1. spacer 1.1|6855|25|NC_020208|CRISPRCasFinder matches to NC_022603 (Carnobacterium inhibens subsp. gilichinskyi plasmid pWNCR64, complete sequence) position: , mismatch: 0, identity: 1.0
ctgtcccatctccatactttcattg CRISPR spacer
ctgtcccatctccatactttcattg Protospacer
*************************
2. spacer 1.1|6855|25|NC_020208|CRISPRCasFinder matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 0, identity: 1.0
ctgtcccatctccatactttcattg CRISPR spacer
ctgtcccatctccatactttcattg Protospacer
*************************
3. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP011282 (Enterococcus faecium strain E39 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
4. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP025426 (Enterococcus faecium strain SC4 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
5. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to LT603679 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
6. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
7. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP040369 (Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
8. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP043485 (Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
9. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP020485 (Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
10. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
11. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP012385 (Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
12. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
13. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
14. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP018073 (Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
15. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP027518 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
16. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP027498 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
17. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP027507 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
18. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
19. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
20. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135288 (Enterococcus faecium isolate E7199 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
21. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135333 (Enterococcus faecium isolate E7471 plasmid 3) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
22. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
23. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP046076 (Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
24. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to MT074686 (Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
25. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
26. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
27. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135244 (Enterococcus faecium isolate E6988 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
28. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135279 (Enterococcus faecium isolate E6975 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
29. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135783 (Enterococcus faecium isolate E4239 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
30. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
31. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135255 (Enterococcus faecium isolate E7098 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
32. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135236 (Enterococcus faecium isolate E7067 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
33. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
34. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135259 (Enterococcus faecium isolate E4457 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
35. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135182 (Enterococcus faecium isolate E1774 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
36. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP040905 (Enterococcus faecium strain N56454 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
37. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP041256 (Enterococcus faecium strain 515 plasmid p26, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
38. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP019209 (Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
39. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
40. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP017798 (Enterococcus faecium strain E243 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
41. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135429 (Enterococcus faecium isolate E8927 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
42. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135436 (Enterococcus faecium isolate E8691 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
43. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
44. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135476 (Enterococcus faecium isolate E8423 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
45. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
46. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135180 (Enterococcus faecium isolate E0595 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
47. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135227 (Enterococcus faecium isolate E7025 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
48. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
49. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
50. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135220 (Enterococcus faecium isolate E7040 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
51. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
52. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
53. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NC_021987 (Enterococcus faecium Aus0085 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
54. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
55. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135325 (Enterococcus faecium isolate E7654 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
56. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135358 (Enterococcus faecium isolate E7948 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
57. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
58. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135352 (Enterococcus faecium isolate E8014 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
59. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
60. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
61. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
62. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
63. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135318 (Enterococcus faecium isolate E7663 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
64. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR134106 (Enterococcus faecium isolate E6043 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
65. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135373 (Enterococcus faecium isolate E8172 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
66. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP006031 (Enterococcus faecium T110 plasmid pEFT110, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
67. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP011829 (Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
68. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR132068 (Enterococcus faecium isolate E0139 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
69. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_AP019395 (Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
70. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
71. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP033042 (Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
72. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP025687 (Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
73. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP040741 (Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
74. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
75. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
76. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
77. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
78. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
79. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
80. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
81. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP017793 (Enterococcus faecium strain E240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
82. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP019993 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
83. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP035655 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
84. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
85. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
86. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
87. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
88. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
89. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
90. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP035649 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
91. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP040850 (Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
92. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP042840 (Enterococcus sp. DA9 plasmid unnamed4) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
93. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135171 (Enterococcus faecium isolate E4227 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
94. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135192 (Enterococcus faecium isolate E4438 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
95. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
96. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP037956 (Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
97. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135308 (Enterococcus faecium isolate E7240 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
98. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
99. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
100. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
101. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP033207 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
102. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
103. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
104. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
105. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_AP019409 (Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
106. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
107. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP034948 (Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
108. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
109. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
110. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to LR135186 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
111. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP012461 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
112. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
113. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_MG674581 (Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
114. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
115. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 0, identity: 1.0
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
****************************************
116. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP025426 (Enterococcus faecium strain SC4 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
117. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP040906 (Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
118. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP027401 (Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
119. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
120. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
121. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP040905 (Enterococcus faecium strain N56454 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
122. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP041256 (Enterococcus faecium strain 515 plasmid p26, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
123. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
124. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
125. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
126. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP011829 (Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
127. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
128. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP033042 (Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
129. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP025687 (Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
130. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
131. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
132. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP019993 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
133. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
134. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP042840 (Enterococcus sp. DA9 plasmid unnamed4) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
135. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP033207 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
136. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
137. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
138. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP012461 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
139. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
140. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP011282 (Enterococcus faecium strain E39 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
141. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to LT603679 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
142. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
143. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP040369 (Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
144. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP043485 (Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
145. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP020485 (Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
146. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
147. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP018073 (Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
148. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP027518 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
149. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP027498 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
150. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP027507 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
151. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
152. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
153. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135288 (Enterococcus faecium isolate E7199 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
154. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135333 (Enterococcus faecium isolate E7471 plasmid 3) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
155. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
156. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP046076 (Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
157. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to MT074686 (Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
158. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
159. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
160. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135244 (Enterococcus faecium isolate E6988 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
161. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135279 (Enterococcus faecium isolate E6975 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
162. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135783 (Enterococcus faecium isolate E4239 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
163. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
164. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135255 (Enterococcus faecium isolate E7098 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
165. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135236 (Enterococcus faecium isolate E7067 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
166. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
167. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135259 (Enterococcus faecium isolate E4457 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
168. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135182 (Enterococcus faecium isolate E1774 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
169. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP019209 (Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
170. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP017798 (Enterococcus faecium strain E243 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
171. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135429 (Enterococcus faecium isolate E8927 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
172. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135436 (Enterococcus faecium isolate E8691 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
173. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
174. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135476 (Enterococcus faecium isolate E8423 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
175. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
176. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135175 (Enterococcus faecium isolate E4402 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
177. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135227 (Enterococcus faecium isolate E7025 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
178. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
179. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
180. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135220 (Enterococcus faecium isolate E7040 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
181. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
182. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
183. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NC_021987 (Enterococcus faecium Aus0085 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
184. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
185. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135325 (Enterococcus faecium isolate E7654 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
186. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135358 (Enterococcus faecium isolate E7948 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
187. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
188. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135352 (Enterococcus faecium isolate E8014 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
189. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
190. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
191. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135318 (Enterococcus faecium isolate E7663 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
192. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR134106 (Enterococcus faecium isolate E6043 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
193. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135373 (Enterococcus faecium isolate E8172 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
194. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP006031 (Enterococcus faecium T110 plasmid pEFT110, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
195. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_AP019395 (Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
196. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP045013 (Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
197. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP040741 (Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
198. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
199. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
200. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
201. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
202. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP040873 (Enterococcus faecium strain DB-1 plasmid punnamed1) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
203. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP040876 (Enterococcus faecium strain DB-1 plasmid punnamed2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
204. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
205. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP017793 (Enterococcus faecium strain E240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
206. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP035655 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
207. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
208. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
209. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
210. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
211. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
212. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR134096 (Enterococcus faecium isolate E1334 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
213. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP035649 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
214. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP040850 (Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
215. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135171 (Enterococcus faecium isolate E4227 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
216. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135192 (Enterococcus faecium isolate E4438 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
217. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
218. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_LR135308 (Enterococcus faecium isolate E7240 plasmid 2) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
219. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
220. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
221. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
222. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
223. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
224. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_AP019409 (Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
225. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
226. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP034948 (Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
227. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
228. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
229. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
230. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_MG674581 (Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
231. spacer 2.2|61716|19|NC_020208|CRISPRCasFinder matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0
gtgccaaaacgttgataaa CRISPR spacer
gtgccaaaacgttgataaa Protospacer
*******************
232. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP027401 (Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.975
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcaggcgctgaatcccttggggct Protospacer
********************.*******************
233. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR135175 (Enterococcus faecium isolate E4402 plasmid 2) position: , mismatch: 1, identity: 0.975
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcaggcgctgaatcccttggggct Protospacer
********************.*******************
234. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_LR134096 (Enterococcus faecium isolate E1334 plasmid 2) position: , mismatch: 1, identity: 0.975
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcaggcgctgaatcccttggggct Protospacer
********************.*******************
235. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 1, identity: 0.975
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
catcctcgacgaaaaatcagacgctgaatcccttggggct Protospacer
**.*************************************
236. spacer 1.1|6855|25|NC_020208|CRISPRCasFinder matches to NC_022603 (Carnobacterium inhibens subsp. gilichinskyi plasmid pWNCR64, complete sequence) position: , mismatch: 3, identity: 0.88
ctgtcccatctccatactttcattg CRISPR spacer
gtgttccatctccatactttcatta Protospacer
***.*******************.
237. spacer 1.1|6855|25|NC_020208|CRISPRCasFinder matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 3, identity: 0.88
ctgtcccatctccatactttcattg CRISPR spacer
gtgttccatctccatactttcatta Protospacer
***.*******************.
238. spacer 2.1|61653|40|NC_020208|CRISPRCasFinder matches to NZ_CP012367 (Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence) position: , mismatch: 5, identity: 0.875
caccctcgacgaaaaatcagacgctgaatcccttggggct CRISPR spacer
caccctcgacgaaaaatcagacgctgaatccttggggctc Protospacer
*******************************.* *** ..