Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_020163 Escherichia coli APEC O78, complete sequence 6 crisprs DEDDh,DinG,cas3,c2c9_V-U4,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK,RT 0 20 11 0

Results visualization

1. NC_020163
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020163_1 482475-482621 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020163_2 768436-768551 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020163_3 954018-954171 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020163_4 3609748-3610387 TypeI-E I-E
10 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020163_5 3636085-3636601 Orphan I-E
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020163_6 4065526-4065665 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_020163_3 3.1|954071|48|NC_020163|CRISPRCasFinder 954071-954118 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4089-4136 3 0.938
NC_020163_3 3.1|954071|48|NC_020163|CRISPRCasFinder 954071-954118 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4088-4135 3 0.938
NC_020163_3 3.1|954071|48|NC_020163|CRISPRCasFinder 954071-954118 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4088-4135 3 0.938
NC_020163_3 3.1|954071|48|NC_020163|CRISPRCasFinder 954071-954118 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4088-4135 3 0.938
NC_020163_4 4.1|3609777|32|NC_020163|CRT 3609777-3609808 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 3 0.906
NC_020163_1 1.1|482524|49|NC_020163|CRISPRCasFinder 482524-482572 49 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31255-31303 6 0.878
NC_020163_4 4.1|3609777|32|NC_020163|CRT 3609777-3609808 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
NC_020163_4 4.13|3609961|31|NC_020163|CRISPRCasFinder 3609961-3609991 31 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 530641-530671 7 0.774
NC_020163_4 4.16|3610144|31|NC_020163|CRISPRCasFinder 3610144-3610174 31 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 17977-18007 7 0.774
NC_020163_4 4.19|3610327|31|NC_020163|CRISPRCasFinder 3610327-3610357 31 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 62682-62712 7 0.774
NC_020163_4 4.19|3610327|31|NC_020163|CRISPRCasFinder 3610327-3610357 31 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1222106-1222136 7 0.774
NC_020163_4 4.19|3610327|31|NC_020163|CRISPRCasFinder 3610327-3610357 31 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 2467672-2467702 7 0.774
NC_020163_5 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT 3636175-3636206 32 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 51276-51307 7 0.781
NC_020163_5 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT 3636175-3636206 32 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 45716-45747 7 0.781
NC_020163_5 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT 3636175-3636206 32 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 51276-51307 7 0.781
NC_020163_5 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT 3636175-3636206 32 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 45716-45747 7 0.781
NC_020163_5 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT 3636175-3636206 32 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 51276-51307 7 0.781
NC_020163_5 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT 3636175-3636206 32 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 51276-51307 7 0.781
NC_020163_5 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT 3636175-3636206 32 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 51276-51307 7 0.781
NC_020163_5 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT 3636175-3636206 32 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 29015-29046 7 0.781
NC_020163_5 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT 3636175-3636206 32 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 78292-78323 7 0.781
NC_020163_5 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT 3636175-3636206 32 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 39563-39594 7 0.781
NC_020163_5 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT 3636175-3636206 32 KU932021 Escherichia coli plasmid pEC3I, complete sequence 51902-51933 7 0.781
NC_020163_5 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT 3636175-3636206 32 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 18560-18591 7 0.781
NC_020163_5 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT 3636175-3636206 32 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 49240-49271 7 0.781
NC_020163_5 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT 3636175-3636206 32 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 81434-81465 7 0.781
NC_020163_5 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT 3636175-3636206 32 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 28916-28947 7 0.781
NC_020163_5 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT 3636175-3636206 32 NZ_MH287044 Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence 36182-36213 7 0.781
NC_020163_5 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT 3636175-3636206 32 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 32230-32261 7 0.781
NC_020163_5 5.10|3636176|32|NC_020163|PILER-CR 3636176-3636207 32 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 51276-51307 7 0.781
NC_020163_5 5.10|3636176|32|NC_020163|PILER-CR 3636176-3636207 32 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 45716-45747 7 0.781
NC_020163_5 5.10|3636176|32|NC_020163|PILER-CR 3636176-3636207 32 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 51276-51307 7 0.781
NC_020163_5 5.10|3636176|32|NC_020163|PILER-CR 3636176-3636207 32 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 45716-45747 7 0.781
NC_020163_5 5.10|3636176|32|NC_020163|PILER-CR 3636176-3636207 32 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 51276-51307 7 0.781
NC_020163_5 5.10|3636176|32|NC_020163|PILER-CR 3636176-3636207 32 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 51276-51307 7 0.781
NC_020163_5 5.10|3636176|32|NC_020163|PILER-CR 3636176-3636207 32 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 51276-51307 7 0.781
NC_020163_5 5.10|3636176|32|NC_020163|PILER-CR 3636176-3636207 32 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 29015-29046 7 0.781
NC_020163_5 5.10|3636176|32|NC_020163|PILER-CR 3636176-3636207 32 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 78292-78323 7 0.781
NC_020163_5 5.10|3636176|32|NC_020163|PILER-CR 3636176-3636207 32 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 39563-39594 7 0.781
NC_020163_5 5.10|3636176|32|NC_020163|PILER-CR 3636176-3636207 32 KU932021 Escherichia coli plasmid pEC3I, complete sequence 51902-51933 7 0.781
NC_020163_5 5.10|3636176|32|NC_020163|PILER-CR 3636176-3636207 32 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 18560-18591 7 0.781
NC_020163_5 5.10|3636176|32|NC_020163|PILER-CR 3636176-3636207 32 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 49240-49271 7 0.781
NC_020163_5 5.10|3636176|32|NC_020163|PILER-CR 3636176-3636207 32 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 81434-81465 7 0.781
NC_020163_5 5.10|3636176|32|NC_020163|PILER-CR 3636176-3636207 32 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 28916-28947 7 0.781
NC_020163_5 5.10|3636176|32|NC_020163|PILER-CR 3636176-3636207 32 NZ_MH287044 Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence 36182-36213 7 0.781
NC_020163_5 5.10|3636176|32|NC_020163|PILER-CR 3636176-3636207 32 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 32230-32261 7 0.781
NC_020163_6 6.1|4065575|42|NC_020163|CRISPRCasFinder 4065575-4065616 42 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30214-30255 7 0.833
NC_020163_1 1.1|482524|49|NC_020163|CRISPRCasFinder 482524-482572 49 MT230402 Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence 275-323 8 0.837
NC_020163_1 1.1|482524|49|NC_020163|CRISPRCasFinder 482524-482572 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14152-14200 8 0.837
NC_020163_4 4.1|3609777|32|NC_020163|CRT 3609777-3609808 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
NC_020163_4 4.3|3609899|32|NC_020163|CRT,PILER-CR 3609899-3609930 32 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 532343-532374 8 0.75
NC_020163_4 4.4|3609960|32|NC_020163|CRT,PILER-CR 3609960-3609991 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 148991-149022 8 0.75
NC_020163_4 4.4|3609960|32|NC_020163|CRT,PILER-CR 3609960-3609991 32 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 530640-530671 8 0.75
NC_020163_4 4.7|3610143|32|NC_020163|CRT,PILER-CR 3610143-3610174 32 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 17977-18008 8 0.75
NC_020163_4 4.7|3610143|32|NC_020163|CRT,PILER-CR 3610143-3610174 32 NZ_CP017753 Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence 97497-97528 8 0.75
NC_020163_4 4.10|3610326|32|NC_020163|CRT,PILER-CR 3610326-3610357 32 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 62682-62713 8 0.75
NC_020163_4 4.10|3610326|32|NC_020163|CRT,PILER-CR 3610326-3610357 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1222106-1222137 8 0.75
NC_020163_4 4.10|3610326|32|NC_020163|CRT,PILER-CR 3610326-3610357 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 2467671-2467702 8 0.75
NC_020163_4 4.10|3610326|32|NC_020163|CRT,PILER-CR 3610326-3610357 32 NC_008759 Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence 12670-12701 8 0.75
NC_020163_4 4.13|3609961|31|NC_020163|CRISPRCasFinder 3609961-3609991 31 NZ_CP036297 Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence 14953-14983 8 0.742
NC_020163_4 4.13|3609961|31|NC_020163|CRISPRCasFinder 3609961-3609991 31 NZ_CP036288 Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence 14983-15013 8 0.742
NC_020163_4 4.13|3609961|31|NC_020163|CRISPRCasFinder 3609961-3609991 31 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 3454-3484 8 0.742
NC_020163_4 4.13|3609961|31|NC_020163|CRISPRCasFinder 3609961-3609991 31 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 148992-149022 8 0.742
NC_020163_4 4.16|3610144|31|NC_020163|CRISPRCasFinder 3610144-3610174 31 NZ_CP017753 Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence 97498-97528 8 0.742
NC_020163_5 5.3|3636236|32|NC_020163|CRISPRCasFinder,CRT 3636236-3636267 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1417960-1417991 8 0.75
NC_020163_5 5.11|3636237|32|NC_020163|PILER-CR 3636237-3636268 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1417960-1417991 8 0.75
NC_020163_6 6.1|4065575|42|NC_020163|CRISPRCasFinder 4065575-4065616 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24899-24940 8 0.81
NC_020163_4 4.1|3609777|32|NC_020163|CRT 3609777-3609808 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 9 0.719
NC_020163_4 4.3|3609899|32|NC_020163|CRT,PILER-CR 3609899-3609930 32 NZ_CP040723 Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence 35740-35771 9 0.719
NC_020163_4 4.4|3609960|32|NC_020163|CRT,PILER-CR 3609960-3609991 32 NZ_CP036297 Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence 14953-14984 9 0.719
NC_020163_4 4.4|3609960|32|NC_020163|CRT,PILER-CR 3609960-3609991 32 NZ_CP036288 Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence 14983-15014 9 0.719
NC_020163_4 4.4|3609960|32|NC_020163|CRT,PILER-CR 3609960-3609991 32 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 3454-3485 9 0.719
NC_020163_4 4.7|3610143|32|NC_020163|CRT,PILER-CR 3610143-3610174 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 405875-405906 9 0.719
NC_020163_4 4.12|3609900|31|NC_020163|CRISPRCasFinder 3609900-3609930 31 NZ_CP040723 Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence 35740-35770 9 0.71
NC_020163_4 4.16|3610144|31|NC_020163|CRISPRCasFinder 3610144-3610174 31 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 405875-405905 9 0.71
NC_020163_4 4.16|3610144|31|NC_020163|CRISPRCasFinder 3610144-3610174 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2248363-2248393 9 0.71
NC_020163_4 4.18|3610266|31|NC_020163|CRISPRCasFinder 3610266-3610296 31 CP011075 Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence 244686-244716 9 0.71
NC_020163_4 4.18|3610266|31|NC_020163|CRISPRCasFinder 3610266-3610296 31 GU075905 Prochlorococcus phage P-HM2, complete genome 78536-78566 9 0.71
NC_020163_4 4.19|3610327|31|NC_020163|CRISPRCasFinder 3610327-3610357 31 NC_011987 Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence 86182-86212 9 0.71
NC_020163_6 6.1|4065575|42|NC_020163|CRISPRCasFinder 4065575-4065616 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24786-24827 9 0.786
NC_020163_1 1.1|482524|49|NC_020163|CRISPRCasFinder 482524-482572 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 208985-209033 10 0.796
NC_020163_1 1.1|482524|49|NC_020163|CRISPRCasFinder 482524-482572 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 219479-219527 10 0.796
NC_020163_1 1.1|482524|49|NC_020163|CRISPRCasFinder 482524-482572 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 61920-61968 10 0.796
NC_020163_1 1.1|482524|49|NC_020163|CRISPRCasFinder 482524-482572 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 210313-210361 10 0.796
NC_020163_1 1.1|482524|49|NC_020163|CRISPRCasFinder 482524-482572 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 191268-191316 10 0.796
NC_020163_4 4.7|3610143|32|NC_020163|CRT,PILER-CR 3610143-3610174 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2248362-2248393 10 0.688
NC_020163_4 4.9|3610265|32|NC_020163|CRT,PILER-CR 3610265-3610296 32 CP011075 Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence 244686-244717 10 0.688
NC_020163_4 4.9|3610265|32|NC_020163|CRT,PILER-CR 3610265-3610296 32 GU075905 Prochlorococcus phage P-HM2, complete genome 78536-78567 10 0.688
NC_020163_4 4.10|3610326|32|NC_020163|CRT,PILER-CR 3610326-3610357 32 NC_011987 Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence 86181-86212 10 0.688
NC_020163_5 5.8|3636541|32|NC_020163|CRISPRCasFinder,CRT 3636541-3636572 32 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 51062-51093 10 0.688
NC_020163_5 5.16|3636542|32|NC_020163|PILER-CR 3636542-3636573 32 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 51062-51093 10 0.688
NC_020163_1 1.1|482524|49|NC_020163|CRISPRCasFinder 482524-482572 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 6786-6834 11 0.776
NC_020163_1 1.1|482524|49|NC_020163|CRISPRCasFinder 482524-482572 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14243-14291 11 0.776
NC_020163_1 1.1|482524|49|NC_020163|CRISPRCasFinder 482524-482572 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87119-87167 12 0.755

1. spacer 3.1|954071|48|NC_020163|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 3, identity: 0.938

tttacgccgcatccggcggttatgcgcagatgcctgatgcgacgctga	CRISPR spacer
tttatgccgcatccggcagttatgcgcagatgcctgatgcgacgctgg	Protospacer
****.************.*****************************.

2. spacer 3.1|954071|48|NC_020163|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 3, identity: 0.938

tttacgccgcatccggcggttatgcgcagatgcctgatgcgacgctga	CRISPR spacer
tttatgccgcatccggcagttatgcgcagatgcctgatgcgacgctgg	Protospacer
****.************.*****************************.

3. spacer 3.1|954071|48|NC_020163|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 3, identity: 0.938

tttacgccgcatccggcggttatgcgcagatgcctgatgcgacgctga	CRISPR spacer
tttatgccgcatccggcagttatgcgcagatgcctgatgcgacgctgg	Protospacer
****.************.*****************************.

4. spacer 3.1|954071|48|NC_020163|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 3, identity: 0.938

tttacgccgcatccggcggttatgcgcagatgcctgatgcgacgctga	CRISPR spacer
tttatgccgcatccggcagttatgcgcagatgcctgatgcgacgctgg	Protospacer
****.************.*****************************.

5. spacer 4.1|3609777|32|NC_020163|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtc	Protospacer
.*******.*********************.*

6. spacer 1.1|482524|49|NC_020163|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 6, identity: 0.878

ttgccagatgcgacgctgtcgcgtcttatcaggcctacgggtccggtgc--	CRISPR spacer
atgcctgatgcgacgctgtcgcgtcttatcaggcctacag--ccgttgcca	Protospacer
 **** ********************************.*  *** ***  

7. spacer 4.1|3609777|32|NC_020163|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781

taagtgat-atccatcatcgcatccagtgcgcc	CRISPR spacer
-ggttgatcgtccttcatcgcagccagtgcgcc	Protospacer
 .. **** .*** ******** **********

8. spacer 4.13|3609961|31|NC_020163|CRISPRCasFinder matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774

acgccagccacctgcttcgccagccgttcgg	CRISPR spacer
tggcccatcacctgcttcgccacctgttcgg	Protospacer
  *** ..************** *.******

9. spacer 4.16|3610144|31|NC_020163|CRISPRCasFinder matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

cacggtagcgccactgcgcgtcggtgacggg	CRISPR spacer
gttggtagcggccctgcgcgtcggtgacgct	Protospacer
  .******* * ****************  

10. spacer 4.19|3610327|31|NC_020163|CRISPRCasFinder matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774

attgcggatgctcccggaattgcgcgggcaa	CRISPR spacer
attgcggatgctgccggcattgcgataggga	Protospacer
************ **** ******  .* .*

11. spacer 4.19|3610327|31|NC_020163|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.774

attgcggatgctcccggaattgcgcgggcaa	CRISPR spacer
gatggcgctgctcacggaattgcgcgcgcaa	Protospacer
. **  * ***** ************ ****

12. spacer 4.19|3610327|31|NC_020163|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

attgcggatgctcccggaattgcgcgggcaa	CRISPR spacer
gatggcgctgctcacggaattgcgcgcgcaa	Protospacer
. **  * ***** ************ ****

13. spacer 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

14. spacer 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

15. spacer 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

16. spacer 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

17. spacer 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

18. spacer 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

19. spacer 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

20. spacer 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

21. spacer 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

22. spacer 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

23. spacer 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

24. spacer 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

25. spacer 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

26. spacer 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

27. spacer 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

28. spacer 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT matches to NZ_MH287044 (Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

29. spacer 5.2|3636175|32|NC_020163|CRISPRCasFinder,CRT matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

30. spacer 5.10|3636176|32|NC_020163|PILER-CR matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

31. spacer 5.10|3636176|32|NC_020163|PILER-CR matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

32. spacer 5.10|3636176|32|NC_020163|PILER-CR matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

33. spacer 5.10|3636176|32|NC_020163|PILER-CR matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

34. spacer 5.10|3636176|32|NC_020163|PILER-CR matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

35. spacer 5.10|3636176|32|NC_020163|PILER-CR matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

36. spacer 5.10|3636176|32|NC_020163|PILER-CR matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

37. spacer 5.10|3636176|32|NC_020163|PILER-CR matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

38. spacer 5.10|3636176|32|NC_020163|PILER-CR matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

39. spacer 5.10|3636176|32|NC_020163|PILER-CR matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

40. spacer 5.10|3636176|32|NC_020163|PILER-CR matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

41. spacer 5.10|3636176|32|NC_020163|PILER-CR matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

42. spacer 5.10|3636176|32|NC_020163|PILER-CR matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

43. spacer 5.10|3636176|32|NC_020163|PILER-CR matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

44. spacer 5.10|3636176|32|NC_020163|PILER-CR matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

45. spacer 5.10|3636176|32|NC_020163|PILER-CR matches to NZ_MH287044 (Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

46. spacer 5.10|3636176|32|NC_020163|PILER-CR matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

47. spacer 6.1|4065575|42|NC_020163|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.833

acgtaggtcagataaggtgtttacgccgcatccgactgctgt	CRISPR spacer
gcgtaggccagataaggcgtttacgccgcatccggcatttgt	Protospacer
.******.*********.****************.*  .***

48. spacer 1.1|482524|49|NC_020163|CRISPRCasFinder matches to MT230402 (Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence) position: , mismatch: 8, identity: 0.837

ttgccagatgcgacgctgtcgcgtcttatcaggcctacgggtccggtgc-	CRISPR spacer
atgcctgatgcgacgctgtcgcgtcttatcaggcctacaaa-ccgttacc	Protospacer
 **** ********************************... *** *.* 

49. spacer 1.1|482524|49|NC_020163|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 8, identity: 0.837

ttgccagatgcgacgctgtcgcgtcttatcaggcctacgggtccggtgc--	CRISPR spacer
acgcctgatgcgtcgctgtcgcgtcttatcaggcctacag--ccgttgccg	Protospacer
 .*** ****** *************************.*  *** ***  

50. spacer 4.1|3609777|32|NC_020163|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

taagtg---atatccatcatcgcatccagtgcgcc	CRISPR spacer
---gtgcgcccctccatcaccgcttccagtgcgcc	Protospacer
   ***    . *******.*** ***********

51. spacer 4.3|3609899|32|NC_020163|CRT,PILER-CR matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.75

ggatctgccagcgcctctgcggggcggtaaac	CRISPR spacer
ggatcggccagcgcatctgcgggaggatgatg	Protospacer
***** ******** ********. *.*.*  

52. spacer 4.4|3609960|32|NC_020163|CRT,PILER-CR matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tacgccagccacctgcttcgccagccgttcgg	CRISPR spacer
ttccgcagccgcctccttcgccagccgtaccc	Protospacer
* *  *****.*** ************* *  

53. spacer 4.4|3609960|32|NC_020163|CRT,PILER-CR matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

tacgccagccacctgcttcgccagccgttcgg	CRISPR spacer
ctggcccatcacctgcttcgccacctgttcgg	Protospacer
.  *** ..************** *.******

54. spacer 4.7|3610143|32|NC_020163|CRT,PILER-CR matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tcacggtagcgccactgcgcgtcggtgacggg	CRISPR spacer
agttggtagcggccctgcgcgtcggtgacgct	Protospacer
   .******* * ****************  

55. spacer 4.7|3610143|32|NC_020163|CRT,PILER-CR matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tcacggtagcgccactgcgcgtcggtgacggg	CRISPR spacer
ttgaagaagcgcgactgcgcgtcggtgacgtc	Protospacer
*.. .* ***** *****************  

56. spacer 4.10|3610326|32|NC_020163|CRT,PILER-CR matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

aattgcggatgctcccggaattgcgcgggcaa	CRISPR spacer
gattgcggatgctgccggcattgcgataggga	Protospacer
.************ **** ******  .* .*

57. spacer 4.10|3610326|32|NC_020163|CRT,PILER-CR matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

aattgcggatgctcccggaattgcgcgggcaa	CRISPR spacer
tgatggcgctgctcacggaattgcgcgcgcaa	Protospacer
 . **  * ***** ************ ****

58. spacer 4.10|3610326|32|NC_020163|CRT,PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

aattgcggatgctcccggaattgcgcgggcaa	CRISPR spacer
tgatggcgctgctcacggaattgcgcgcgcaa	Protospacer
 . **  * ***** ************ ****

59. spacer 4.10|3610326|32|NC_020163|CRT,PILER-CR matches to NC_008759 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence) position: , mismatch: 8, identity: 0.75

aattgcggatgctcccggaa-----ttgcgcgggcaa	CRISPR spacer
aaatgcggatgctcccggaaatgagtttcacg-----	Protospacer
** *****************     ** *.**     

60. spacer 4.13|3609961|31|NC_020163|CRISPRCasFinder matches to NZ_CP036297 (Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence) position: , mismatch: 8, identity: 0.742

acgccagccacctgcttcgccagccgttcgg	CRISPR spacer
acgcaagccacctgcatcgccagctgccgct	Protospacer
**** ********** ********.*..   

61. spacer 4.13|3609961|31|NC_020163|CRISPRCasFinder matches to NZ_CP036288 (Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence) position: , mismatch: 8, identity: 0.742

acgccagccacctgcttcgccagccgttcgg	CRISPR spacer
acgcaagccacctgcatcgccagctgccgct	Protospacer
**** ********** ********.*..   

62. spacer 4.13|3609961|31|NC_020163|CRISPRCasFinder matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 8, identity: 0.742

acgccagccacctgcttcgccagccgttcgg	CRISPR spacer
tcggcagccacctgctgcgccagctgcgcaa	Protospacer
 ** ************ *******.*. *..

63. spacer 4.13|3609961|31|NC_020163|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

acgccagccacctgcttcgccagccgttcgg	CRISPR spacer
tccgcagccgcctccttcgccagccgtaccc	Protospacer
 *  *****.*** ************* *  

64. spacer 4.16|3610144|31|NC_020163|CRISPRCasFinder matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

cacggtagcgccactgcgcgtcggtgacggg	CRISPR spacer
tgaagaagcgcgactgcgcgtcggtgacgtc	Protospacer
.. .* ***** *****************  

65. spacer 5.3|3636236|32|NC_020163|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tggttcactcacgcaacgtctgagcgcgttga	CRISPR spacer
cggggtaatcacgcaacgtccgaccgcgttgt	Protospacer
.**  .* ************.** ******* 

66. spacer 5.11|3636237|32|NC_020163|PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tggttcactcacgcaacgtctgagcgcgttga	CRISPR spacer
cggggtaatcacgcaacgtccgaccgcgttgt	Protospacer
.**  .* ************.** ******* 

67. spacer 6.1|4065575|42|NC_020163|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 8, identity: 0.81

acgtaggtcagataaggtgtttacgccgcatccgactgctgt	CRISPR spacer
ttgtaggtcggataaggcgtttacgccgcatccgacatcaat	Protospacer
 .*******.*******.******************  * .*

68. spacer 4.1|3609777|32|NC_020163|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
ctcatcgcatccatcatcggttccagtgcgcc	Protospacer
.  .* ..***********  ***********

69. spacer 4.3|3609899|32|NC_020163|CRT,PILER-CR matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

ggatctgccagcgcctctgcggggcggtaaac	CRISPR spacer
gtcgctgccagcgcctcggcgaggcggtctcg	Protospacer
*   ************* ***.******    

70. spacer 4.4|3609960|32|NC_020163|CRT,PILER-CR matches to NZ_CP036297 (Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence) position: , mismatch: 9, identity: 0.719

tacgccagccacctgcttcgccagccgttcgg	CRISPR spacer
cacgcaagccacctgcatcgccagctgccgct	Protospacer
.**** ********** ********.*..   

71. spacer 4.4|3609960|32|NC_020163|CRT,PILER-CR matches to NZ_CP036288 (Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence) position: , mismatch: 9, identity: 0.719

tacgccagccacctgcttcgccagccgttcgg	CRISPR spacer
cacgcaagccacctgcatcgccagctgccgct	Protospacer
.**** ********** ********.*..   

72. spacer 4.4|3609960|32|NC_020163|CRT,PILER-CR matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 9, identity: 0.719

tacgccagccacctgcttcgccagccgttcgg	CRISPR spacer
ctcggcagccacctgctgcgccagctgcgcaa	Protospacer
. ** ************ *******.*. *..

73. spacer 4.7|3610143|32|NC_020163|CRT,PILER-CR matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

tcacggtagcgccactgcgcgtcggtgacggg	CRISPR spacer
ttgaagaagcgcgactgcgcgtcagtgacgtc	Protospacer
*.. .* ***** **********.******  

74. spacer 4.12|3609900|31|NC_020163|CRISPRCasFinder matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.71

gatctgccagcgcctctgcggggcggtaaac	CRISPR spacer
tcgctgccagcgcctcggcgaggcggtctcg	Protospacer
   ************* ***.******    

75. spacer 4.16|3610144|31|NC_020163|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

cacggtagcgccactgcgcgtcggtgacggg	CRISPR spacer
tgaagaagcgcgactgcgcgtcagtgacgtc	Protospacer
.. .* ***** **********.******  

76. spacer 4.16|3610144|31|NC_020163|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.71

cacggtagcgccactgcgcgtcggtgacggg	CRISPR spacer
ggacgtcgcgccactgggcgtcggtgatgtc	Protospacer
 .  ** ********* **********.*  

77. spacer 4.18|3610266|31|NC_020163|CRISPRCasFinder matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

taattcgcaaatcaatatatattttgtccgt	CRISPR spacer
attttcggaaatcaatctatattttgcctca	Protospacer
   **** ******** *********.*.  

78. spacer 4.18|3610266|31|NC_020163|CRISPRCasFinder matches to GU075905 (Prochlorococcus phage P-HM2, complete genome) position: , mismatch: 9, identity: 0.71

taattcgcaaatcaatatatattttgtccgt	CRISPR spacer
cagaagtaaaatcaatatataatttttccgt	Protospacer
.*.     ************* *** *****

79. spacer 4.19|3610327|31|NC_020163|CRISPRCasFinder matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 9, identity: 0.71

attgcggatgctcccggaattgcgcgggcaa	CRISPR spacer
ccagcggatgctcctcgaattgcgcggtagc	Protospacer
 . ***********. ***********  . 

80. spacer 6.1|4065575|42|NC_020163|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.786

acgtaggtcagataaggtgtttacgccgcatccgactgctgt	CRISPR spacer
ttgtaggtcggataaggcgtttacgccgcatccgacatcaac	Protospacer
 .*******.*******.******************  * ..

81. spacer 1.1|482524|49|NC_020163|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.796

ttgccagatgcgacgctgtcgcgtcttatcaggcctacgggtccggtgc----	CRISPR spacer
atgcctgatgcgacgctgacgcgtcttatcaggcctac----ccactgttttt	Protospacer
 **** ************ *******************    **. **.    

82. spacer 1.1|482524|49|NC_020163|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.796

ttgccagatgcgacgctgtcgcgtcttatcaggcctacgggtccggtgc----	CRISPR spacer
atgcctgatgcgacgctgacgcgtcttatcaggcctac----ccactgttttt	Protospacer
 **** ************ *******************    **. **.    

83. spacer 1.1|482524|49|NC_020163|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 10, identity: 0.796

ttgccagatgcgacgctgtcgcgtcttatcaggcctacg--ggtccggtgc	CRISPR spacer
atgccagatgcgacgctggcgcgtcttatctggcctacgaagggctaac--	Protospacer
 ***************** *********** ********  ** *....  

84. spacer 1.1|482524|49|NC_020163|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.796

ttgccagatgcgacgctgtcgcgtcttatcaggcctacgggtccggtgc----	CRISPR spacer
atgcctgatgcgacgctgacgcgtcttatcaggcctac----ccactgttttt	Protospacer
 **** ************ *******************    **. **.    

85. spacer 1.1|482524|49|NC_020163|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.796

ttgccagatgcgacgctgtcgcgtcttatcaggcctacgggtccggtgc----	CRISPR spacer
atgcctgatgcgacgctgacgcgtcttatcaggcctac----ccactgttttt	Protospacer
 **** ************ *******************    **. **.    

86. spacer 4.7|3610143|32|NC_020163|CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688

tcacggtagcgccactgcgcgtcggtgacggg	CRISPR spacer
gggacgtcgcgccactgggcgtcggtgatgtc	Protospacer
  .  ** ********* **********.*  

87. spacer 4.9|3610265|32|NC_020163|CRT,PILER-CR matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ataattcgcaaatcaatatatattttgtccgt	CRISPR spacer
tattttcggaaatcaatctatattttgcctca	Protospacer
    **** ******** *********.*.  

88. spacer 4.9|3610265|32|NC_020163|CRT,PILER-CR matches to GU075905 (Prochlorococcus phage P-HM2, complete genome) position: , mismatch: 10, identity: 0.688

ataattcgcaaatcaatatatattttgtccgt	CRISPR spacer
ccagaagtaaaatcaatatataatttttccgt	Protospacer
 .*.     ************* *** *****

89. spacer 4.10|3610326|32|NC_020163|CRT,PILER-CR matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 10, identity: 0.688

aattgcggatgctcccggaattgcgcgggcaa	CRISPR spacer
cccagcggatgctcctcgaattgcgcggtagc	Protospacer
  . ***********. ***********  . 

90. spacer 5.8|3636541|32|NC_020163|CRISPRCasFinder,CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 10, identity: 0.688

actaaacttaatgatggccgttacagcgtgga	CRISPR spacer
gagtaacttaatgatgggcgtcacagcagcgg	Protospacer
.   ************* ***.*****.  *.

91. spacer 5.16|3636542|32|NC_020163|PILER-CR matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 10, identity: 0.688

actaaacttaatgatggccgttacagcgtgga	CRISPR spacer
gagtaacttaatgatgggcgtcacagcagcgg	Protospacer
.   ************* ***.*****.  *.

92. spacer 1.1|482524|49|NC_020163|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.776

ttgccagatgcgacgctgtcgcgtcttatcaggcctac--gggtccggtgc	CRISPR spacer
atgccagatgcgacgctgacgcgtcttatctggcctacaaagggctaac--	Protospacer
 ***************** *********** *******  .** *....  

93. spacer 1.1|482524|49|NC_020163|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 11, identity: 0.776

ttgccagatgcgacgctgtcgcgtcttatcaggcctacgggtccggtgc	CRISPR spacer
gcgcctgatgcgccgctgtcgcgtcttatcaggcctacaaatcgtttcc	Protospacer
 .*** ****** *************************...**   * *

94. spacer 1.1|482524|49|NC_020163|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

ttgccagatgcgacgctgtcgcgtcttatcaggcctacgggtccggtgc	CRISPR spacer
atgcctgatgcgacgctgccgcgtcttatcaggcctacaaaatcaatcg	Protospacer
 **** ************.*******************... .*..*  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 237703 : 250946 12 Shigella_phage(50.0%) tail,transposase NA
DBSCAN-SWA_2 629173 : 701239 84 Shigella_phage(42.37%) holin,integrase,plate,lysis,protease,tail,terminase,tRNA,transposase,portal,head,capsid attL 628448:628463|attR 658393:658408
DBSCAN-SWA_3 953490 : 1046092 101 Shigella_phage(51.67%) holin,integrase,plate,protease,tail,terminase,transposase,portal,head,capsid attL 967145:967203|attR 1009356:1009414
DBSCAN-SWA_4 1259510 : 1305817 45 Enterobacteria_phage(41.38%) holin,integrase,lysis,protease,tail,tRNA,transposase attL 1269661:1269707|attR 1297291:1297337
DBSCAN-SWA_5 1525399 : 1542390 27 Enterobacteria_phage(59.26%) integrase,lysis,protease,terminase,transposase attL 1516900:1516914|attR 1555466:1555480
DBSCAN-SWA_6 1629922 : 1638504 14 Salmonella_phage(84.62%) integrase attL 1624942:1624954|attR 1631798:1631810
DBSCAN-SWA_7 1678079 : 1776050 90 Escherichia_phage(29.63%) integrase,plate,lysis,protease,tail,tRNA,terminase,portal,capsid attL 1697950:1697967|attR 1723235:1723252
DBSCAN-SWA_8 2378318 : 2418740 52 Enterobacteria_phage(42.86%) lysis,tail,terminase,transposase,portal NA
DBSCAN-SWA_9 2959679 : 2969121 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_10 2981150 : 3053604 70 Shigella_phage(29.63%) holin,lysis,tail,tRNA,transposase NA
DBSCAN-SWA_11 3589200 : 3602383 12 Escherichia_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage