Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_020156 Nonlabens dokdonensis DSW-6, complete sequence 6 crisprs csa3,DEDDh,cas3,PD-DExK,WYL 0 1 2 0

Results visualization

1. NC_020156
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020156_1 1027685-1027831 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020156_2 1101825-1102018 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020156_3 2316163-2316242 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020156_4 2636822-2636905 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020156_5 2757867-2757976 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020156_6 3501124-3501237 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_020156_2 2.2|1101962|30|NC_020156|PILER-CR 1101962-1101991 30 NZ_AP022320 Burkholderia sp. THE68 plasmid BTHE68_p2, complete sequence 104708-104737 9 0.7

1. spacer 2.2|1101962|30|NC_020156|PILER-CR matches to NZ_AP022320 (Burkholderia sp. THE68 plasmid BTHE68_p2, complete sequence) position: , mismatch: 9, identity: 0.7

tgaaattaaaagctcgatgaaacatactat	CRISPR spacer
cgaaattgaaagctcgaggaaacaagaacg	Protospacer
.******.********* ****** .    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 693001 : 699313 9 Bacillus_virus(14.29%) NA NA
DBSCAN-SWA_2 3028015 : 3068517 43 Sulfolobus_monocaudavirus(25.0%) transposase,integrase,protease attL 3020419:3020439|attR 3072399:3072419
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage