688

tgtgccgccgatccactcagcgacgcgatcag	CRISPR spacer
ctggccgccgatccagtcggcgacgccagtga	Protospacer
.  ************ **.******* * ...

51. spacer 1.14|94952|32|NC_019958|CRT matches to NZ_CP030367 (Salinibacter ruber strain M1 plasmid pSR61, complete sequence) position: , mismatch: 10, identity: 0.688

gtagccactgccgacgggctgtcccacatccc	CRISPR spacer
tctcaaactgctgccgggctgtcccacattcg	Protospacer
 .    *****.* ***************.* 

52. spacer 1.16|95074|32|NC_019958|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688

gacggcgcgccaccatgagacgccgccggatt	CRISPR spacer
gggtgcgcgccgccgtgagacgccgccaccgc	Protospacer
*.  *******.**.************.   .

53. spacer 1.16|95074|32|NC_019958|CRT matches to NC_011961 (Thermomicrobium roseum DSM 5159 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gacggcgcgccaccatgagacgccgccggatt	CRISPR spacer
agctgcgcgccgccatgaggcgccgccacgcc	Protospacer
..* *******.*******.*******. ...

54. spacer 1.5|94888|35|NC_019958|CRISPRCasFinder matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 11, identity: 0.686

gacactatgccgggaacgcgcggccagatccactt	CRISPR spacer
tggtcaatgcctggaacgcgcggcccgatccctac	Protospacer
 .  * ***** ************* ***** . .

55. spacer 1.9|94646|32|NC_019958|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656

agtgccgccggtccgctcagcaacgcgatcag	CRISPR spacer
gtggccgccgggccgctcagcgacgccgatgc	Protospacer
.  ******** *********.**** . .. 

56. spacer 1.16|95074|32|NC_019958|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.656

gacggcgcgccaccatgagacgccgccggatt	CRISPR spacer
cggtgcgcgccgccgtgagacgccgccaccgc	Protospacer
 .  *******.**.************.   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_019959
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_019959_1 39563-39752 TypeV-U4 NA
2 spacers
c2c9_V-U4

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_019959_1 1.1|39591|52|NC_019959|CRISPRCasFinder 39591-39642 52 NC_019959 Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence 39591-39642 0 1.0
NC_019959_1 1.2|39671|54|NC_019959|CRISPRCasFinder 39671-39724 54 NC_019959 Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence 39671-39724 0 1.0

1. spacer 1.1|39591|52|NC_019959|CRISPRCasFinder matches to NC_019959 (Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence) position: , mismatch: 0, identity: 1.0

gacgccttgtaggcaggggcaggggcaagcaagcaatgtcgccaagcagcgg	CRISPR spacer
gacgccttgtaggcaggggcaggggcaagcaagcaatgtcgccaagcagcgg	Protospacer
****************************************************

2. spacer 1.2|39671|54|NC_019959|CRISPRCasFinder matches to NC_019959 (Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence) position: , mismatch: 0, identity: 1.0

cacgatcagcgccagccggcggccggccggccgggccgatcgtgatacgggttc	CRISPR spacer
cacgatcagcgccagccggcggccggccggccgggccgatcgtgatacgggttc	Protospacer
******************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage