Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP019035 Salmonella enterica subsp. enterica serovar Gallinarum str. 9184 isolate ATCC 9184 chromosome, complete genome 2 crisprs PD-DExK,WYL,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,cas3,DEDDh,DinG 0 10 3 0

Results visualization

1. NZ_CP019035
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019035_1 1224776-1225415 TypeI-E I-E
10 spacers
cas8e,cse2gr11,cas7,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019035_2 1241565-1241718 TypeI-E I-E
2 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP019035_2 2.1|1241603|23|NZ_CP019035|PILER-CR 1241603-1241625 23 MN693671 Marine virus AFVG_250M196, complete genome 29249-29271 3 0.87
NZ_CP019035_1 1.14|1225049|33|NZ_CP019035|CRISPRCasFinder 1225049-1225081 33 NZ_CP032236 Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence 63403-63435 4 0.879
NZ_CP019035_1 1.14|1225049|33|NZ_CP019035|CRISPRCasFinder 1225049-1225081 33 NZ_LN681230 Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence 91355-91387 4 0.879
NZ_CP019035_2 2.1|1241603|23|NZ_CP019035|PILER-CR 1241603-1241625 23 MN693776 Marine virus AFVG_250M197, complete genome 4155-4177 4 0.826
NZ_CP019035_1 1.4|1224986|34|NZ_CP019035|PILER-CR,CRT 1224986-1225019 34 NZ_CP044178 Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1 18967-19000 5 0.853
NZ_CP019035_1 1.4|1224986|34|NZ_CP019035|PILER-CR,CRT 1224986-1225019 34 CP053324 Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence 25136-25169 5 0.853
NZ_CP019035_1 1.5|1225047|35|NZ_CP019035|PILER-CR,CRT 1225047-1225081 35 NZ_CP032236 Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence 63403-63437 5 0.857
NZ_CP019035_1 1.5|1225047|35|NZ_CP019035|PILER-CR,CRT 1225047-1225081 35 NZ_LN681230 Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence 91353-91387 5 0.857
NZ_CP019035_1 1.4|1224986|34|NZ_CP019035|PILER-CR,CRT 1224986-1225019 34 NZ_LN890526 Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence 31716-31749 6 0.824
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 NZ_CP044178 Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1 18969-19000 6 0.812
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 CP053324 Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence 25138-25169 6 0.812
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 NZ_LN890526 Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence 31718-31749 7 0.781
NZ_CP019035_1 1.9|1225292|34|NZ_CP019035|PILER-CR,CRT 1225292-1225325 34 MN694003 Marine virus AFVG_250M677, complete genome 17627-17660 8 0.765
NZ_CP019035_1 1.12|1224927|32|NZ_CP019035|CRISPRCasFinder 1224927-1224958 32 MG592432 Vibrio phage 1.050.O._10N.286.48.A6, partial genome 21687-21718 8 0.75
NZ_CP019035_1 1.12|1224927|32|NZ_CP019035|CRISPRCasFinder 1224927-1224958 32 MG592431 Vibrio phage 1.049.O._10N.286.54.B5, partial genome 21426-21457 8 0.75
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 NZ_CP053022 Sphingobium yanoikuyae strain YC-XJ2 plasmid p-A-Sy, complete sequence 329022-329053 8 0.75
NZ_CP019035_1 1.18|1225294|32|NZ_CP019035|CRISPRCasFinder 1225294-1225325 32 MN694003 Marine virus AFVG_250M677, complete genome 17629-17660 8 0.75
NZ_CP019035_1 1.10|1224805|32|NZ_CP019035|CRISPRCasFinder 1224805-1224836 32 CP006879 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence 405613-405644 9 0.719
NZ_CP019035_1 1.12|1224927|32|NZ_CP019035|CRISPRCasFinder 1224927-1224958 32 NC_047790 Pseudoalteromonas phage C5a, complete genome 34441-34472 9 0.719
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 NZ_CP048340 Escherichia coli strain 142 plasmid p142_C, complete sequence 2410-2441 9 0.719
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 NZ_LR130559 Escherichia coli strain MS14385 isolate MS14385 plasmid 5 41882-41913 9 0.719
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 NZ_CP020518 Escherichia coli strain 222 plasmid unnamed2, complete sequence 13450-13481 9 0.719
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 NZ_CP020497 Escherichia coli strain 103 plasmid unnamed2, complete sequence 37140-37171 9 0.719
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 NZ_CP040921 Escherichia coli strain FC853_EC plasmid p853EC2, complete sequence 32060-32091 9 0.719
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 CP053252 Escherichia coli strain SCU-204 plasmid pSCU-204-5, complete sequence 19381-19412 9 0.719
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 NZ_CP042622 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-7, complete sequence 2614-2645 9 0.719
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 NZ_LT985302 Escherichia coli strain ECOR 39 genome assembly, plasmid: RCS82_pI 11943-11974 9 0.719
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 NZ_CP028194 Escherichia coli strain CFSAN018748 plasmid pGMI14-004_3, complete sequence 15383-15414 9 0.719
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 NZ_CP024865 Escherichia coli strain AR_0015 plasmid unitig_3_pilon, complete sequence 22646-22677 9 0.719
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 AP019710 Escherichia coli O145:H28 122715 plasmid pO145_122715_2 DNA, complete genome 4361-4392 9 0.719
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 NZ_CP024829 Escherichia coli strain CREC-544 plasmid pCREC-544_3, complete sequence 2221-2252 9 0.719
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 NZ_CP009861 Escherichia coli strain ECONIH1 plasmid pECO-b75, complete sequence 2868-2899 9 0.719
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 CP025877 Escherichia coli strain 503458 plasmid p503458_49, complete sequence 18343-18374 9 0.719
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 NZ_CP023368 Escherichia coli strain 1428 plasmid p48, complete sequence 4914-4945 9 0.719
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 NZ_CP032259 Escherichia coli strain AR_0067 plasmid unnamed2, complete sequence 23402-23433 9 0.719
NZ_CP019035_1 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder 1224988-1225019 32 NZ_CP037450 Escherichia coli strain ATCC 25922 plasmid unnamed, complete sequence 15851-15882 9 0.719
NZ_CP019035_1 1.14|1225049|33|NZ_CP019035|CRISPRCasFinder 1225049-1225081 33 NZ_CP031947 Ruegeria sp. AD91A plasmid unnamed1, complete sequence 143751-143783 9 0.727
NZ_CP019035_1 1.10|1224805|32|NZ_CP019035|CRISPRCasFinder 1224805-1224836 32 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 699963-699994 10 0.688
NZ_CP019035_1 1.15|1225111|32|NZ_CP019035|CRISPRCasFinder 1225111-1225142 32 NZ_LR134399 Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence 103231-103262 10 0.688
NZ_CP019035_1 1.5|1225047|35|NZ_CP019035|PILER-CR,CRT 1225047-1225081 35 NZ_CP031947 Ruegeria sp. AD91A plasmid unnamed1, complete sequence 143751-143785 11 0.686

1. spacer 2.1|1241603|23|NZ_CP019035|PILER-CR matches to MN693671 (Marine virus AFVG_250M196, complete genome) position: , mismatch: 3, identity: 0.87

cagggcaaattcatccgccgctg	CRISPR spacer
aactgcaaattcatccgccgctg	Protospacer
 *  *******************

2. spacer 1.14|1225049|33|NZ_CP019035|CRISPRCasFinder matches to NZ_CP032236 (Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence) position: , mismatch: 4, identity: 0.879

caaacaccaagctcttccgccgcgcgttcctga	CRISPR spacer
catttaccaagctcttccgctgcgcgttcctga	Protospacer
**  .***************.************

3. spacer 1.14|1225049|33|NZ_CP019035|CRISPRCasFinder matches to NZ_LN681230 (Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence) position: , mismatch: 4, identity: 0.879

caaacaccaagctcttccgccgcgcgttcctga	CRISPR spacer
catttaccaagctcttccgctgcgcgttcctga	Protospacer
**  .***************.************

4. spacer 2.1|1241603|23|NZ_CP019035|PILER-CR matches to MN693776 (Marine virus AFVG_250M197, complete genome) position: , mismatch: 4, identity: 0.826

cagggcaaattcatccgccgctg	CRISPR spacer
acctgcaaattcatccgccgctg	Protospacer
    *******************

5. spacer 1.4|1224986|34|NZ_CP019035|PILER-CR,CRT matches to NZ_CP044178 (Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1) position: , mismatch: 5, identity: 0.853

ccaattt----aggggccggaactccgggaaaggcagc	CRISPR spacer
----tttgagaaggggccggaactccgggaaaggcacc	Protospacer
    ***    ************************* *

6. spacer 1.4|1224986|34|NZ_CP019035|PILER-CR,CRT matches to CP053324 (Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.853

ccaattt----aggggccggaactccgggaaaggcagc	CRISPR spacer
----tttgagaaggggccggaactccgggaaaggcacc	Protospacer
    ***    ************************* *

7. spacer 1.5|1225047|35|NZ_CP019035|PILER-CR,CRT matches to NZ_CP032236 (Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence) position: , mismatch: 5, identity: 0.857

cgcaaacaccaagctcttccgccgcgcgttcctga	CRISPR spacer
ggcatttaccaagctcttccgctgcgcgttcctga	Protospacer
 ***  .***************.************

8. spacer 1.5|1225047|35|NZ_CP019035|PILER-CR,CRT matches to NZ_LN681230 (Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence) position: , mismatch: 5, identity: 0.857

cgcaaacaccaagctcttccgccgcgcgttcctga	CRISPR spacer
ggcatttaccaagctcttccgctgcgcgttcctga	Protospacer
 ***  .***************.************

9. spacer 1.4|1224986|34|NZ_CP019035|PILER-CR,CRT matches to NZ_LN890526 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.824

ccaattt----aggggccggaactccgggaaaggcagc	CRISPR spacer
----tttgagaaggggccggaactccggaaaaggcacc	Protospacer
    ***    *****************.******* *

10. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to NZ_CP044178 (Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1) position: , mismatch: 6, identity: 0.812

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccgggaaaggcacc	Protospacer
 .   ************************* *

11. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to CP053324 (Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccgggaaaggcacc	Protospacer
 .   ************************* *

12. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to NZ_LN890526 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.781

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggaaaaggcacc	Protospacer
 .   *****************.******* *

13. spacer 1.9|1225292|34|NZ_CP019035|PILER-CR,CRT matches to MN694003 (Marine virus AFVG_250M677, complete genome) position: , mismatch: 8, identity: 0.765

cgcggtcgcagcctggcctgttgccgtagaatcg	CRISPR spacer
cgcgatcgcagcctgggctgttgccgtgctcgcc	Protospacer
****.*********** **********.    * 

14. spacer 1.12|1224927|32|NZ_CP019035|CRISPRCasFinder matches to MG592432 (Vibrio phage 1.050.O._10N.286.48.A6, partial genome) position: , mismatch: 8, identity: 0.75

ctgccggtctgtgctgttgtcgtcaataatca	CRISPR spacer
aatctgctctgtgctgttgtagtcaattataa	Protospacer
   *.* ************* ****** ** *

15. spacer 1.12|1224927|32|NZ_CP019035|CRISPRCasFinder matches to MG592431 (Vibrio phage 1.049.O._10N.286.54.B5, partial genome) position: , mismatch: 8, identity: 0.75

ctgccggtctgtgctgttgtcgtcaataatca	CRISPR spacer
aatctgctctgtgctgttgtagtcaattataa	Protospacer
   *.* ************* ****** ** *

16. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to NZ_CP053022 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-A-Sy, complete sequence) position: , mismatch: 8, identity: 0.75

---aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
gtcagtt---gggccggaaagccgggaaaggcata	Protospacer
   *.**   *********  ************  

17. spacer 1.18|1225294|32|NZ_CP019035|CRISPRCasFinder matches to MN694003 (Marine virus AFVG_250M677, complete genome) position: , mismatch: 8, identity: 0.75

cggtcgcagcctggcctgttgccgtagaatcg	CRISPR spacer
cgatcgcagcctgggctgttgccgtgctcgcc	Protospacer
**.*********** **********.    * 

18. spacer 1.10|1224805|32|NZ_CP019035|CRISPRCasFinder matches to CP006879 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence) position: , mismatch: 9, identity: 0.719

aggatttcgccgcgctgttggcctccagattc	CRISPR spacer
cagggtcgaccgcgctgtcgccctccagattc	Protospacer
 .*. *. .*********.* ***********

19. spacer 1.12|1224927|32|NZ_CP019035|CRISPRCasFinder matches to NC_047790 (Pseudoalteromonas phage C5a, complete genome) position: , mismatch: 9, identity: 0.719

ctgccggtctgtgctgttgtcgtcaataatca	CRISPR spacer
tttggtgtctgtgccgttttcgtcaataagct	Protospacer
.*    ********.*** ********** * 

20. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to NZ_CP048340 (Escherichia coli strain 142 plasmid p142_C, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

21. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to NZ_LR130559 (Escherichia coli strain MS14385 isolate MS14385 plasmid 5) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

22. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to NZ_CP020518 (Escherichia coli strain 222 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

23. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to NZ_CP020497 (Escherichia coli strain 103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

24. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to NZ_CP040921 (Escherichia coli strain FC853_EC plasmid p853EC2, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

25. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to CP053252 (Escherichia coli strain SCU-204 plasmid pSCU-204-5, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

26. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to NZ_CP042622 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-7, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

27. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to NZ_LT985302 (Escherichia coli strain ECOR 39 genome assembly, plasmid: RCS82_pI) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

28. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to NZ_CP028194 (Escherichia coli strain CFSAN018748 plasmid pGMI14-004_3, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

29. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to NZ_CP024865 (Escherichia coli strain AR_0015 plasmid unitig_3_pilon, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

30. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to AP019710 (Escherichia coli O145:H28 122715 plasmid pO145_122715_2 DNA, complete genome) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

31. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to NZ_CP024829 (Escherichia coli strain CREC-544 plasmid pCREC-544_3, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

32. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to NZ_CP009861 (Escherichia coli strain ECONIH1 plasmid pECO-b75, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

33. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to CP025877 (Escherichia coli strain 503458 plasmid p503458_49, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

34. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to NZ_CP023368 (Escherichia coli strain 1428 plasmid p48, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

35. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to NZ_CP032259 (Escherichia coli strain AR_0067 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

36. spacer 1.13|1224988|32|NZ_CP019035|CRISPRCasFinder matches to NZ_CP037450 (Escherichia coli strain ATCC 25922 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

37. spacer 1.14|1225049|33|NZ_CP019035|CRISPRCasFinder matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

caaacaccaagctcttccgccgcgcgttcctga	CRISPR spacer
gaaacaccaaggtcttccgccgcacgggcaaag	Protospacer
 ********** ***********.**  *  ..

38. spacer 1.10|1224805|32|NZ_CP019035|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

aggatttcgccgcgctgttggcctccagattc	CRISPR spacer
gggatatcgccgcgctgatggcctatgaccac	Protospacer
.**** *********** ****** ... . *

39. spacer 1.15|1225111|32|NZ_CP019035|CRISPRCasFinder matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.688

ttgctctcattaaaggggtttccatgtttgat	CRISPR spacer
gattcgtcattacagtggtttccatgttttag	Protospacer
   .. ****** ** ************* * 

40. spacer 1.5|1225047|35|NZ_CP019035|PILER-CR,CRT matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.686

cgcaaacaccaagctcttccgccgcgcgttcctga	CRISPR spacer
gagaaacaccaaggtcttccgccgcacgggcaaag	Protospacer
 . ********** ***********.**  *  ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1940432 : 1949601 9 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_2 2016793 : 2027300 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_3 2808652 : 2907780 98 Enterobacteria_phage(27.66%) tRNA,protease,holin,lysis,integrase,portal,tail,terminase attL 2860603:2860632|attR 2907916:2907945
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage