Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_020895 Streptomyces hygroscopicus subsp. jinggangensis TL01, complete sequence 13 crisprs csa3,casR,DEDDh,WYL,cas4,Cas9_archaeal,cas3,DinG 3 5 5 0
NC_020293 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH2, complete sequence 0 crisprs NA 0 0 0 0
NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 10 crisprs cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3 2 108 0 0

Results visualization

1. NC_020895
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020895_1 394309-394404 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020895_2 1984718-1984801 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020895_3 2839302-2839432 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020895_4 3775861-3775940 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020895_5 4087987-4088108 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020895_6 4568765-4568874 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020895_7 5802897-5803002 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020895_8 6261079-6261503 Orphan NA
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020895_9 6583760-6584059 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020895_10 6645025-6645110 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020895_11 7421707-7421801 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020895_12 7702873-7702997 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020895_13 8118524-8118631 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_020895_8 8.6|6261309|16|NC_020895|CRISPRCasFinder 6261309-6261324 16 NC_020894.1 32718-32733 2 0.875
NC_020895_8 8.7|6261348|16|NC_020895|CRISPRCasFinder 6261348-6261363 16 NC_020293.1 65144-65159 2 0.875
NC_020895_8 8.2|6261147|16|NC_020895|CRISPRCasFinder 6261147-6261162 16 NC_020894.1 134187-134202 9 0.438

1. spacer 8.6|6261309|16|NC_020895|CRISPRCasFinder matches to position: 32718-32733, mismatch: 2, identity: 0.875

cggcggaggcgcgaac	CRISPR spacer
cggcggaagcgcggac	Protospacer
*******.*****.**

2. spacer 8.7|6261348|16|NC_020895|CRISPRCasFinder matches to position: 65144-65159, mismatch: 2, identity: 0.875

cggcgggggcggaaac	CRISPR spacer
cggcgagggcggagac	Protospacer
*****.*******.**

3. spacer 8.2|6261147|16|NC_020895|CRISPRCasFinder matches to position: 134187-134202, mismatch: 9, identity: 0.438

caacaacaacggccga--------	CRISPR spacer
--------tcggccgatgttgatg	Protospacer
         *******        

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_020895_8 8.1|6261102|22|NC_020895|CRISPRCasFinder 6261102-6261123 22 MG592483 Vibrio phage 1.110.O._10N.261.52.C1, partial genome 17500-17521 2 0.909
NC_020895_8 8.4|6261225|22|NC_020895|CRISPRCasFinder 6261225-6261246 22 NZ_AP017970 Fusobacterium varium strain Fv113-g1 plasmid pFV113-g1-2, complete sequence 57593-57614 2 0.909
NC_020895_5 5.1|4088010|25|NC_020895|CRISPRCasFinder 4088010-4088034 25 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 880222-880246 3 0.88
NC_020895_8 8.4|6261225|22|NC_020895|CRISPRCasFinder 6261225-6261246 22 AP014301 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S28-C84, *** SEQUENCING IN PROGRESS *** 6900-6921 3 0.864
NC_020895_4 4.1|3775884|34|NC_020895|CRISPRCasFinder 3775884-3775917 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 614600-614633 7 0.794
NC_020895_9 9.1|6583793|32|NC_020895|CRISPRCasFinder 6583793-6583824 32 NZ_CP032696 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525b, complete sequence 278569-278600 8 0.75
NC_020895_4 4.1|3775884|34|NC_020895|CRISPRCasFinder 3775884-3775917 34 MN908687 Gordonia phage Skog, complete genome 100355-100388 9 0.735

1. spacer 8.1|6261102|22|NC_020895|CRISPRCasFinder matches to MG592483 (Vibrio phage 1.110.O._10N.261.52.C1, partial genome) position: , mismatch: 2, identity: 0.909

caataacaacaacaacggtagg	CRISPR spacer
gcataacaacaacaacggtagg	Protospacer
  ********************

2. spacer 8.4|6261225|22|NC_020895|CRISPRCasFinder matches to NZ_AP017970 (Fusobacterium varium strain Fv113-g1 plasmid pFV113-g1-2, complete sequence) position: , mismatch: 2, identity: 0.909

taacaacaacaacggcaggggt	CRISPR spacer
caacaacaacaacagcaggggt	Protospacer
.************.********

3. spacer 5.1|4088010|25|NC_020895|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

tctccggtgccgaccgccgtaccag	CRISPR spacer
tctccgctgccgcccgccgtacccg	Protospacer
****** ***** ********** *

4. spacer 8.4|6261225|22|NC_020895|CRISPRCasFinder matches to AP014301 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S28-C84, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.864

taacaacaacaacggcaggggt	CRISPR spacer
gaacaacaacaacggcagggaa	Protospacer
 *******************. 

5. spacer 4.1|3775884|34|NC_020895|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccgacccccaccacccagccgaccgacctgct--	CRISPR spacer
ggccgacccccagcgcccagccgac--accggtgga	Protospacer
************ *.**********  *** *.   

6. spacer 9.1|6583793|32|NC_020895|CRISPRCasFinder matches to NZ_CP032696 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525b, complete sequence) position: , mismatch: 8, identity: 0.75

cgcacccggcaacggtccgggccccgaagggg	CRISPR spacer
cgcgcccggcaacggtccggaccgacgaggac	Protospacer
***.****************.**   .***. 

7. spacer 4.1|3775884|34|NC_020895|CRISPRCasFinder matches to MN908687 (Gordonia phage Skog, complete genome) position: , mismatch: 9, identity: 0.735

ggccgacccccaccacccagccgaccgacctgct	CRISPR spacer
gccacggcgtcaccaccaacccgaccgacctgct	Protospacer
* *  . * .******* * **************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10631 : 68094 51 Shigella_phage(16.67%) integrase,transposase attL 4355:4373|attR 22499:22517
DBSCAN-SWA_2 74862 : 134870 44 Streptococcus_phage(25.0%) integrase,transposase attL 85084:85143|attR 133839:134705
DBSCAN-SWA_3 1461425 : 1505873 42 Bacillus_phage(40.0%) integrase,transposase attL 1467146:1467161|attR 1501357:1501372
DBSCAN-SWA_4 2554009 : 2608730 39 Bacillus_phage(33.33%) tail,plate,protease NA
DBSCAN-SWA_5 9626369 : 9663979 35 Bacillus_phage(100.0%) integrase,transposase attL 9613485:9613503|attR 9639339:9639357
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_020293
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_020894
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020894_1 40505-40837 TypeI-E I-E
5 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020894_2 50724-51606 TypeI-E I-E:NA
14 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020894_3 51787-52547 TypeI-E I-E
12 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020894_4 52980-53191 TypeI-E I-E
3 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020894_5 54790-55002 TypeI-E I-E
3 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020894_6 55197-55775 TypeI-E NA:I-E
9 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020894_7 55970-56852 TypeI-E I-E
14 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020894_8 57047-57687 TypeI-E I-E
10 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020894_9 57882-58763 TypeI-E NA:I-E
14 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020894_10 86868-86975 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_020894_9 9.1|57911|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57911-57942 32 NC_020895.1 5667586-5667617 0 1.0
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 NC_020293.1 66208-66239 1 0.969

1. spacer 9.1|57911|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to position: 5667586-5667617, mismatch: 0, identity: 1.0

accgcgaccttccggtggagggcgtgcagttc	CRISPR spacer
accgcgaccttccggtggagggcgtgcagttc	Protospacer
********************************

2. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to position: 66208-66239, mismatch: 1, identity: 0.969

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
catctcgatccagagcacgccggccgccgcca	Protospacer
***.****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_020894_1 1.1|40535|31|NC_020894|CRISPRCasFinder 40535-40565 31 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 40535-40565 0 1.0
NC_020894_1 1.1|40535|31|NC_020894|CRISPRCasFinder 40535-40565 31 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 40536-40566 0 1.0
NC_020894_1 1.2|40596|29|NC_020894|CRISPRCasFinder 40596-40624 29 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 40596-40624 0 1.0
NC_020894_1 1.2|40596|29|NC_020894|CRISPRCasFinder 40596-40624 29 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 40597-40625 0 1.0
NC_020894_1 1.3|40655|31|NC_020894|CRISPRCasFinder 40655-40685 31 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 40655-40685 0 1.0
NC_020894_1 1.3|40655|31|NC_020894|CRISPRCasFinder 40655-40685 31 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 40656-40686 0 1.0
NC_020894_1 1.4|40716|31|NC_020894|CRISPRCasFinder 40716-40746 31 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 40716-40746 0 1.0
NC_020894_1 1.4|40716|31|NC_020894|CRISPRCasFinder 40716-40746 31 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 40717-40747 0 1.0
NC_020894_1 1.5|40777|31|NC_020894|CRISPRCasFinder 40777-40807 31 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 40777-40807 0 1.0
NC_020894_1 1.5|40777|31|NC_020894|CRISPRCasFinder 40777-40807 31 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 40778-40808 0 1.0
NC_020894_1 1.6|40596|30|NC_020894|CRT 40596-40625 30 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 40596-40625 0 1.0
NC_020894_1 1.6|40596|30|NC_020894|CRT 40596-40625 30 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 40597-40626 0 1.0
NC_020894_1 1.7|40655|32|NC_020894|CRT,PILER-CR 40655-40686 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 40655-40686 0 1.0
NC_020894_1 1.7|40655|32|NC_020894|CRT,PILER-CR 40655-40686 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 40656-40687 0 1.0
NC_020894_1 1.8|40716|32|NC_020894|CRT,PILER-CR 40716-40747 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 40716-40747 0 1.0
NC_020894_1 1.8|40716|32|NC_020894|CRT,PILER-CR 40716-40747 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 40717-40748 0 1.0
NC_020894_1 1.9|40777|32|NC_020894|CRT,PILER-CR 40777-40808 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 40777-40808 0 1.0
NC_020894_1 1.9|40777|32|NC_020894|CRT,PILER-CR 40777-40808 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 40778-40809 0 1.0
NC_020894_2 2.1|50753|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50753-50784 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 50753-50784 0 1.0
NC_020894_2 2.1|50753|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50753-50784 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 50754-50785 0 1.0
NC_020894_2 2.2|50814|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50814-50845 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 50814-50845 0 1.0
NC_020894_2 2.2|50814|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50814-50845 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 50815-50846 0 1.0
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 50875-50906 0 1.0
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 50876-50907 0 1.0
NC_020894_2 2.4|50936|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50936-50967 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 50936-50967 0 1.0
NC_020894_2 2.4|50936|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50936-50967 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 50937-50968 0 1.0
NC_020894_2 2.5|50997|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50997-51028 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 50997-51028 0 1.0
NC_020894_2 2.5|50997|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50997-51028 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 50998-51029 0 1.0
NC_020894_2 2.6|51058|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 51058-51089 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 51058-51089 0 1.0
NC_020894_2 2.6|51058|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 51058-51089 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 57259-57290 0 1.0
NC_020894_2 2.6|51058|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 51058-51089 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 51059-51090 0 1.0
NC_020894_2 2.6|51058|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 51058-51089 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 57260-57291 0 1.0
NC_020894_2 2.7|51119|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 51119-51150 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 51119-51150 0 1.0
NC_020894_2 2.7|51119|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 51119-51150 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 51120-51151 0 1.0
NC_020894_2 2.8|51180|32|NC_020894|CRISPRCasFinder,CRT 51180-51211 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 51180-51211 0 1.0
NC_020894_2 2.8|51180|32|NC_020894|CRISPRCasFinder,CRT 51180-51211 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 51181-51212 0 1.0
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 51241-51272 0 1.0
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 51242-51273 0 1.0
NC_020894_2 2.10|51302|32|NC_020894|CRISPRCasFinder,CRT 51302-51333 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 51302-51333 0 1.0
NC_020894_2 2.10|51302|32|NC_020894|CRISPRCasFinder,CRT 51302-51333 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 51303-51334 0 1.0
NC_020894_2 2.11|51363|32|NC_020894|CRISPRCasFinder,CRT 51363-51394 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 51363-51394 0 1.0
NC_020894_2 2.11|51363|32|NC_020894|CRISPRCasFinder,CRT 51363-51394 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 51364-51395 0 1.0
NC_020894_2 2.12|51424|32|NC_020894|CRISPRCasFinder,CRT 51424-51455 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 51424-51455 0 1.0
NC_020894_2 2.12|51424|32|NC_020894|CRISPRCasFinder,CRT 51424-51455 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 51425-51456 0 1.0
NC_020894_2 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT 51485-51516 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 51485-51516 0 1.0
NC_020894_2 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT 51485-51516 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 51486-51517 0 1.0
NC_020894_2 2.14|51546|32|NC_020894|CRT 51546-51577 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 51546-51577 0 1.0
NC_020894_2 2.14|51546|32|NC_020894|CRT 51546-51577 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 51547-51578 0 1.0
NC_020894_3 3.1|51816|32|NC_020894|CRISPRCasFinder 51816-51847 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 51816-51847 0 1.0
NC_020894_3 3.1|51816|32|NC_020894|CRISPRCasFinder 51816-51847 32 NZ_CP009439 Streptomyces glaucescens strain GLA.O plasmid pSglau1, complete sequence 131283-131314 0 1.0
NC_020894_3 3.1|51816|32|NC_020894|CRISPRCasFinder 51816-51847 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 51817-51848 0 1.0
NC_020894_3 3.2|51877|32|NC_020894|CRISPRCasFinder 51877-51908 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 51877-51908 0 1.0
NC_020894_3 3.2|51877|32|NC_020894|CRISPRCasFinder 51877-51908 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 51878-51909 0 1.0
NC_020894_3 3.3|51938|32|NC_020894|CRISPRCasFinder 51938-51969 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 51938-51969 0 1.0
NC_020894_3 3.3|51938|32|NC_020894|CRISPRCasFinder 51938-51969 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 51939-51970 0 1.0
NC_020894_3 3.4|51999|32|NC_020894|CRISPRCasFinder 51999-52030 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 51999-52030 0 1.0
NC_020894_3 3.4|51999|32|NC_020894|CRISPRCasFinder 51999-52030 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 52000-52031 0 1.0
NC_020894_3 3.5|52060|32|NC_020894|CRISPRCasFinder 52060-52091 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 52060-52091 0 1.0
NC_020894_3 3.5|52060|32|NC_020894|CRISPRCasFinder 52060-52091 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 52061-52092 0 1.0
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 52121-52152 0 1.0
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 52122-52153 0 1.0
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 102623-102654 0 1.0
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 52182-52213 0 1.0
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 52183-52214 0 1.0
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NC_003903 Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence 93947-93978 0 1.0
NC_020894_3 3.8|52243|32|NC_020894|CRISPRCasFinder 52243-52274 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 52243-52274 0 1.0
NC_020894_3 3.8|52243|32|NC_020894|CRISPRCasFinder 52243-52274 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 52244-52275 0 1.0
NC_020894_3 3.9|52304|32|NC_020894|CRISPRCasFinder 52304-52335 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 52304-52335 0 1.0
NC_020894_3 3.9|52304|32|NC_020894|CRISPRCasFinder 52304-52335 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 52305-52336 0 1.0
NC_020894_3 3.10|52365|31|NC_020894|CRISPRCasFinder 52365-52395 31 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 52365-52395 0 1.0
NC_020894_3 3.10|52365|31|NC_020894|CRISPRCasFinder 52365-52395 31 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 52366-52396 0 1.0
NC_020894_3 3.11|52425|32|NC_020894|CRISPRCasFinder 52425-52456 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 52425-52456 0 1.0
NC_020894_3 3.11|52425|32|NC_020894|CRISPRCasFinder 52425-52456 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 52426-52457 0 1.0
NC_020894_3 3.12|52486|32|NC_020894|CRISPRCasFinder 52486-52517 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 52486-52517 0 1.0
NC_020894_3 3.12|52486|32|NC_020894|CRISPRCasFinder 52486-52517 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 52487-52518 0 1.0
NC_020894_3 3.13|51811|37|NC_020894|CRT 51811-51847 37 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 51811-51847 0 1.0
NC_020894_3 3.13|51811|37|NC_020894|CRT 51811-51847 37 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 51812-51848 0 1.0
NC_020894_3 3.14|51872|37|NC_020894|CRT 51872-51908 37 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 51872-51908 0 1.0
NC_020894_3 3.14|51872|37|NC_020894|CRT 51872-51908 37 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 51873-51909 0 1.0
NC_020894_3 3.15|51933|37|NC_020894|CRT 51933-51969 37 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 51933-51969 0 1.0
NC_020894_3 3.15|51933|37|NC_020894|CRT 51933-51969 37 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 51934-51970 0 1.0
NC_020894_3 3.16|51994|37|NC_020894|CRT 51994-52030 37 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 51994-52030 0 1.0
NC_020894_3 3.16|51994|37|NC_020894|CRT 51994-52030 37 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 51995-52031 0 1.0
NC_020894_3 3.17|52055|37|NC_020894|CRT 52055-52091 37 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 52055-52091 0 1.0
NC_020894_3 3.17|52055|37|NC_020894|CRT 52055-52091 37 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 52056-52092 0 1.0
NC_020894_3 3.18|52116|37|NC_020894|CRT 52116-52152 37 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 52116-52152 0 1.0
NC_020894_3 3.18|52116|37|NC_020894|CRT 52116-52152 37 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 52117-52153 0 1.0
NC_020894_3 3.19|52177|37|NC_020894|CRT 52177-52213 37 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 52177-52213 0 1.0
NC_020894_3 3.19|52177|37|NC_020894|CRT 52177-52213 37 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 52178-52214 0 1.0
NC_020894_3 3.20|52238|37|NC_020894|CRT 52238-52274 37 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 52238-52274 0 1.0
NC_020894_3 3.20|52238|37|NC_020894|CRT 52238-52274 37 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 52239-52275 0 1.0
NC_020894_3 3.21|52299|37|NC_020894|CRT 52299-52335 37 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 52299-52335 0 1.0
NC_020894_3 3.21|52299|37|NC_020894|CRT 52299-52335 37 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 52300-52336 0 1.0
NC_020894_3 3.22|52360|36|NC_020894|CRT 52360-52395 36 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 52360-52395 0 1.0
NC_020894_3 3.22|52360|36|NC_020894|CRT 52360-52395 36 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 52361-52396 0 1.0
NC_020894_3 3.23|52420|37|NC_020894|CRT 52420-52456 37 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 52420-52456 0 1.0
NC_020894_3 3.23|52420|37|NC_020894|CRT 52420-52456 37 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 52421-52457 0 1.0
NC_020894_3 3.24|52481|37|NC_020894|CRT 52481-52517 37 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 52481-52517 0 1.0
NC_020894_3 3.24|52481|37|NC_020894|CRT 52481-52517 37 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 52482-52518 0 1.0
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 53009-53040 0 1.0
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 53010-53041 0 1.0
NC_020894_4 4.2|53070|32|NC_020894|CRISPRCasFinder 53070-53101 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 53070-53101 0 1.0
NC_020894_4 4.2|53070|32|NC_020894|CRISPRCasFinder 53070-53101 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 53071-53102 0 1.0
NC_020894_4 4.3|53131|32|NC_020894|CRISPRCasFinder 53131-53162 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 53131-53162 0 1.0
NC_020894_4 4.3|53131|32|NC_020894|CRISPRCasFinder 53131-53162 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 53132-53163 0 1.0
NC_020894_5 5.1|54819|32|NC_020894|CRISPRCasFinder 54819-54850 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 54819-54850 0 1.0
NC_020894_5 5.1|54819|32|NC_020894|CRISPRCasFinder 54819-54850 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 54820-54851 0 1.0
NC_020894_5 5.2|54880|32|NC_020894|CRISPRCasFinder 54880-54911 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 54880-54911 0 1.0
NC_020894_5 5.2|54880|32|NC_020894|CRISPRCasFinder 54880-54911 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 54881-54912 0 1.0
NC_020894_5 5.3|54941|32|NC_020894|CRISPRCasFinder 54941-54972 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 54941-54972 0 1.0
NC_020894_5 5.3|54941|32|NC_020894|CRISPRCasFinder 54941-54972 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 54942-54973 0 1.0
NC_020894_6 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55226-55257 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 55226-55257 0 1.0
NC_020894_6 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55226-55257 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 55227-55258 0 1.0
NC_020894_6 6.2|55287|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55287-55318 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 55287-55318 0 1.0
NC_020894_6 6.2|55287|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55287-55318 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 55288-55319 0 1.0
NC_020894_6 6.3|55348|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55348-55379 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 55348-55379 0 1.0
NC_020894_6 6.3|55348|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55348-55379 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 55349-55380 0 1.0
NC_020894_6 6.4|55409|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55409-55440 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 55409-55440 0 1.0
NC_020894_6 6.4|55409|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55409-55440 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 55410-55441 0 1.0
NC_020894_6 6.5|55470|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55470-55501 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 55470-55501 0 1.0
NC_020894_6 6.5|55470|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55470-55501 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 55471-55502 0 1.0
NC_020894_6 6.6|55531|32|NC_020894|CRISPRCasFinder,CRT 55531-55562 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 55531-55562 0 1.0
NC_020894_6 6.6|55531|32|NC_020894|CRISPRCasFinder,CRT 55531-55562 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 55532-55563 0 1.0
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 55592-55623 0 1.0
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 55593-55624 0 1.0
NC_020894_6 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT 55653-55684 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 55653-55684 0 1.0
NC_020894_6 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT 55653-55684 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 55654-55685 0 1.0
NC_020894_6 6.9|55714|32|NC_020894|CRISPRCasFinder,CRT 55714-55745 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 55714-55745 0 1.0
NC_020894_6 6.9|55714|32|NC_020894|CRISPRCasFinder,CRT 55714-55745 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 57626-57657 0 1.0
NC_020894_6 6.9|55714|32|NC_020894|CRISPRCasFinder,CRT 55714-55745 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 55715-55746 0 1.0
NC_020894_6 6.9|55714|32|NC_020894|CRISPRCasFinder,CRT 55714-55745 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 57627-57658 0 1.0
NC_020894_7 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT 55999-56030 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 55999-56030 0 1.0
NC_020894_7 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT 55999-56030 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56000-56031 0 1.0
NC_020894_7 7.2|56060|32|NC_020894|CRISPRCasFinder,CRT 56060-56091 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56060-56091 0 1.0
NC_020894_7 7.2|56060|32|NC_020894|CRISPRCasFinder,CRT 56060-56091 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56061-56092 0 1.0
NC_020894_7 7.3|56121|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 56121-56152 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56121-56152 0 1.0
NC_020894_7 7.3|56121|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 56121-56152 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56122-56153 0 1.0
NC_020894_7 7.4|56182|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 56182-56213 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56182-56213 0 1.0
NC_020894_7 7.4|56182|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 56182-56213 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56183-56214 0 1.0
NC_020894_7 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 56243-56274 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56243-56274 0 1.0
NC_020894_7 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 56243-56274 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56244-56275 0 1.0
NC_020894_7 7.6|56304|31|NC_020894|CRISPRCasFinder,CRT 56304-56334 31 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56304-56334 0 1.0
NC_020894_7 7.6|56304|31|NC_020894|CRISPRCasFinder,CRT 56304-56334 31 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56305-56335 0 1.0
NC_020894_7 7.7|56364|32|NC_020894|CRISPRCasFinder,CRT 56364-56395 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56364-56395 0 1.0
NC_020894_7 7.7|56364|32|NC_020894|CRISPRCasFinder,CRT 56364-56395 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56365-56396 0 1.0
NC_020894_7 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT 56425-56456 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56425-56456 0 1.0
NC_020894_7 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT 56425-56456 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56426-56457 0 1.0
NC_020894_7 7.9|56486|32|NC_020894|CRISPRCasFinder,CRT 56486-56517 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56486-56517 0 1.0
NC_020894_7 7.9|56486|32|NC_020894|CRISPRCasFinder,CRT 56486-56517 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56487-56518 0 1.0
NC_020894_7 7.10|56547|32|NC_020894|CRISPRCasFinder,CRT 56547-56578 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56547-56578 0 1.0
NC_020894_7 7.10|56547|32|NC_020894|CRISPRCasFinder,CRT 56547-56578 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56548-56579 0 1.0
NC_020894_7 7.11|56608|32|NC_020894|CRISPRCasFinder,CRT 56608-56639 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56608-56639 0 1.0
NC_020894_7 7.11|56608|32|NC_020894|CRISPRCasFinder,CRT 56608-56639 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56609-56640 0 1.0
NC_020894_7 7.12|56669|32|NC_020894|CRISPRCasFinder,CRT 56669-56700 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56669-56700 0 1.0
NC_020894_7 7.12|56669|32|NC_020894|CRISPRCasFinder,CRT 56669-56700 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56670-56701 0 1.0
NC_020894_7 7.13|56730|32|NC_020894|CRISPRCasFinder,CRT 56730-56761 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56730-56761 0 1.0
NC_020894_7 7.13|56730|32|NC_020894|CRISPRCasFinder,CRT 56730-56761 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56731-56762 0 1.0
NC_020894_7 7.14|56791|32|NC_020894|CRISPRCasFinder,CRT 56791-56822 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56791-56822 0 1.0
NC_020894_7 7.14|56791|32|NC_020894|CRISPRCasFinder,CRT 56791-56822 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56792-56823 0 1.0
NC_020894_7 7.15|56304|32|NC_020894|PILER-CR 56304-56335 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56303-56334 0 1.0
NC_020894_7 7.15|56304|32|NC_020894|PILER-CR 56304-56335 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56304-56335 0 1.0
NC_020894_7 7.16|56365|32|NC_020894|PILER-CR 56365-56396 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56364-56395 0 1.0
NC_020894_7 7.16|56365|32|NC_020894|PILER-CR 56365-56396 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56365-56396 0 1.0
NC_020894_7 7.17|56426|32|NC_020894|PILER-CR 56426-56457 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56425-56456 0 1.0
NC_020894_7 7.17|56426|32|NC_020894|PILER-CR 56426-56457 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56426-56457 0 1.0
NC_020894_7 7.18|56487|32|NC_020894|PILER-CR 56487-56518 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56486-56517 0 1.0
NC_020894_7 7.18|56487|32|NC_020894|PILER-CR 56487-56518 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56487-56518 0 1.0
NC_020894_7 7.19|56548|32|NC_020894|PILER-CR 56548-56579 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56547-56578 0 1.0
NC_020894_7 7.19|56548|32|NC_020894|PILER-CR 56548-56579 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56548-56579 0 1.0
NC_020894_7 7.20|56609|32|NC_020894|PILER-CR 56609-56640 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56608-56639 0 1.0
NC_020894_7 7.20|56609|32|NC_020894|PILER-CR 56609-56640 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56609-56640 0 1.0
NC_020894_7 7.21|56670|32|NC_020894|PILER-CR 56670-56701 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56669-56700 0 1.0
NC_020894_7 7.21|56670|32|NC_020894|PILER-CR 56670-56701 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56670-56701 0 1.0
NC_020894_8 8.1|57076|32|NC_020894|CRISPRCasFinder,CRT 57076-57107 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 57076-57107 0 1.0
NC_020894_8 8.1|57076|32|NC_020894|CRISPRCasFinder,CRT 57076-57107 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 57077-57108 0 1.0
NC_020894_8 8.2|57137|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57137-57168 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 57137-57168 0 1.0
NC_020894_8 8.2|57137|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57137-57168 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 57138-57169 0 1.0
NC_020894_8 8.3|57198|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57198-57229 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 57198-57229 0 1.0
NC_020894_8 8.3|57198|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57198-57229 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 57199-57230 0 1.0
NC_020894_8 8.4|57259|33|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57259-57291 33 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 51058-51090 0 1.0
NC_020894_8 8.4|57259|33|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57259-57291 33 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 57259-57291 0 1.0
NC_020894_8 8.4|57259|33|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57259-57291 33 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 51059-51091 0 1.0
NC_020894_8 8.4|57259|33|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57259-57291 33 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 57260-57292 0 1.0
NC_020894_8 8.5|57321|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57321-57352 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 57321-57352 0 1.0
NC_020894_8 8.5|57321|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57321-57352 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 57322-57353 0 1.0
NC_020894_8 8.6|57382|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57382-57413 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 57382-57413 0 1.0
NC_020894_8 8.6|57382|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57382-57413 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 57383-57414 0 1.0
NC_020894_8 8.7|57443|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57443-57474 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 57443-57474 0 1.0
NC_020894_8 8.7|57443|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57443-57474 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 57444-57475 0 1.0
NC_020894_8 8.8|57504|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57504-57535 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 57504-57535 0 1.0
NC_020894_8 8.8|57504|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57504-57535 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 57505-57536 0 1.0
NC_020894_8 8.9|57565|32|NC_020894|CRISPRCasFinder,CRT 57565-57596 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 57565-57596 0 1.0
NC_020894_8 8.9|57565|32|NC_020894|CRISPRCasFinder,CRT 57565-57596 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 57566-57597 0 1.0
NC_020894_8 8.10|57626|32|NC_020894|CRISPRCasFinder 57626-57657 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 55714-55745 0 1.0
NC_020894_8 8.10|57626|32|NC_020894|CRISPRCasFinder 57626-57657 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 57626-57657 0 1.0
NC_020894_8 8.10|57626|32|NC_020894|CRISPRCasFinder 57626-57657 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 55715-55746 0 1.0
NC_020894_8 8.10|57626|32|NC_020894|CRISPRCasFinder 57626-57657 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 57627-57658 0 1.0
NC_020894_9 9.1|57911|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57911-57942 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 57911-57942 0 1.0
NC_020894_9 9.1|57911|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57911-57942 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 57912-57943 0 1.0
NC_020894_9 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57972-58003 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 57972-58003 0 1.0
NC_020894_9 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57972-58003 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 57973-58004 0 1.0
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 58033-58064 0 1.0
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 58034-58065 0 1.0
NC_020894_9 9.4|58094|31|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58094-58124 31 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 58094-58124 0 1.0
NC_020894_9 9.4|58094|31|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58094-58124 31 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 58095-58125 0 1.0
NC_020894_9 9.5|58154|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58154-58185 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 58154-58185 0 1.0
NC_020894_9 9.5|58154|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58154-58185 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 58155-58186 0 1.0
NC_020894_9 9.5|58154|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58154-58185 32 LN997844 Streptomyces reticuli genome assembly TUE45, plasmid : III 83457-83488 0 1.0
NC_020894_9 9.6|58215|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58215-58246 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 58215-58246 0 1.0
NC_020894_9 9.6|58215|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58215-58246 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 58216-58247 0 1.0
NC_020894_9 9.7|58276|32|NC_020894|CRISPRCasFinder,CRT 58276-58307 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 58276-58307 0 1.0
NC_020894_9 9.7|58276|32|NC_020894|CRISPRCasFinder,CRT 58276-58307 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 58277-58308 0 1.0
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 58337-58368 0 1.0
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 58338-58369 0 1.0
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 58398-58429 0 1.0
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 58399-58430 0 1.0
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 58459-58490 0 1.0
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 58460-58491 0 1.0
NC_020894_9 9.11|58520|32|NC_020894|CRISPRCasFinder,CRT 58520-58551 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 58520-58551 0 1.0
NC_020894_9 9.11|58520|32|NC_020894|CRISPRCasFinder,CRT 58520-58551 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 58521-58552 0 1.0
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 58581-58612 0 1.0
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 58582-58613 0 1.0
NC_020894_9 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT 58642-58673 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 58642-58673 0 1.0
NC_020894_9 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT 58642-58673 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 58643-58674 0 1.0
NC_020894_9 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT 58703-58734 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 58703-58734 0 1.0
NC_020894_9 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT 58703-58734 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 58704-58735 0 1.0
NC_020894_10 10.1|86892|60|NC_020894|CRISPRCasFinder 86892-86951 60 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 86892-86951 0 1.0
NC_020894_10 10.1|86892|60|NC_020894|CRISPRCasFinder 86892-86951 60 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 86893-86952 0 1.0
NC_020894_3 3.1|51816|32|NC_020894|CRISPRCasFinder 51816-51847 32 NZ_CP030863 Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence 12030-12061 1 0.969
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 84825-84856 1 0.969
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NC_022001 Streptomyces collinus Tu 365 plasmid pSCO1, complete sequence 28524-28555 1 0.969
NC_020894_5 5.3|54941|32|NC_020894|CRISPRCasFinder 54941-54972 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 57565-57596 1 0.969
NC_020894_5 5.3|54941|32|NC_020894|CRISPRCasFinder 54941-54972 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 57566-57597 1 0.969
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 MH834623 Arthrobacter phage Peas, complete genome 6324-6355 1 0.969
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 NC_048094 Arthrobacter phage Eileen, complete genome 6324-6355 1 0.969
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 MH834605 Arthrobacter phage Constance, complete genome 6364-6395 1 0.969
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 NC_048095 Arthrobacter phage Judy, complete genome 6363-6394 1 0.969
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 MH834603 Arthrobacter phage Bridgette, complete genome 6359-6390 1 0.969
NC_020894_6 6.9|55714|32|NC_020894|CRISPRCasFinder,CRT 55714-55745 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56791-56822 1 0.969
NC_020894_6 6.9|55714|32|NC_020894|CRISPRCasFinder,CRT 55714-55745 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56792-56823 1 0.969
NC_020894_7 7.14|56791|32|NC_020894|CRISPRCasFinder,CRT 56791-56822 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 55714-55745 1 0.969
NC_020894_7 7.14|56791|32|NC_020894|CRISPRCasFinder,CRT 56791-56822 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 57626-57657 1 0.969
NC_020894_7 7.14|56791|32|NC_020894|CRISPRCasFinder,CRT 56791-56822 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 55715-55746 1 0.969
NC_020894_7 7.14|56791|32|NC_020894|CRISPRCasFinder,CRT 56791-56822 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 57627-57658 1 0.969
NC_020894_8 8.3|57198|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57198-57229 32 NC_010851 Streptomyces sp. FR1 plasmid pFRL1, complete sequence 16057-16088 1 0.969
NC_020894_8 8.9|57565|32|NC_020894|CRISPRCasFinder,CRT 57565-57596 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 54941-54972 1 0.969
NC_020894_8 8.9|57565|32|NC_020894|CRISPRCasFinder,CRT 57565-57596 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 54942-54973 1 0.969
NC_020894_8 8.10|57626|32|NC_020894|CRISPRCasFinder 57626-57657 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 56791-56822 1 0.969
NC_020894_8 8.10|57626|32|NC_020894|CRISPRCasFinder 57626-57657 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 56792-56823 1 0.969
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 NC_016972 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG2, complete sequence 66208-66239 1 0.969
NC_020894_7 7.6|56304|31|NC_020894|CRISPRCasFinder,CRT 56304-56334 31 NZ_CP043961 Streptomyces tendae strain 139 plasmid unnamed2, complete sequence 24415-24445 2 0.935
NC_020894_7 7.15|56304|32|NC_020894|PILER-CR 56304-56335 32 NZ_CP043961 Streptomyces tendae strain 139 plasmid unnamed2, complete sequence 24414-24445 2 0.938
NC_020894_8 8.3|57198|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57198-57229 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 29334-29365 2 0.938
NC_020894_9 9.5|58154|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58154-58185 32 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 186371-186402 2 0.938
NC_020894_9 9.5|58154|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58154-58185 32 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 3182-3213 2 0.938
NC_020894_9 9.5|58154|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58154-58185 32 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 178203-178234 2 0.938
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 LN997844 Streptomyces reticuli genome assembly TUE45, plasmid : III 51653-51684 3 0.906
NC_020894_3 3.19|52177|37|NC_020894|CRT 52177-52213 37 NC_003903 Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence 93942-93978 3 0.919
NC_020894_3 3.19|52177|37|NC_020894|CRT 52177-52213 37 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 102618-102654 3 0.919
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 448118-448149 4 0.875
NC_020894_3 3.13|51811|37|NC_020894|CRT 51811-51847 37 NZ_CP009439 Streptomyces glaucescens strain GLA.O plasmid pSglau1, complete sequence 131283-131319 4 0.892
NC_020894_3 3.19|52177|37|NC_020894|CRT 52177-52213 37 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 84820-84856 4 0.892
NC_020894_3 3.4|51999|32|NC_020894|CRISPRCasFinder 51999-52030 32 NZ_CP011869 Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence 2010-2041 5 0.844
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NC_004719 Streptomyces avermitilis MA-4680 = NBRC 14893 plasmid SAP1, complete sequence 46915-46946 5 0.844
NC_020894_3 3.13|51811|37|NC_020894|CRT 51811-51847 37 NZ_CP030863 Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence 12025-12061 5 0.865
NC_020894_3 3.19|52177|37|NC_020894|CRT 52177-52213 37 NC_022001 Streptomyces collinus Tu 365 plasmid pSCO1, complete sequence 28519-28555 5 0.865
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 483370-483401 5 0.844
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 76903-76934 5 0.844
NC_020894_7 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 56243-56274 32 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 348632-348663 5 0.844
NC_020894_8 8.3|57198|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57198-57229 32 NZ_CP026654 Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence 57111-57142 5 0.844
NC_020894_9 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57972-58003 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 667160-667191 5 0.844
NC_020894_9 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57972-58003 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1456134-1456165 5 0.844
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP021029 Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence 2527-2558 5 0.844
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP020911 Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence 2527-2558 5 0.844
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NC_021911 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence 2526-2557 5 0.844
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP013515 Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence 2534-2565 5 0.844
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP013605 Rhizobium sp. N731 plasmid pRspN731d, complete sequence 2528-2559 5 0.844
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NC_019847 Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence 74175-74206 5 0.844
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 1308475-1308506 5 0.844
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 96202-96233 5 0.844
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 821160-821191 5 0.844
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 1264627-1264658 5 0.844
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP021803 Sinorhizobium meliloti strain USDA1021 plasmid accessoryA, complete sequence 181587-181618 5 0.844
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 592816-592847 5 0.844
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 1065834-1065865 5 0.844
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 806524-806555 5 0.844
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 1190992-1191023 5 0.844
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 682229-682260 5 0.844
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NC_019313 Sinorhizobium meliloti plasmid pHRC017, complete sequence 63914-63945 5 0.844
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 1060369-1060400 5 0.844
NC_020894_1 1.2|40596|29|NC_020894|CRISPRCasFinder 40596-40624 29 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 252026-252054 6 0.793
NC_020894_1 1.2|40596|29|NC_020894|CRISPRCasFinder 40596-40624 29 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 10631-10659 6 0.793
NC_020894_1 1.2|40596|29|NC_020894|CRISPRCasFinder 40596-40624 29 NZ_CP040821 Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence 25252-25280 6 0.793
NC_020894_1 1.2|40596|29|NC_020894|CRISPRCasFinder 40596-40624 29 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 322420-322448 6 0.793
NC_020894_1 1.2|40596|29|NC_020894|CRISPRCasFinder 40596-40624 29 NZ_LR594663 Variovorax sp. RA8 plasmid 2 103977-104005 6 0.793
NC_020894_1 1.6|40596|30|NC_020894|CRT 40596-40625 30 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 322420-322449 6 0.8
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 MK801721 Gordonia phage William, complete genome 1453-1484 6 0.812
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NC_011003 Burkholderia cenocepacia J2315 plasmid pBCJ2315, complete sequence 8760-8791 6 0.812
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_AP022335 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence 134875-134906 6 0.812
NC_020894_2 2.7|51119|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 51119-51150 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 406269-406300 6 0.812
NC_020894_2 2.7|51119|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 51119-51150 32 NZ_CP007144 Hymenobacter swuensis DY53 plasmid pHsw1, complete sequence 224860-224891 6 0.812
NC_020894_2 2.8|51180|32|NC_020894|CRISPRCasFinder,CRT 51180-51211 32 NC_023067 Streptomyces sp. F2 plasmid pFP3, complete sequence 32307-32338 6 0.812
NC_020894_2 2.8|51180|32|NC_020894|CRISPRCasFinder,CRT 51180-51211 32 NC_017833 Streptomyces sp. FR1 plasmid pFP4, complete sequence 39127-39158 6 0.812
NC_020894_2 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT 51485-51516 32 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 35633-35664 6 0.812
NC_020894_2 2.14|51546|32|NC_020894|CRT 51546-51577 32 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 140045-140076 6 0.812
NC_020894_2 2.14|51546|32|NC_020894|CRT 51546-51577 32 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 142438-142469 6 0.812
NC_020894_2 2.14|51546|32|NC_020894|CRT 51546-51577 32 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 428825-428856 6 0.812
NC_020894_3 3.2|51877|32|NC_020894|CRISPRCasFinder 51877-51908 32 MN234216 Streptomyces phage Gilgamesh, complete genome 103308-103339 6 0.812
NC_020894_3 3.4|51999|32|NC_020894|CRISPRCasFinder 51999-52030 32 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 427262-427293 6 0.812
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_CP011666 Streptomyces sp. Mg1 plasmid pSMg1-2, complete sequence 116781-116812 6 0.812
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 KT381864 Thiobacimonas phage vB_ThpS-P1, complete genome 23960-23991 6 0.812
NC_020894_3 3.8|52243|32|NC_020894|CRISPRCasFinder 52243-52274 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 671311-671342 6 0.812
NC_020894_3 3.10|52365|31|NC_020894|CRISPRCasFinder 52365-52395 31 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 431230-431260 6 0.806
NC_020894_3 3.10|52365|31|NC_020894|CRISPRCasFinder 52365-52395 31 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 560461-560491 6 0.806
NC_020894_3 3.19|52177|37|NC_020894|CRT 52177-52213 37 LN997844 Streptomyces reticuli genome assembly TUE45, plasmid : III 51653-51689 6 0.838
NC_020894_6 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55226-55257 32 NZ_CP014598 Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence 78019-78050 6 0.812
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 KM083128 Mycobacterium phage Sparky, complete genome 6127-6158 6 0.812
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NZ_CP015232 Epibacterium mobile F1926 plasmid unnamed2, complete sequence 99189-99220 6 0.812
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 797246-797277 6 0.812
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 EU307292 Burkholderia phage Bups phi1 clone 2 partial sequence 16731-16762 6 0.812
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NZ_CP024582 Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence 59698-59729 6 0.812
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NZ_CP041653 Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence 92387-92418 6 0.812
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NZ_CP025188 Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence 278742-278773 6 0.812
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP033585 Streptomyces sp. ADI95-16 plasmid pADI95-16d, complete sequence 3814-3845 6 0.812
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 473336-473367 6 0.812
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 294053-294084 6 0.812
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 MN175604 Gordonia phage PhorbesPhlower, complete genome 26326-26357 6 0.812
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 41572-41603 6 0.812
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1710955-1710986 6 0.812
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1734014-1734045 6 0.812
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 JQ680376 Unidentified phage clone 2209_scaffold1451 genomic sequence 15319-15350 6 0.812
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 894754-894785 6 0.812
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NC_006571 Streptomyces albulus plasmid pNO33 DNA, complete sequence 21906-21937 6 0.812
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 357784-357815 6 0.812
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP021127 Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence 4044-4075 6 0.812
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 830411-830442 6 0.812
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 432180-432211 6 0.812
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 89437-89468 6 0.812
NC_020894_1 1.2|40596|29|NC_020894|CRISPRCasFinder 40596-40624 29 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 902139-902167 7 0.759
NC_020894_1 1.2|40596|29|NC_020894|CRISPRCasFinder 40596-40624 29 NC_008271 Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence 320748-320776 7 0.759
NC_020894_1 1.2|40596|29|NC_020894|CRISPRCasFinder 40596-40624 29 NZ_LR134445 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 3, complete sequence 23031-23059 7 0.759
NC_020894_1 1.2|40596|29|NC_020894|CRISPRCasFinder 40596-40624 29 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5661992-5662020 7 0.759
NC_020894_1 1.2|40596|29|NC_020894|CRISPRCasFinder 40596-40624 29 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 83966-83994 7 0.759
NC_020894_1 1.4|40716|31|NC_020894|CRISPRCasFinder 40716-40746 31 NZ_AP020327 Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1 184094-184124 7 0.774
NC_020894_1 1.5|40777|31|NC_020894|CRISPRCasFinder 40777-40807 31 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1725731-1725761 7 0.774
NC_020894_1 1.5|40777|31|NC_020894|CRISPRCasFinder 40777-40807 31 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 488812-488842 7 0.774
NC_020894_1 1.5|40777|31|NC_020894|CRISPRCasFinder 40777-40807 31 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 406633-406663 7 0.774
NC_020894_1 1.6|40596|30|NC_020894|CRT 40596-40625 30 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 902138-902167 7 0.767
NC_020894_1 1.6|40596|30|NC_020894|CRT 40596-40625 30 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 252026-252055 7 0.767
NC_020894_1 1.6|40596|30|NC_020894|CRT 40596-40625 30 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 10631-10660 7 0.767
NC_020894_1 1.6|40596|30|NC_020894|CRT 40596-40625 30 NC_014839 Pantoea sp. At-9b plasmid pPAT9B02, complete sequence 302818-302847 7 0.767
NC_020894_1 1.6|40596|30|NC_020894|CRT 40596-40625 30 NZ_LR134445 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 3, complete sequence 23030-23059 7 0.767
NC_020894_1 1.6|40596|30|NC_020894|CRT 40596-40625 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5661991-5662020 7 0.767
NC_020894_1 1.6|40596|30|NC_020894|CRT 40596-40625 30 NZ_CP040821 Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence 25252-25281 7 0.767
NC_020894_1 1.9|40777|32|NC_020894|CRT,PILER-CR 40777-40808 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1725731-1725762 7 0.781
NC_020894_1 1.9|40777|32|NC_020894|CRT,PILER-CR 40777-40808 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 406632-406663 7 0.781
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_CP026305 Streptomyces lunaelactis strain MM109 plasmid pSLUN1, complete sequence 91691-91722 7 0.781
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 807382-807413 7 0.781
NC_020894_2 2.8|51180|32|NC_020894|CRISPRCasFinder,CRT 51180-51211 32 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 32142-32173 7 0.781
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 KU160671 Arthrobacter phage Vulture, complete genome 28538-28569 7 0.781
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 KU160648 Arthrobacter phage HunterDalle, complete genome 28538-28569 7 0.781
NC_020894_3 3.1|51816|32|NC_020894|CRISPRCasFinder 51816-51847 32 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 20210-20241 7 0.781
NC_020894_3 3.3|51938|32|NC_020894|CRISPRCasFinder 51938-51969 32 NC_003903 Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence 126185-126216 7 0.781
NC_020894_3 3.3|51938|32|NC_020894|CRISPRCasFinder 51938-51969 32 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 705066-705097 7 0.781
NC_020894_3 3.3|51938|32|NC_020894|CRISPRCasFinder 51938-51969 32 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 935980-936011 7 0.781
NC_020894_3 3.4|51999|32|NC_020894|CRISPRCasFinder 51999-52030 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 103492-103523 7 0.781
NC_020894_3 3.4|51999|32|NC_020894|CRISPRCasFinder 51999-52030 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 103493-103524 7 0.781
NC_020894_3 3.4|51999|32|NC_020894|CRISPRCasFinder 51999-52030 32 NC_024145 Mycobacterium phage Hosp, complete genome 47156-47187 7 0.781
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1675213-1675244 7 0.781
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_LR134455 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence 236066-236097 7 0.781
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_CP011666 Streptomyces sp. Mg1 plasmid pSMg1-2, complete sequence 77502-77533 7 0.781
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NC_016972 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG2, complete sequence 9153-9184 7 0.781
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 192710-192741 7 0.781
NC_020894_3 3.10|52365|31|NC_020894|CRISPRCasFinder 52365-52395 31 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 409264-409294 7 0.774
NC_020894_3 3.10|52365|31|NC_020894|CRISPRCasFinder 52365-52395 31 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 326772-326802 7 0.774
NC_020894_3 3.10|52365|31|NC_020894|CRISPRCasFinder 52365-52395 31 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 325094-325124 7 0.774
NC_020894_3 3.10|52365|31|NC_020894|CRISPRCasFinder 52365-52395 31 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 371402-371432 7 0.774
NC_020894_3 3.10|52365|31|NC_020894|CRISPRCasFinder 52365-52395 31 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 400434-400464 7 0.774
NC_020894_3 3.11|52425|32|NC_020894|CRISPRCasFinder 52425-52456 32 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 485754-485785 7 0.781
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 MN813681 Mycobacterium phage Roary, complete genome 7722-7753 7 0.781
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 KT184694 Mycobacterium phage Smeadley, complete genome 7755-7786 7 0.781
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 MK524492 Mycobacterium phage Expelliarmus, complete genome 7723-7754 7 0.781
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 MH825708 Mycobacterium phage NearlyHeadless, complete genome 7760-7791 7 0.781
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 NC_022753 Mycobacterium phage Fredward, complete genome 7718-7749 7 0.781
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 MH651173 Mycobacterium phage Dixon, complete genome 7756-7787 7 0.781
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 MT310857 Mycobacterium phage Danforth, complete genome 7737-7768 7 0.781
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 JX015524 Mycobacterium virus Astro, complete genome 7758-7789 7 0.781
NC_020894_4 4.3|53131|32|NC_020894|CRISPRCasFinder 53131-53162 32 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 352653-352684 7 0.781
NC_020894_6 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55226-55257 32 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 140918-140949 7 0.781
NC_020894_6 6.6|55531|32|NC_020894|CRISPRCasFinder,CRT 55531-55562 32 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 19849-19880 7 0.781
NC_020894_6 6.6|55531|32|NC_020894|CRISPRCasFinder,CRT 55531-55562 32 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 1891686-1891717 7 0.781
NC_020894_6 6.6|55531|32|NC_020894|CRISPRCasFinder,CRT 55531-55562 32 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 1747645-1747676 7 0.781
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 MH727545 Mycobacterium phage DismalStressor, complete genome 6658-6689 7 0.781
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 NC_026598 Mycobacterium phage Milly, complete genome 6658-6689 7 0.781
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 KX688047 Mycobacterium phage Marcoliusprime, complete genome 6658-6689 7 0.781
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 MF140408 Mycobacterium phage DismalFunk, complete genome 6658-6689 7 0.781
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 MF140411 Mycobacterium phage Findley, complete genome 6658-6689 7 0.781
NC_020894_6 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT 55653-55684 32 MK510962 Pseudomonas phage CF3, partial genome 11312-11343 7 0.781
NC_020894_6 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT 55653-55684 32 MK510987 Pseudomonas phage BR233, partial genome 18926-18957 7 0.781
NC_020894_6 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT 55653-55684 32 MG707188 Pseudomonas phage TC7, partial genome 5544-5575 7 0.781
NC_020894_6 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT 55653-55684 32 MK510974 Pseudomonas phage CF140, partial genome 18896-18927 7 0.781
NC_020894_6 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT 55653-55684 32 NC_007805 Pseudomonas phage F10, complete genome 18994-19025 7 0.781
NC_020894_6 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT 55653-55684 32 MK510978 Pseudomonas phage CF208, partial genome 19036-19067 7 0.781
NC_020894_6 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT 55653-55684 32 MK510988 Pseudomonas phage BR299, partial genome 19116-19147 7 0.781
NC_020894_6 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT 55653-55684 32 MK510976 Pseudomonas phage CF165, partial genome 39636-39667 7 0.781
NC_020894_6 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT 55653-55684 32 KM389229 UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence 21416-21447 7 0.781
NC_020894_6 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT 55653-55684 32 MK510992 Pseudomonas phage BR144, partial genome 3905-3936 7 0.781
NC_020894_6 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT 55653-55684 32 MK510975 Pseudomonas phage CF145, partial genome 19212-19243 7 0.781
NC_020894_6 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT 55653-55684 32 MK510986 Pseudomonas phage BR213, partial genome 18920-18951 7 0.781
NC_020894_6 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT 55653-55684 32 DQ163912 Bacteriophage F10, complete genome 18994-19025 7 0.781
NC_020894_7 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT 55999-56030 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 609680-609711 7 0.781
NC_020894_7 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT 55999-56030 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1284760-1284791 7 0.781
NC_020894_7 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT 55999-56030 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1113064-1113095 7 0.781
NC_020894_7 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT 55999-56030 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1113010-1113041 7 0.781
NC_020894_7 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT 55999-56030 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 601652-601683 7 0.781
NC_020894_7 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT 55999-56030 32 NZ_LR699074 Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2 29884-29915 7 0.781
NC_020894_7 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT 55999-56030 32 NZ_LR699074 Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2 40782-40813 7 0.781
NC_020894_7 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT 55999-56030 32 NZ_LR699074 Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2 64915-64946 7 0.781
NC_020894_7 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT 55999-56030 32 NZ_LR699074 Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2 74744-74775 7 0.781
NC_020894_7 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT 55999-56030 32 NZ_LR699074 Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2 111323-111354 7 0.781
NC_020894_7 7.6|56304|31|NC_020894|CRISPRCasFinder,CRT 56304-56334 31 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 769901-769931 7 0.774
NC_020894_7 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT 56425-56456 32 MH590604 Microbacterium phage ColaCorta, complete genome 25041-25072 7 0.781
NC_020894_7 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT 56425-56456 32 MT553340 Microbacterium phage Glamour, complete genome 25033-25064 7 0.781
NC_020894_7 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT 56425-56456 32 MN096378 Microbacterium phage MCubed, complete genome 25058-25089 7 0.781
NC_020894_7 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT 56425-56456 32 MH513982 Microbacterium phage Sansa, complete genome 25119-25150 7 0.781
NC_020894_7 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT 56425-56456 32 MK894432 Microbacterium phage Finny, complete genome 25082-25113 7 0.781
NC_020894_7 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT 56425-56456 32 MH590606 Microbacterium phage Andromedas, complete genome 25041-25072 7 0.781
NC_020894_7 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT 56425-56456 32 MG839027 Microbacterium phage Eleri, complete genome 25042-25073 7 0.781
NC_020894_7 7.9|56486|32|NC_020894|CRISPRCasFinder,CRT 56486-56517 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1298599-1298630 7 0.781
NC_020894_7 7.9|56486|32|NC_020894|CRISPRCasFinder,CRT 56486-56517 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 514935-514966 7 0.781
NC_020894_7 7.10|56547|32|NC_020894|CRISPRCasFinder,CRT 56547-56578 32 MK494108 Mycobacterium phage Charm, complete genome 44571-44602 7 0.781
NC_020894_7 7.10|56547|32|NC_020894|CRISPRCasFinder,CRT 56547-56578 32 MN585974 Mycobacterium phage DreamTeam1, complete genome 44419-44450 7 0.781
NC_020894_7 7.12|56669|32|NC_020894|CRISPRCasFinder,CRT 56669-56700 32 NZ_CP026653 Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence 74951-74982 7 0.781
NC_020894_7 7.12|56669|32|NC_020894|CRISPRCasFinder,CRT 56669-56700 32 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 345122-345153 7 0.781
NC_020894_7 7.12|56669|32|NC_020894|CRISPRCasFinder,CRT 56669-56700 32 NC_019387 Thermus oshimai JL-2 plasmid pTHEOS01, complete sequence 209857-209888 7 0.781
NC_020894_7 7.17|56426|32|NC_020894|PILER-CR 56426-56457 32 MH590604 Microbacterium phage ColaCorta, complete genome 25041-25072 7 0.781
NC_020894_7 7.17|56426|32|NC_020894|PILER-CR 56426-56457 32 MT553340 Microbacterium phage Glamour, complete genome 25033-25064 7 0.781
NC_020894_7 7.17|56426|32|NC_020894|PILER-CR 56426-56457 32 MN096378 Microbacterium phage MCubed, complete genome 25058-25089 7 0.781
NC_020894_7 7.17|56426|32|NC_020894|PILER-CR 56426-56457 32 MH513982 Microbacterium phage Sansa, complete genome 25119-25150 7 0.781
NC_020894_7 7.17|56426|32|NC_020894|PILER-CR 56426-56457 32 MK894432 Microbacterium phage Finny, complete genome 25082-25113 7 0.781
NC_020894_7 7.17|56426|32|NC_020894|PILER-CR 56426-56457 32 MH590606 Microbacterium phage Andromedas, complete genome 25041-25072 7 0.781
NC_020894_7 7.17|56426|32|NC_020894|PILER-CR 56426-56457 32 MG839027 Microbacterium phage Eleri, complete genome 25042-25073 7 0.781
NC_020894_7 7.18|56487|32|NC_020894|PILER-CR 56487-56518 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1298599-1298630 7 0.781
NC_020894_7 7.18|56487|32|NC_020894|PILER-CR 56487-56518 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 514935-514966 7 0.781
NC_020894_7 7.19|56548|32|NC_020894|PILER-CR 56548-56579 32 MK494108 Mycobacterium phage Charm, complete genome 44571-44602 7 0.781
NC_020894_7 7.19|56548|32|NC_020894|PILER-CR 56548-56579 32 MN585974 Mycobacterium phage DreamTeam1, complete genome 44419-44450 7 0.781
NC_020894_7 7.21|56670|32|NC_020894|PILER-CR 56670-56701 32 NZ_CP026653 Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence 74951-74982 7 0.781
NC_020894_7 7.21|56670|32|NC_020894|PILER-CR 56670-56701 32 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 345122-345153 7 0.781
NC_020894_7 7.21|56670|32|NC_020894|PILER-CR 56670-56701 32 NC_019387 Thermus oshimai JL-2 plasmid pTHEOS01, complete sequence 209857-209888 7 0.781
NC_020894_8 8.3|57198|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57198-57229 32 NZ_CP032827 Sphingomonas sp. YZ-8 plasmid unnamed2, complete sequence 153923-153954 7 0.781
NC_020894_8 8.5|57321|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57321-57352 32 NZ_CP046903 Pseudomonas stutzeri strain PM101005 plasmid p1_PM101005, complete sequence 20902-20933 7 0.781
NC_020894_8 8.6|57382|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57382-57413 32 NC_001387 Streptomyces lividans plasmid pIJ101, complete sequence 1620-1651 7 0.781
NC_020894_9 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57972-58003 32 MN585994 Mycobacterium phage SheaKeira, complete genome 35533-35564 7 0.781
NC_020894_9 9.4|58094|31|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58094-58124 31 NZ_CP016619 Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence 39275-39305 7 0.774
NC_020894_9 9.4|58094|31|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58094-58124 31 NC_011273 Mycobacterium phage Myrna, complete genome 78935-78965 7 0.774
NC_020894_9 9.4|58094|31|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58094-58124 31 LR606149 Rhizobium sp. Q54 genome assembly, plasmid: 6 39015-39045 7 0.774
NC_020894_9 9.6|58215|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58215-58246 32 NZ_CP016617 Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence 1343110-1343141 7 0.781
NC_020894_9 9.7|58276|32|NC_020894|CRISPRCasFinder,CRT 58276-58307 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 604063-604094 7 0.781
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP021375 Rhizobium sp. ACO-34A plasmid pRACO34Aa, complete sequence 46319-46350 7 0.781
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 431600-431631 7 0.781
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1700792-1700823 7 0.781
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 MH727561 Mycobacterium phage Serendipitous, complete genome 13896-13927 7 0.781
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 MG711460 Faecalibacterium phage FP_Mushu, complete genome 21853-21884 7 0.781
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NC_012849 Ralstonia pickettii 12D plasmid pRp12D02, complete sequence 86271-86302 7 0.781
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 935571-935602 7 0.781
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NC_007766 Rhizobium etli CFN 42 plasmid p42f, complete sequence 2520-2551 7 0.781
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP034352 Streptomyces sp. W1SF4 plasmid p2, complete sequence 83519-83550 7 0.781
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 946631-946662 7 0.781
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP028569 Acinetobacter pittii strain WCHAP005046 plasmid p1_005046, complete sequence 97380-97411 7 0.781
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 CP033559 Acinetobacter nosocomialis strain 2012C01-137 plasmid p2012C01-137-2, complete sequence 40240-40271 7 0.781
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 CP033551 Acinetobacter nosocomialis strain 2014S01-097 plasmid p2014S01-097-1, complete sequence 33459-33490 7 0.781
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 CP033546 Acinetobacter nosocomialis strain 2014N23-120 plasmid p2014N23-120-1, complete sequence 23849-23880 7 0.781
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 183580-183611 7 0.781
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP044357 Acinetobacter baumannii strain CAM180-1 plasmid pCAM180A, complete sequence 4347-4378 7 0.781
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NC_016978 Comamonas testosteroni plasmid pI2, complete sequence 35649-35680 7 0.781
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP028139 Acinetobacter baumannii strain NCIMB 8209 plasmid pAbNCIMB8209_134, complete sequence 78652-78683 7 0.781
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1395940-1395971 7 0.781
NC_020894_9 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT 58642-58673 32 NZ_CP017304 Rhodococcus sp. YL-1 plasmid pYLL2 sequence 246372-246403 7 0.781
NC_020894_9 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT 58642-58673 32 NZ_CP021356 Rhodococcus sp. S2-17 plasmid pRB29, complete sequence 63997-64028 7 0.781
NC_020894_9 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT 58642-58673 32 NZ_CP050125 Rhodococcus erythropolis strain KB1 plasmid plas1, complete sequence 44564-44595 7 0.781
NC_020894_9 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT 58642-58673 32 NZ_CP046575 Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence 36774-36805 7 0.781
NC_020894_9 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT 58642-58673 32 NC_005073 Rhodococcus erythropolis linear plasmid pBD2, complete sequence 100025-100056 7 0.781
NC_020894_9 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT 58642-58673 32 NZ_CP034156 Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence 97690-97721 7 0.781
NC_020894_9 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT 58642-58673 32 NZ_CP042915 Rhodococcus qingshengii strain RL1 plasmid unnamed2 85476-85507 7 0.781
NC_020894_9 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT 58642-58673 32 NZ_CP042915 Rhodococcus qingshengii strain RL1 plasmid unnamed2 447968-447999 7 0.781
NC_020894_9 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT 58642-58673 32 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 377636-377667 7 0.781
NC_020894_9 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT 58642-58673 32 NZ_CP020385 Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence 125265-125296 7 0.781
NC_020894_9 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT 58703-58734 32 NZ_CP009294 Novosphingobium pentaromativorans US6-1 plasmid pLA1, complete sequence 155271-155302 7 0.781
NC_020894_9 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT 58703-58734 32 NZ_CP044976 Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-1, complete sequence 152671-152702 7 0.781
NC_020894_9 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT 58703-58734 32 NZ_CP044976 Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-1, complete sequence 172923-172954 7 0.781
NC_020894_1 1.2|40596|29|NC_020894|CRISPRCasFinder 40596-40624 29 NZ_CP011450 Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence 36574-36602 8 0.724
NC_020894_1 1.2|40596|29|NC_020894|CRISPRCasFinder 40596-40624 29 NZ_AP017656 Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence 307088-307116 8 0.724
NC_020894_1 1.3|40655|31|NC_020894|CRISPRCasFinder 40655-40685 31 MH834602 Microbacterium phage Brahms, complete genome 12791-12821 8 0.742
NC_020894_1 1.3|40655|31|NC_020894|CRISPRCasFinder 40655-40685 31 MN183281 Microbacterium phage Vitas, complete genome 12791-12821 8 0.742
NC_020894_1 1.3|40655|31|NC_020894|CRISPRCasFinder 40655-40685 31 MH834604 Microbacterium phage Coltrane, complete genome 12791-12821 8 0.742
NC_020894_1 1.3|40655|31|NC_020894|CRISPRCasFinder 40655-40685 31 MH834596 Microbacterium phage Armstrong, complete genome 12791-12821 8 0.742
NC_020894_1 1.4|40716|31|NC_020894|CRISPRCasFinder 40716-40746 31 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 338606-338636 8 0.742
NC_020894_1 1.5|40777|31|NC_020894|CRISPRCasFinder 40777-40807 31 KX815338 Streptomyces phage Joe, complete genome 13516-13546 8 0.742
NC_020894_1 1.6|40596|30|NC_020894|CRT 40596-40625 30 NC_008271 Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence 320748-320777 8 0.733
NC_020894_1 1.6|40596|30|NC_020894|CRT 40596-40625 30 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 83965-83994 8 0.733
NC_020894_1 1.8|40716|32|NC_020894|CRT,PILER-CR 40716-40747 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 338606-338637 8 0.75
NC_020894_1 1.8|40716|32|NC_020894|CRT,PILER-CR 40716-40747 32 NZ_AP020327 Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1 184094-184125 8 0.75
NC_020894_1 1.9|40777|32|NC_020894|CRT,PILER-CR 40777-40808 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 488811-488842 8 0.75
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 411711-411742 8 0.75
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 410920-410951 8 0.75
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 861617-861648 8 0.75
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 951506-951537 8 0.75
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_CP034811 Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence 182255-182286 8 0.75
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_CP017078 Novosphingobium resinovorum strain SA1 plasmid pSA3, complete sequence 262529-262560 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP021031 Rhizobium sp. NXC14 plasmid pRspNXC14a, complete sequence 477626-477657 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP020910 Rhizobium etli strain NXC12 plasmid pRetNXC12d, complete sequence 510115-510146 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 1608803-1608834 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 143145-143176 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 145882-145913 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 1549008-1549039 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 210682-210713 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 1154014-1154045 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 1533938-1533969 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 1581511-1581542 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 1393135-1393166 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 180409-180440 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 245531-245562 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 165183-165214 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1509668-1509699 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 1477104-1477135 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 1059286-1059317 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 705408-705439 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 1097971-1098002 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 70121-70152 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 1592083-1592114 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 352912-352943 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 140508-140539 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 143145-143176 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 532301-532332 8 0.75
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 MK376954 Gordonia phage WhoseManz, complete genome 45059-45090 8 0.75
NC_020894_2 2.12|51424|32|NC_020894|CRISPRCasFinder,CRT 51424-51455 32 NZ_CP037915 Sphingomonas sp. AAP5 plasmid p150, complete sequence 65979-66010 8 0.75
NC_020894_2 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT 51485-51516 32 NZ_CP011518 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence 611160-611191 8 0.75
NC_020894_2 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT 51485-51516 32 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 96602-96633 8 0.75
NC_020894_2 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT 51485-51516 32 NZ_CP027794 Rhodococcus hoagii strain DSSKP-R-001 plasmid plas1, complete sequence 55840-55871 8 0.75
NC_020894_2 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT 51485-51516 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 579847-579878 8 0.75
NC_020894_2 2.14|51546|32|NC_020894|CRT 51546-51577 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1950483-1950514 8 0.75
NC_020894_2 2.14|51546|32|NC_020894|CRT 51546-51577 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1136102-1136133 8 0.75
NC_020894_2 2.14|51546|32|NC_020894|CRT 51546-51577 32 NZ_CP012478 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence 25876-25907 8 0.75
NC_020894_3 3.3|51938|32|NC_020894|CRISPRCasFinder 51938-51969 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1145199-1145230 8 0.75
NC_020894_3 3.4|51999|32|NC_020894|CRISPRCasFinder 51999-52030 32 NZ_CP040720 Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence 8043-8074 8 0.75
NC_020894_3 3.4|51999|32|NC_020894|CRISPRCasFinder 51999-52030 32 NZ_CP018064 Rhodococcus sp. 2G plasmid p1, complete sequence 160459-160490 8 0.75
NC_020894_3 3.4|51999|32|NC_020894|CRISPRCasFinder 51999-52030 32 NC_017771 Deinococcus gobiensis I-0 plasmid P3, complete sequence 144236-144267 8 0.75
NC_020894_3 3.4|51999|32|NC_020894|CRISPRCasFinder 51999-52030 32 NZ_CP016821 Rhodococcus sp. p52 plasmid pDF01, complete sequence 61970-62001 8 0.75
NC_020894_3 3.4|51999|32|NC_020894|CRISPRCasFinder 51999-52030 32 NZ_CP038031 Rhodococcus ruber strain R1 plasmid unnamed1, complete sequence 76408-76439 8 0.75
NC_020894_3 3.4|51999|32|NC_020894|CRISPRCasFinder 51999-52030 32 MH744423 Mycobacterium phage Saguaro, complete genome 52001-52032 8 0.75
NC_020894_3 3.4|51999|32|NC_020894|CRISPRCasFinder 51999-52030 32 KU998247 Gordonia phage Bachita, complete genome 68725-68756 8 0.75
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NC_012520 Rhodococcus opacus B4 plasmid pROB01, complete sequence 217618-217649 8 0.75
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NC_008271 Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence 205318-205349 8 0.75
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_CP046575 Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence 74811-74842 8 0.75
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 153671-153702 8 0.75
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 246152-246183 8 0.75
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 57950-57981 8 0.75
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NC_011990 Agrobacterium radiobacter K84 plasmid pAtK84b, complete sequence 58454-58485 8 0.75
NC_020894_3 3.10|52365|31|NC_020894|CRISPRCasFinder 52365-52395 31 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 493631-493661 8 0.742
NC_020894_3 3.10|52365|31|NC_020894|CRISPRCasFinder 52365-52395 31 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 60473-60503 8 0.742
NC_020894_3 3.10|52365|31|NC_020894|CRISPRCasFinder 52365-52395 31 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 103656-103686 8 0.742
NC_020894_3 3.10|52365|31|NC_020894|CRISPRCasFinder 52365-52395 31 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 95369-95399 8 0.742
NC_020894_3 3.10|52365|31|NC_020894|CRISPRCasFinder 52365-52395 31 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 274417-274447 8 0.742
NC_020894_3 3.10|52365|31|NC_020894|CRISPRCasFinder 52365-52395 31 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 251540-251570 8 0.742
NC_020894_3 3.11|52425|32|NC_020894|CRISPRCasFinder 52425-52456 32 NZ_LR594691 Variovorax sp. WDL1 plasmid 3 564620-564651 8 0.75
NC_020894_3 3.19|52177|37|NC_020894|CRT 52177-52213 37 NC_004719 Streptomyces avermitilis MA-4680 = NBRC 14893 plasmid SAP1, complete sequence 46910-46946 8 0.784
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 MH588547 Caulobacter phage CcrSC, complete genome 14579-14610 8 0.75
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 MH588547 Caulobacter phage CcrSC, complete genome 308121-308152 8 0.75
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 NC_048047 Caulobacter phage CcrBL9, complete genome 13858-13889 8 0.75
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 NC_048047 Caulobacter phage CcrBL9, complete genome 313870-313901 8 0.75
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 NZ_CP011453 Altererythrobacter atlanticus strain 26DY36 plasmid unnamed, complete sequence 76714-76745 8 0.75
NC_020894_4 4.2|53070|32|NC_020894|CRISPRCasFinder 53070-53101 32 NC_011962 Rhodobacter sphaeroides KD131 plasmid pRSKD131A, complete sequence 71080-71111 8 0.75
NC_020894_4 4.2|53070|32|NC_020894|CRISPRCasFinder 53070-53101 32 NZ_CP027930 Microbacterium sp. SGAir0570 plasmid pSGAir0570_2, complete sequence 20388-20419 8 0.75
NC_020894_4 4.3|53131|32|NC_020894|CRISPRCasFinder 53131-53162 32 NZ_CP033873 Caulobacter sp. FWC26 plasmid p1, complete sequence 98572-98603 8 0.75
NC_020894_6 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55226-55257 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1423012-1423043 8 0.75
NC_020894_6 6.4|55409|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55409-55440 32 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 293680-293711 8 0.75
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 NZ_CP020811 Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed2, complete sequence 119101-119132 8 0.75
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 230878-230909 8 0.75
NC_020894_6 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT 55653-55684 32 NC_030931 Pseudomonas phage phi2, complete genome 40272-40303 8 0.75
NC_020894_7 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT 55999-56030 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 627303-627334 8 0.75
NC_020894_7 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT 55999-56030 32 NZ_CP041044 Paracoccus sp. AK26 plasmid pAK2, complete sequence 105504-105535 8 0.75
NC_020894_7 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 56243-56274 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 726774-726805 8 0.75
NC_020894_7 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 56243-56274 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1086297-1086328 8 0.75
NC_020894_7 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 56243-56274 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 164648-164679 8 0.75
NC_020894_7 7.7|56364|32|NC_020894|CRISPRCasFinder,CRT 56364-56395 32 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 490994-491025 8 0.75
NC_020894_7 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT 56425-56456 32 MT657343 Microbacterium phage GaeCeo, complete genome 1474-1505 8 0.75
NC_020894_7 7.15|56304|32|NC_020894|PILER-CR 56304-56335 32 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 769900-769931 8 0.75
NC_020894_7 7.16|56365|32|NC_020894|PILER-CR 56365-56396 32 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 490994-491025 8 0.75
NC_020894_7 7.17|56426|32|NC_020894|PILER-CR 56426-56457 32 MT657343 Microbacterium phage GaeCeo, complete genome 1474-1505 8 0.75
NC_020894_8 8.3|57198|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57198-57229 32 NZ_CP048426 Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence 125453-125484 8 0.75
NC_020894_8 8.5|57321|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57321-57352 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 980204-980235 8 0.75
NC_020894_8 8.5|57321|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57321-57352 32 MG592544 Vibrio phage 1.177.O._10N.286.45.E10, partial genome 14816-14847 8 0.75
NC_020894_9 9.1|57911|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57911-57942 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 99180-99211 8 0.75
NC_020894_9 9.1|57911|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57911-57942 32 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1786620-1786651 8 0.75
NC_020894_9 9.1|57911|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57911-57942 32 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 1618635-1618666 8 0.75
NC_020894_9 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57972-58003 32 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 330663-330694 8 0.75
NC_020894_9 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57972-58003 32 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 327849-327880 8 0.75
NC_020894_9 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57972-58003 32 NZ_CP015006 Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence 241731-241762 8 0.75
NC_020894_9 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57972-58003 32 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 676906-676937 8 0.75
NC_020894_9 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57972-58003 32 NZ_CP047177 Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence 82271-82302 8 0.75
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 72135-72166 8 0.75
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 455713-455744 8 0.75
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NZ_LR536451 Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 2 7324-7355 8 0.75
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1170086-1170117 8 0.75
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 319338-319369 8 0.75
NC_020894_9 9.7|58276|32|NC_020894|CRISPRCasFinder,CRT 58276-58307 32 MN234226 Mycobacterium phage Curiosium, complete genome 52490-52521 8 0.75
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NC_014818 Asticcacaulis excentricus CB 48 plasmid pASTEX01, complete sequence 1991-2022 8 0.75
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 128540-128571 8 0.75
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 49448-49479 8 0.75
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1155354-1155385 8 0.75
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 42261-42292 8 0.75
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 1002698-1002729 8 0.75
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 38405-38436 8 0.75
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_CP010956 Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence 118218-118249 8 0.75
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP006990 Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence 4217-4248 8 0.75
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 4217-4248 8 0.75
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NC_007949 Polaromonas sp. JS666 plasmid 1, complete sequence 148951-148982 8 0.75
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_LR134449 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 7, complete sequence 17277-17308 8 0.75
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 738501-738532 8 0.75
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP042995 Acinetobacter nosocomialis strain J1A plasmid unnamed1, complete sequence 48055-48086 8 0.75
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_KX426229 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.1, complete sequence 123636-123667 8 0.75
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1009697-1009728 8 0.75
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 CP033573 Acinetobacter nosocomialis strain 2010N17-248 plasmid p2010N17-248, complete sequence 25671-25702 8 0.75
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 562840-562871 8 0.75
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 CP019144 Acinetobacter lwoffii strain ZS207 plasmid pmZS, complete sequence 51743-51774 8 0.75
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP026129 Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence 72105-72136 8 0.75
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 3878-3909 8 0.75
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 414172-414203 8 0.75
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_AP018825 Acinetobacter ursingii strain M3 plasmid pAURM-1, complete sequence 47342-47373 8 0.75
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP032290 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.6, complete sequence 65151-65182 8 0.75
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 FJ937737 Burkholderia cenocepacia phage BcepIL02, complete genome 31003-31034 8 0.75
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 NC_012743 Burkholderia phage BcepIL02, complete genome 31003-31034 8 0.75
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 NZ_CP024582 Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence 84055-84086 8 0.75
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 NC_009939 Deinococcus geothermalis DSM 11300 plasmid pDGEO02, complete sequence 54153-54184 8 0.75
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 NZ_CP011666 Streptomyces sp. Mg1 plasmid pSMg1-2, complete sequence 104729-104760 8 0.75
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 MK494124 Mycobacterium phage Kristoff, complete genome 31797-31828 8 0.75
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 MN586038 Mycobacterium phage WalterMcMickey, complete genome 31358-31389 8 0.75
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 JX411619 Mycobacterium virus Rebeuca, complete genome 31798-31829 8 0.75
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 NC_041982 Mycobacterium phage Twister, complete genome 31358-31389 8 0.75
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 MT522002 Mycobacterium phage Topanga, complete genome 31447-31478 8 0.75
NC_020894_9 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT 58642-58673 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 102137-102168 8 0.75
NC_020894_9 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT 58642-58673 32 KM659098 Sinorhizobium sp. LM21 plasmid pLM21S1, complete sequence 35531-35562 8 0.75
NC_020894_9 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT 58703-58734 32 NC_019917 Burkholderia phage BcepMigl, complete genome 57818-57849 8 0.75
NC_020894_1 1.2|40596|29|NC_020894|CRISPRCasFinder 40596-40624 29 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 148339-148367 9 0.69
NC_020894_1 1.5|40777|31|NC_020894|CRISPRCasFinder 40777-40807 31 NZ_CP015204 Rhodococcus sp. 008 plasmid pR8C1, complete sequence 19597-19627 9 0.71
NC_020894_1 1.5|40777|31|NC_020894|CRISPRCasFinder 40777-40807 31 MN703407 Microbacterium phage Leaf, complete genome 65386-65416 9 0.71
NC_020894_1 1.5|40777|31|NC_020894|CRISPRCasFinder 40777-40807 31 MN703414 Microbacterium phage Dewdrop, complete genome 65386-65416 9 0.71
NC_020894_1 1.6|40596|30|NC_020894|CRT 40596-40625 30 NZ_AP017656 Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence 307088-307117 9 0.7
NC_020894_1 1.6|40596|30|NC_020894|CRT 40596-40625 30 NZ_CP011450 Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence 36573-36602 9 0.7
NC_020894_1 1.6|40596|30|NC_020894|CRT 40596-40625 30 NZ_LR594663 Variovorax sp. RA8 plasmid 2 103977-104006 9 0.7
NC_020894_1 1.7|40655|32|NC_020894|CRT,PILER-CR 40655-40686 32 MH834602 Microbacterium phage Brahms, complete genome 12790-12821 9 0.719
NC_020894_1 1.7|40655|32|NC_020894|CRT,PILER-CR 40655-40686 32 MN183281 Microbacterium phage Vitas, complete genome 12790-12821 9 0.719
NC_020894_1 1.7|40655|32|NC_020894|CRT,PILER-CR 40655-40686 32 MH834604 Microbacterium phage Coltrane, complete genome 12790-12821 9 0.719
NC_020894_1 1.7|40655|32|NC_020894|CRT,PILER-CR 40655-40686 32 MH834596 Microbacterium phage Armstrong, complete genome 12790-12821 9 0.719
NC_020894_1 1.9|40777|32|NC_020894|CRT,PILER-CR 40777-40808 32 MN703407 Microbacterium phage Leaf, complete genome 65385-65416 9 0.719
NC_020894_1 1.9|40777|32|NC_020894|CRT,PILER-CR 40777-40808 32 MN703414 Microbacterium phage Dewdrop, complete genome 65385-65416 9 0.719
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_LR134467 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 25, complete sequence 74852-74883 9 0.719
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 981634-981665 9 0.719
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 34476-34507 9 0.719
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 487374-487405 9 0.719
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1325695-1325726 9 0.719
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1597692-1597723 9 0.719
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 1574874-1574905 9 0.719
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 451879-451910 9 0.719
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 96305-96336 9 0.719
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1279840-1279871 9 0.719
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1292618-1292649 9 0.719
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP031193 Humibacter sp. BT305 plasmid unnamed1 61677-61708 9 0.719
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 169661-169692 9 0.719
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 881936-881967 9 0.719
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 538826-538857 9 0.719
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 460407-460438 9 0.719
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 800789-800820 9 0.719
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 JX042579 Mycobacterium virus MacnCheese, complete genome 10038-10069 9 0.719
NC_020894_2 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT 51485-51516 32 NZ_CP052758 Cellulosimicrobium sp. BI34T plasmid pCPRO01, complete sequence 29860-29891 9 0.719
NC_020894_2 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT 51485-51516 32 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 283938-283969 9 0.719
NC_020894_2 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT 51485-51516 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 121167-121198 9 0.719
NC_020894_2 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT 51485-51516 32 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 414231-414262 9 0.719
NC_020894_3 3.3|51938|32|NC_020894|CRISPRCasFinder 51938-51969 32 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 1239371-1239402 9 0.719
NC_020894_3 3.3|51938|32|NC_020894|CRISPRCasFinder 51938-51969 32 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 1058204-1058235 9 0.719
NC_020894_3 3.4|51999|32|NC_020894|CRISPRCasFinder 51999-52030 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 540076-540107 9 0.719
NC_020894_3 3.4|51999|32|NC_020894|CRISPRCasFinder 51999-52030 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1364360-1364391 9 0.719
NC_020894_3 3.4|51999|32|NC_020894|CRISPRCasFinder 51999-52030 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 540085-540116 9 0.719
NC_020894_3 3.4|51999|32|NC_020894|CRISPRCasFinder 51999-52030 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 562871-562902 9 0.719
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1926251-1926282 9 0.719
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 459477-459508 9 0.719
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP011296 Rhodococcus erythropolis strain BG43 plasmid pRLCBG43, complete sequence 2246-2277 9 0.719
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 409523-409554 9 0.719
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 CP007645 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence 467810-467841 9 0.719
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 461127-461158 9 0.719
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_CP020716 Cnuibacter physcomitrellae strain XA(T) plasmid unnamed1, complete sequence 208472-208503 9 0.719
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 449877-449908 9 0.719
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1701673-1701704 9 0.719
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4628592-4628623 9 0.719
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_CP039425 Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence 120222-120253 9 0.719
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_CP039430 Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence 120220-120251 9 0.719
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 MN586026 Gordonia phage Leonard, complete genome 33738-33769 9 0.719
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NC_031112 Gordonia phage Phinally, complete genome 33735-33766 9 0.719
NC_020894_3 3.8|52243|32|NC_020894|CRISPRCasFinder 52243-52274 32 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 70380-70411 9 0.719
NC_020894_3 3.9|52304|32|NC_020894|CRISPRCasFinder 52304-52335 32 NZ_CP015095 Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence 43738-43769 9 0.719
NC_020894_3 3.10|52365|31|NC_020894|CRISPRCasFinder 52365-52395 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 462692-462722 9 0.71
NC_020894_3 3.10|52365|31|NC_020894|CRISPRCasFinder 52365-52395 31 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 383517-383547 9 0.71
NC_020894_3 3.14|51872|37|NC_020894|CRT 51872-51908 37 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 613916-613952 9 0.757
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 NZ_CP047896 Sphingomonas sp. C33 plasmid pC33, complete sequence 96140-96171 9 0.719
NC_020894_4 4.2|53070|32|NC_020894|CRISPRCasFinder 53070-53101 32 NZ_CP049142 Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence 164603-164634 9 0.719
NC_020894_5 5.1|54819|32|NC_020894|CRISPRCasFinder 54819-54850 32 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 389352-389383 9 0.719
NC_020894_6 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55226-55257 32 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 132038-132069 9 0.719
NC_020894_6 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55226-55257 32 NZ_CP026745 Nocardia cyriacigeorgica strain MDA3349 isolate MDA3349 ancestor plasmid p_unnamed, complete sequence 34420-34451 9 0.719
NC_020894_6 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55226-55257 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 225093-225124 9 0.719
NC_020894_6 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55226-55257 32 NZ_CP046917 Paraburkholderia sp. DHF22 plasmid p1, complete sequence 23364-23395 9 0.719
NC_020894_6 6.4|55409|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55409-55440 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 496639-496670 9 0.719
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 439388-439419 9 0.719
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 NZ_CP020948 Rhizobium sp. CIAT894 plasmid pRheCIAT894a, complete sequence 140625-140656 9 0.719
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 23630-23661 9 0.719
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 899231-899262 9 0.719
NC_020894_6 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT 55653-55684 32 NZ_CP022197 Celeribacter ethanolicus strain TSPH2 plasmid unnamed, complete sequence 52880-52911 9 0.719
NC_020894_6 6.9|55714|32|NC_020894|CRISPRCasFinder,CRT 55714-55745 32 NZ_CP010956 Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence 124184-124215 9 0.719
NC_020894_7 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT 55999-56030 32 NZ_CP032686 Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence 297623-297654 9 0.719
NC_020894_7 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT 55999-56030 32 NZ_CP032691 Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence 292602-292633 9 0.719
NC_020894_7 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT 55999-56030 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1752830-1752861 9 0.719
NC_020894_7 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 56243-56274 32 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 33539-33570 9 0.719
NC_020894_7 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 56243-56274 32 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 353751-353782 9 0.719
NC_020894_7 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 56243-56274 32 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 151356-151387 9 0.719
NC_020894_7 7.6|56304|31|NC_020894|CRISPRCasFinder,CRT 56304-56334 31 NZ_CP017427 Methylobacterium sp. XJLW plasmid unnamed1, complete sequence 150536-150566 9 0.71
NC_020894_7 7.6|56304|31|NC_020894|CRISPRCasFinder,CRT 56304-56334 31 NZ_CP045223 Achromobacter xylosoxidans strain DN002 plasmid unnamed 181457-181487 9 0.71
NC_020894_7 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT 56425-56456 32 NZ_CP022424 Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence 206558-206589 9 0.719
NC_020894_7 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT 56425-56456 32 MN310543 Microbacterium phage ChickenKing, complete genome 1474-1505 9 0.719
NC_020894_7 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT 56425-56456 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 302798-302829 9 0.719
NC_020894_7 7.9|56486|32|NC_020894|CRISPRCasFinder,CRT 56486-56517 32 NZ_CP016820 Rhodococcus sp. p52 plasmid pDF02, complete sequence 59711-59742 9 0.719
NC_020894_7 7.10|56547|32|NC_020894|CRISPRCasFinder,CRT 56547-56578 32 NZ_CP039694 Agrobacterium larrymoorei strain CFBP5473 plasmid pTiCFBP5473, complete sequence 338612-338643 9 0.719
NC_020894_7 7.12|56669|32|NC_020894|CRISPRCasFinder,CRT 56669-56700 32 NZ_CP040763 Paracoccus sp. 2251 plasmid unnamed4, complete sequence 166886-166917 9 0.719
NC_020894_7 7.14|56791|32|NC_020894|CRISPRCasFinder,CRT 56791-56822 32 NZ_CP010956 Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence 124184-124215 9 0.719
NC_020894_7 7.17|56426|32|NC_020894|PILER-CR 56426-56457 32 NZ_CP022424 Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence 206558-206589 9 0.719
NC_020894_7 7.17|56426|32|NC_020894|PILER-CR 56426-56457 32 MN310543 Microbacterium phage ChickenKing, complete genome 1474-1505 9 0.719
NC_020894_7 7.17|56426|32|NC_020894|PILER-CR 56426-56457 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 302798-302829 9 0.719
NC_020894_7 7.18|56487|32|NC_020894|PILER-CR 56487-56518 32 NZ_CP016820 Rhodococcus sp. p52 plasmid pDF02, complete sequence 59711-59742 9 0.719
NC_020894_7 7.19|56548|32|NC_020894|PILER-CR 56548-56579 32 NZ_CP039694 Agrobacterium larrymoorei strain CFBP5473 plasmid pTiCFBP5473, complete sequence 338612-338643 9 0.719
NC_020894_7 7.21|56670|32|NC_020894|PILER-CR 56670-56701 32 NZ_CP040763 Paracoccus sp. 2251 plasmid unnamed4, complete sequence 166886-166917 9 0.719
NC_020894_8 8.3|57198|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57198-57229 32 NZ_CP006368 Aureimonas sp. AU20 plasmid pAU20a, complete sequence 105695-105726 9 0.719
NC_020894_8 8.8|57504|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57504-57535 32 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 260105-260136 9 0.719
NC_020894_8 8.8|57504|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57504-57535 32 NC_009426 Novosphingobium aromaticivorans DSM 12444 plasmid pNL1, complete sequence 36069-36100 9 0.719
NC_020894_8 8.8|57504|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57504-57535 32 NZ_CP031116 Rubrobacter indicoceani strain SCSIO 08198 plasmid unnamed1, complete sequence 28488-28519 9 0.719
NC_020894_8 8.8|57504|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57504-57535 32 NC_002033 Novosphingobium aromaticivorans plasmid pNL1, complete sequence 163919-163950 9 0.719
NC_020894_8 8.9|57565|32|NC_020894|CRISPRCasFinder,CRT 57565-57596 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 205321-205352 9 0.719
NC_020894_8 8.9|57565|32|NC_020894|CRISPRCasFinder,CRT 57565-57596 32 NC_021347 Rhodococcus phage E3, complete genome 72124-72155 9 0.719
NC_020894_8 8.10|57626|32|NC_020894|CRISPRCasFinder 57626-57657 32 NZ_CP010956 Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence 124184-124215 9 0.719
NC_020894_9 9.1|57911|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57911-57942 32 MN234220 Gordonia phage Lambo, complete genome 56831-56862 9 0.719
NC_020894_9 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57972-58003 32 NZ_CP014682 Kozakia baliensis strain NBRC 16680 plasmid pKB16680_1, complete sequence 116478-116509 9 0.719
NC_020894_9 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57972-58003 32 NZ_CP014675 Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence 51614-51645 9 0.719
NC_020894_9 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 57972-58003 32 NC_047992 Microbacterium phage Zeta1847, complete genome 42922-42953 9 0.719
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NZ_CP024895 Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence 14995-15026 9 0.719
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 417985-418016 9 0.719
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NZ_CP035513 Haematobacter massiliensis strain OT1 plasmid pOT1-3, complete sequence 7967-7998 9 0.719
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NZ_CP042998 Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence 108549-108580 9 0.719
NC_020894_9 9.6|58215|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58215-58246 32 NZ_CP016821 Rhodococcus sp. p52 plasmid pDF01, complete sequence 158557-158588 9 0.719
NC_020894_9 9.7|58276|32|NC_020894|CRISPRCasFinder,CRT 58276-58307 32 KT898134 Aeromonas phage phiARM81mr, complete genome 51271-51302 9 0.719
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP032692 Rhizobium sp. CCGE532 plasmid pRCCGE532b, complete sequence 52659-52690 9 0.719
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP020444 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence 27237-27268 9 0.719
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NC_020061 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899b, complete sequence 52171-52202 9 0.719
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1030067-1030098 9 0.719
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 926779-926810 9 0.719
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 999011-999042 9 0.719
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 925876-925907 9 0.719
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 926771-926802 9 0.719
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 926801-926832 9 0.719
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 926762-926793 9 0.719
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1030160-1030191 9 0.719
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP011772 Croceicoccus naphthovorans strain PQ-2 plasmid p2, complete sequence 23275-23306 9 0.719
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1030156-1030187 9 0.719
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1030139-1030170 9 0.719
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 139859-139890 9 0.719
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 393754-393785 9 0.719
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 554855-554886 9 0.719
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 1098710-1098741 9 0.719
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 302895-302926 9 0.719
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 954470-954501 9 0.719
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_CP025584 Paracoccus jeotgali strain CBA4604 plasmid pCBA4604-01, complete sequence 10779-10810 9 0.719
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 374671-374702 9 0.719
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NC_048019 Gordonia phage Ruthy, complete genome 37027-37058 9 0.719
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 1227929-1227960 9 0.719
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 24502-24533 9 0.719
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP020568 Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence 79755-79786 9 0.719
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 CP040467 Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence 48372-48403 9 0.719
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 145178-145209 9 0.719
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 NZ_CP030830 Neorhizobium sp. NCHU2750 plasmid pNCHU2750c, complete sequence 94350-94381 9 0.719
NC_020894_9 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT 58642-58673 32 NZ_CP021373 Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence 139602-139633 9 0.719
NC_020894_9 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT 58703-58734 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 205310-205341 9 0.719
NC_020894_9 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT 58703-58734 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1161593-1161624 9 0.719
NC_020894_9 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT 58703-58734 32 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 39267-39298 9 0.719
NC_020894_1 1.5|40777|31|NC_020894|CRISPRCasFinder 40777-40807 31 NC_000867 Pseudoalteromonas phage PM2, complete genome 7211-7241 10 0.677
NC_020894_1 1.5|40777|31|NC_020894|CRISPRCasFinder 40777-40807 31 NC_042121 Pseudoalteromonas phage Cr39582, complete genome 7235-7265 10 0.677
NC_020894_1 1.5|40777|31|NC_020894|CRISPRCasFinder 40777-40807 31 AF155037 Alteromonas phage PM2, complete genome 7211-7241 10 0.677
NC_020894_1 1.5|40777|31|NC_020894|CRISPRCasFinder 40777-40807 31 M26134 Bacteriophage PM2 structural protein gene containing purine/pyrimidine rich regions and anti-Z-DNA-IgG binding regions, complete cds 1011-1041 10 0.677
NC_020894_1 1.6|40596|30|NC_020894|CRT 40596-40625 30 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 148338-148367 10 0.667
NC_020894_1 1.9|40777|32|NC_020894|CRT,PILER-CR 40777-40808 32 NZ_CP015204 Rhodococcus sp. 008 plasmid pR8C1, complete sequence 19597-19628 10 0.688
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 38580-38611 10 0.688
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 38579-38610 10 0.688
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_CP039913 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence 98932-98963 10 0.688
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_CP013109 Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence 383632-383663 10 0.688
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 167174-167205 10 0.688
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_CP024309 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3b, complete sequence 180118-180149 10 0.688
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_CP013053 Sinorhizobium americanum CCGM7 plasmid B, complete sequence 344522-344553 10 0.688
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 38578-38609 10 0.688
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NC_008757 Polaromonas naphthalenivorans CJ2 plasmid pPNAP01, complete sequence 50065-50096 10 0.688
NC_020894_2 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT 51241-51272 32 NC_007950 Polaromonas sp. JS666 plasmid 2, complete sequence 316975-317006 10 0.688
NC_020894_2 2.14|51546|32|NC_020894|CRT 51546-51577 32 MH450125 Arthrobacter phage MediumFry, complete genome 29228-29259 10 0.688
NC_020894_3 3.1|51816|32|NC_020894|CRISPRCasFinder 51816-51847 32 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 114174-114205 10 0.688
NC_020894_3 3.2|51877|32|NC_020894|CRISPRCasFinder 51877-51908 32 NZ_CP049358 Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence 194248-194279 10 0.688
NC_020894_3 3.3|51938|32|NC_020894|CRISPRCasFinder 51938-51969 32 NZ_KX443388 Rhodococcus hoagii strain PAM1216 plasmid pVAPA1216, complete sequence 15370-15401 10 0.688
NC_020894_3 3.3|51938|32|NC_020894|CRISPRCasFinder 51938-51969 32 NZ_KX443406 Rhodococcus hoagii strain PAM1413 plasmid pVAPB1413, complete sequence 14667-14698 10 0.688
NC_020894_3 3.3|51938|32|NC_020894|CRISPRCasFinder 51938-51969 32 NZ_KX443397 Rhodococcus hoagii strain PAM1475 plasmid pVAPB1475, complete sequence 14667-14698 10 0.688
NC_020894_3 3.3|51938|32|NC_020894|CRISPRCasFinder 51938-51969 32 NZ_KX443407 Rhodococcus hoagii strain PAM1533 plasmid PVAPB1533, complete sequence 14667-14698 10 0.688
NC_020894_3 3.3|51938|32|NC_020894|CRISPRCasFinder 51938-51969 32 NZ_CP027795 Rhodococcus hoagii strain DSSKP-R-001 plasmid plas2, complete sequence 72966-72997 10 0.688
NC_020894_3 3.3|51938|32|NC_020894|CRISPRCasFinder 51938-51969 32 NZ_CP041646 Rhodococcus hoagii strain WY plasmid pWY, complete sequence 15749-15780 10 0.688
NC_020894_3 3.3|51938|32|NC_020894|CRISPRCasFinder 51938-51969 32 NC_014247 Rhodococcus equi plasmid pVAPAMBE116, complete sequence 15385-15416 10 0.688
NC_020894_3 3.3|51938|32|NC_020894|CRISPRCasFinder 51938-51969 32 NZ_CP039433 Rhodococcus sp. SGAir0479 plasmid unnamed 48758-48789 10 0.688
NC_020894_3 3.3|51938|32|NC_020894|CRISPRCasFinder 51938-51969 32 NC_011150 Rhodococcus equi plasmid pVAPB1593, complete sequence 14735-14766 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 1001373-1001404 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_LR134445 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 3, complete sequence 36795-36826 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 465715-465746 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP011450 Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence 259233-259264 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 581734-581765 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 1015156-1015187 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 251532-251563 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 955847-955878 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 1054186-1054217 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 654120-654151 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 958695-958726 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 454233-454264 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 932816-932847 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 743418-743449 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 93087-93118 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 1431589-1431620 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 819002-819033 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 601554-601585 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 805893-805924 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 430084-430115 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 405901-405932 10 0.688
NC_020894_3 3.6|52121|32|NC_020894|CRISPRCasFinder 52121-52152 32 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 465375-465406 10 0.688
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 564474-564505 10 0.688
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_CP030841 Acidisarcina polymorpha strain SBC82 plasmid pACPOL1, complete sequence 40852-40883 10 0.688
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 697259-697290 10 0.688
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 564483-564514 10 0.688
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 587269-587300 10 0.688
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 560792-560823 10 0.688
NC_020894_3 3.11|52425|32|NC_020894|CRISPRCasFinder 52425-52456 32 NZ_CP032091 Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed1, complete sequence 509632-509663 10 0.688
NC_020894_3 3.13|51811|37|NC_020894|CRT 51811-51847 37 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 114174-114210 10 0.73
NC_020894_3 3.15|51933|37|NC_020894|CRT 51933-51969 37 NC_003903 Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence 126180-126216 10 0.73
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 NC_008010 Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence 290865-290896 10 0.688
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 567055-567086 10 0.688
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 217997-218028 10 0.688
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 NC_024995 Gluconacetobacter europaeus plasmid pGE3 genomic DNA, complete sequence, strain: KGMA0119 4701-4732 10 0.688
NC_020894_4 4.1|53009|32|NC_020894|CRISPRCasFinder 53009-53040 32 MN234170 Mycobacterium phage MalagasyRose, complete genome 10152-10183 10 0.688
NC_020894_4 4.2|53070|32|NC_020894|CRISPRCasFinder 53070-53101 32 NZ_CP048424 Rhizobium daejeonense strain KACC 13094 plasmid unnamed1, complete sequence 60538-60569 10 0.688
NC_020894_4 4.2|53070|32|NC_020894|CRISPRCasFinder 53070-53101 32 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 436931-436962 10 0.688
NC_020894_4 4.2|53070|32|NC_020894|CRISPRCasFinder 53070-53101 32 MN694806 Marine virus AFVG_250M690, complete genome 11731-11762 10 0.688
NC_020894_4 4.3|53131|32|NC_020894|CRISPRCasFinder 53131-53162 32 MN813693 Mycobacterium phage Imvubu, complete genome 52209-52240 10 0.688
NC_020894_6 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55226-55257 32 NZ_CP012899 Burkholderia sp. CCGE1001 plasmid pCCGE1001a, complete sequence 24678-24709 10 0.688
NC_020894_6 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55226-55257 32 NC_018696 Paraburkholderia phenoliruptrix BR3459a plasmid pSYMBR3459, complete sequence 538735-538766 10 0.688
NC_020894_6 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 55226-55257 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 255464-255495 10 0.688
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1210963-1210994 10 0.688
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 NC_018023 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.02, complete sequence 116413-116444 10 0.688
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 NZ_CP030828 Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence 693032-693063 10 0.688
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 NZ_CP016821 Rhodococcus sp. p52 plasmid pDF01, complete sequence 112956-112987 10 0.688
NC_020894_6 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT 55592-55623 32 KT287080 Enterobacter phage phiEap-2, complete genome 38234-38265 10 0.688
NC_020894_6 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT 55653-55684 32 NZ_LR723674 Rhizobium flavum strain YW14 plasmid 5 29478-29509 10 0.688
NC_020894_7 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 56243-56274 32 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 180333-180364 10 0.688
NC_020894_7 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 56243-56274 32 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 177627-177658 10 0.688
NC_020894_7 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT 56425-56456 32 NZ_CP033024 Agrobacterium fabrum strain 1D132 plasmid pAt1D132a, complete sequence 281454-281485 10 0.688
NC_020894_7 7.17|56426|32|NC_020894|PILER-CR 56426-56457 32 NZ_CP033024 Agrobacterium fabrum strain 1D132 plasmid pAt1D132a, complete sequence 281454-281485 10 0.688
NC_020894_8 8.3|57198|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57198-57229 32 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 231233-231264 10 0.688
NC_020894_8 8.5|57321|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 57321-57352 32 KY676784 Streptomyces phage ToastyFinz, complete genome 9273-9304 10 0.688
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NZ_CP015090 Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence 127399-127430 10 0.688
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NC_015952 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence 76829-76860 10 0.688
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NC_011667 Thauera sp. MZ1T plasmid pTha01, complete sequence 42061-42092 10 0.688
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 136303-136334 10 0.688
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1234829-1234860 10 0.688
NC_020894_9 9.7|58276|32|NC_020894|CRISPRCasFinder,CRT 58276-58307 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1085136-1085167 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 329193-329224 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP021027 Rhizobium sp. TAL182 plasmid pRetTAL182c, complete sequence 230519-230550 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013633 Rhizobium sp. N324 plasmid pRspN324c, complete sequence 237679-237710 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013555 Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence 258497-258528 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 258885-258916 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013587 Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence 206042-206073 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013598 Rhizobium sp. N741 plasmid pRspN741c, complete sequence 244273-244304 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013561 Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence 239948-239979 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013578 Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence 263443-263474 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013550 Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence 228424-228455 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013530 Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence 228423-228454 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013535 Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence 228424-228455 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013540 Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence 247954-247985 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013544 Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence 176010-176041 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013566 Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence 258498-258529 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013502 Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence 244195-244226 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013583 Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence 228423-228454 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013508 Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence 244273-244304 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013519 Rhizobium sp. N113 plasmid pRspN113b, complete sequence 244272-244303 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013572 Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence 263443-263474 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP021125 Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence 232244-232275 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013492 Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence 246835-246866 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013514 Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence 239948-239979 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013497 Rhizobium sp. N621 plasmid pRspN621b, complete sequence 246835-246866 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013592 Rhizobium sp. N871 plasmid pRspN871b, complete sequence 244195-244226 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 CP007643 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence 290680-290711 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 225242-225273 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP013604 Rhizobium sp. N731 plasmid pRspN731c, complete sequence 239950-239981 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP017243 Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence 223925-223956 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP034999 Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence 453158-453189 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 249431-249462 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 133402-133433 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 539014-539045 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 NC_021780 Salmonella phage FSL SP-088, complete genome 58221-58252 10 0.688
NC_020894_9 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT 58337-58368 32 KC139515 Salmonella phage FSL SP-124, complete genome 57978-58009 10 0.688
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 MK373789 Escherichia phage vB_EcoS_PTXU06, complete genome 31823-31854 10 0.688
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 304966-304997 10 0.688
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 368776-368807 10 0.688
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1532276-1532307 10 0.688
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1651501-1651532 10 0.688
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1651447-1651478 10 0.688
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 979431-979462 10 0.688
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 366419-366450 10 0.688
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 173028-173059 10 0.688
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP038031 Rhodococcus ruber strain R1 plasmid unnamed1, complete sequence 138464-138495 10 0.688
NC_020894_9 9.11|58520|32|NC_020894|CRISPRCasFinder,CRT 58520-58551 32 NZ_CP015090 Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence 45302-45333 10 0.688
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 330314-330345 10 0.688
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 41837-41868 10 0.688
NC_020894_9 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT 58703-58734 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 993400-993431 10 0.688
NC_020894_9 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT 58703-58734 32 NZ_CP049813 Monaibacterium sp. ALG8 plasmid unnamed2, complete sequence 8128-8159 10 0.688
NC_020894_1 1.9|40777|32|NC_020894|CRT,PILER-CR 40777-40808 32 NC_000867 Pseudoalteromonas phage PM2, complete genome 7211-7242 11 0.656
NC_020894_1 1.9|40777|32|NC_020894|CRT,PILER-CR 40777-40808 32 M26134 Bacteriophage PM2 structural protein gene containing purine/pyrimidine rich regions and anti-Z-DNA-IgG binding regions, complete cds 1010-1041 11 0.656
NC_020894_1 1.9|40777|32|NC_020894|CRT,PILER-CR 40777-40808 32 NC_042121 Pseudoalteromonas phage Cr39582, complete genome 7235-7266 11 0.656
NC_020894_1 1.9|40777|32|NC_020894|CRT,PILER-CR 40777-40808 32 AF155037 Alteromonas phage PM2, complete genome 7211-7242 11 0.656
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NC_011003 Burkholderia cenocepacia J2315 plasmid pBCJ2315, complete sequence 30192-30223 11 0.656
NC_020894_2 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50875-50906 32 NZ_CP011506 Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence 108453-108484 11 0.656
NC_020894_2 2.4|50936|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 50936-50967 32 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 350916-350947 11 0.656
NC_020894_2 2.7|51119|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 51119-51150 32 NC_012521 Rhodococcus opacus B4 plasmid pROB02, complete sequence 22348-22379 11 0.656
NC_020894_2 2.14|51546|32|NC_020894|CRT 51546-51577 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 118610-118641 11 0.656
NC_020894_3 3.7|52182|32|NC_020894|CRISPRCasFinder 52182-52213 32 NZ_AP022566 Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence 183008-183039 11 0.656
NC_020894_3 3.14|51872|37|NC_020894|CRT 51872-51908 37 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1786335-1786371 11 0.703
NC_020894_3 3.16|51994|37|NC_020894|CRT 51994-52030 37 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 427262-427298 11 0.703
NC_020894_7 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT 55999-56030 32 NC_015409 Verrucosispora maris AB-18-032 plasmid pVMKU, complete sequence 46207-46238 11 0.656
NC_020894_7 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR 56243-56274 32 NZ_CP022193 Yangia pacifica strain YSBP01 plasmid unnamed3, complete sequence 11117-11148 11 0.656
NC_020894_9 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT 58033-58064 32 AP017627 Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome 65013-65044 11 0.656
NC_020894_9 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT 58398-58429 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1346326-1346357 11 0.656
NC_020894_9 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT 58459-58490 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 827375-827406 11 0.656
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 631444-631475 11 0.656
NC_020894_9 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT 58581-58612 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1997082-1997113 11 0.656

1. spacer 1.1|40535|31|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

acccaccacaccccgagccgactggccgggg	CRISPR spacer
acccaccacaccccgagccgactggccgggg	Protospacer
*******************************

2. spacer 1.1|40535|31|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

acccaccacaccccgagccgactggccgggg	CRISPR spacer
acccaccacaccccgagccgactggccgggg	Protospacer
*******************************

3. spacer 1.2|40596|29|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcgggctcaccggccgcgatgacct	CRISPR spacer
cgtggcgggctcaccggccgcgatgacct	Protospacer
*****************************

4. spacer 1.2|40596|29|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcgggctcaccggccgcgatgacct	CRISPR spacer
cgtggcgggctcaccggccgcgatgacct	Protospacer
*****************************

5. spacer 1.3|40655|31|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

agtgcctcgaagacgagggtggaggctgcgg	CRISPR spacer
agtgcctcgaagacgagggtggaggctgcgg	Protospacer
*******************************

6. spacer 1.3|40655|31|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

agtgcctcgaagacgagggtggaggctgcgg	CRISPR spacer
agtgcctcgaagacgagggtggaggctgcgg	Protospacer
*******************************

7. spacer 1.4|40716|31|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cgggttgcgggggcgtggatggtcgtggtca	CRISPR spacer
cgggttgcgggggcgtggatggtcgtggtca	Protospacer
*******************************

8. spacer 1.4|40716|31|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cgggttgcgggggcgtggatggtcgtggtca	CRISPR spacer
cgggttgcgggggcgtggatggtcgtggtca	Protospacer
*******************************

9. spacer 1.5|40777|31|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cttcttggcggccttgttgatgcgcttcttg	CRISPR spacer
cttcttggcggccttgttgatgcgcttcttg	Protospacer
*******************************

10. spacer 1.5|40777|31|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cttcttggcggccttgttgatgcgcttcttg	CRISPR spacer
cttcttggcggccttgttgatgcgcttcttg	Protospacer
*******************************

11. spacer 1.6|40596|30|NC_020894|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcgggctcaccggccgcgatgacctc	CRISPR spacer
cgtggcgggctcaccggccgcgatgacctc	Protospacer
******************************

12. spacer 1.6|40596|30|NC_020894|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcgggctcaccggccgcgatgacctc	CRISPR spacer
cgtggcgggctcaccggccgcgatgacctc	Protospacer
******************************

13. spacer 1.7|40655|32|NC_020894|CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

agtgcctcgaagacgagggtggaggctgcggc	CRISPR spacer
agtgcctcgaagacgagggtggaggctgcggc	Protospacer
********************************

14. spacer 1.7|40655|32|NC_020894|CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

agtgcctcgaagacgagggtggaggctgcggc	CRISPR spacer
agtgcctcgaagacgagggtggaggctgcggc	Protospacer
********************************

15. spacer 1.8|40716|32|NC_020894|CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cgggttgcgggggcgtggatggtcgtggtcat	CRISPR spacer
cgggttgcgggggcgtggatggtcgtggtcat	Protospacer
********************************

16. spacer 1.8|40716|32|NC_020894|CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cgggttgcgggggcgtggatggtcgtggtcat	CRISPR spacer
cgggttgcgggggcgtggatggtcgtggtcat	Protospacer
********************************

17. spacer 1.9|40777|32|NC_020894|CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cttcttggcggccttgttgatgcgcttcttgt	CRISPR spacer
cttcttggcggccttgttgatgcgcttcttgt	Protospacer
********************************

18. spacer 1.9|40777|32|NC_020894|CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cttcttggcggccttgttgatgcgcttcttgt	CRISPR spacer
cttcttggcggccttgttgatgcgcttcttgt	Protospacer
********************************

19. spacer 2.1|50753|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcctggttagcgtcgacgttactttcgaggt	CRISPR spacer
cgcctggttagcgtcgacgttactttcgaggt	Protospacer
********************************

20. spacer 2.1|50753|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cgcctggttagcgtcgacgttactttcgaggt	CRISPR spacer
cgcctggttagcgtcgacgttactttcgaggt	Protospacer
********************************

21. spacer 2.2|50814|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cggtgctagagccgcccccactacccactacc	CRISPR spacer
cggtgctagagccgcccccactacccactacc	Protospacer
********************************

22. spacer 2.2|50814|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cggtgctagagccgcccccactacccactacc	CRISPR spacer
cggtgctagagccgcccccactacccactacc	Protospacer
********************************

23. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
tgttgcaggcgacggcgcaggagatcgtggct	Protospacer
********************************

24. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
tgttgcaggcgacggcgcaggagatcgtggct	Protospacer
********************************

25. spacer 2.4|50936|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gtcacacaggtgatcaggaccgtcttcctcgc	CRISPR spacer
gtcacacaggtgatcaggaccgtcttcctcgc	Protospacer
********************************

26. spacer 2.4|50936|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gtcacacaggtgatcaggaccgtcttcctcgc	CRISPR spacer
gtcacacaggtgatcaggaccgtcttcctcgc	Protospacer
********************************

27. spacer 2.5|50997|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

agcatcgatcgcaagccgtgctcgaagcgccg	CRISPR spacer
agcatcgatcgcaagccgtgctcgaagcgccg	Protospacer
********************************

28. spacer 2.5|50997|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

agcatcgatcgcaagccgtgctcgaagcgccg	CRISPR spacer
agcatcgatcgcaagccgtgctcgaagcgccg	Protospacer
********************************

29. spacer 2.6|51058|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cccacgaagcccccgtccgagtctgggcgggg	CRISPR spacer
cccacgaagcccccgtccgagtctgggcgggg	Protospacer
********************************

30. spacer 2.6|51058|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cccacgaagcccccgtccgagtctgggcgggg	CRISPR spacer
cccacgaagcccccgtccgagtctgggcgggg	Protospacer
********************************

31. spacer 2.6|51058|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cccacgaagcccccgtccgagtctgggcgggg	CRISPR spacer
cccacgaagcccccgtccgagtctgggcgggg	Protospacer
********************************

32. spacer 2.6|51058|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cccacgaagcccccgtccgagtctgggcgggg	CRISPR spacer
cccacgaagcccccgtccgagtctgggcgggg	Protospacer
********************************

33. spacer 2.7|51119|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cagctcggcgcgcaggaacggtccgggctgcg	CRISPR spacer
cagctcggcgcgcaggaacggtccgggctgcg	Protospacer
********************************

34. spacer 2.7|51119|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cagctcggcgcgcaggaacggtccgggctgcg	CRISPR spacer
cagctcggcgcgcaggaacggtccgggctgcg	Protospacer
********************************

35. spacer 2.8|51180|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cagtccaggccgtccttgatgtgaccgaccgt	CRISPR spacer
cagtccaggccgtccttgatgtgaccgaccgt	Protospacer
********************************

36. spacer 2.8|51180|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cagtccaggccgtccttgatgtgaccgaccgt	CRISPR spacer
cagtccaggccgtccttgatgtgaccgaccgt	Protospacer
********************************

37. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gaggtgaggctcgtcggccagggcgccggcaa	Protospacer
********************************

38. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gaggtgaggctcgtcggccagggcgccggcaa	Protospacer
********************************

39. spacer 2.10|51302|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cagcgtcccggaccgtgcaagatgccccagtc	CRISPR spacer
cagcgtcccggaccgtgcaagatgccccagtc	Protospacer
********************************

40. spacer 2.10|51302|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cagcgtcccggaccgtgcaagatgccccagtc	CRISPR spacer
cagcgtcccggaccgtgcaagatgccccagtc	Protospacer
********************************

41. spacer 2.11|51363|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

acaccccaccccatccacagcagtcaggaaga	CRISPR spacer
acaccccaccccatccacagcagtcaggaaga	Protospacer
********************************

42. spacer 2.11|51363|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

acaccccaccccatccacagcagtcaggaaga	CRISPR spacer
acaccccaccccatccacagcagtcaggaaga	Protospacer
********************************

43. spacer 2.12|51424|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gagtccgggctgtgggcgttgaagggctacaa	CRISPR spacer
gagtccgggctgtgggcgttgaagggctacaa	Protospacer
********************************

44. spacer 2.12|51424|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gagtccgggctgtgggcgttgaagggctacaa	CRISPR spacer
gagtccgggctgtgggcgttgaagggctacaa	Protospacer
********************************

45. spacer 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gtcgacgtcgcgttcgtgccgcgctccgcgtt	CRISPR spacer
gtcgacgtcgcgttcgtgccgcgctccgcgtt	Protospacer
********************************

46. spacer 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gtcgacgtcgcgttcgtgccgcgctccgcgtt	CRISPR spacer
gtcgacgtcgcgttcgtgccgcgctccgcgtt	Protospacer
********************************

47. spacer 2.14|51546|32|NC_020894|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ccttgaccttgtcgaccttcatctcgaacagg	CRISPR spacer
ccttgaccttgtcgaccttcatctcgaacagg	Protospacer
********************************

48. spacer 2.14|51546|32|NC_020894|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ccttgaccttgtcgaccttcatctcgaacagg	CRISPR spacer
ccttgaccttgtcgaccttcatctcgaacagg	Protospacer
********************************

49. spacer 3.1|51816|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccctgccccgcctgagcgcgaacgtgccg	CRISPR spacer
ccgccctgccccgcctgagcgcgaacgtgccg	Protospacer
********************************

50. spacer 3.1|51816|32|NC_020894|CRISPRCasFinder matches to NZ_CP009439 (Streptomyces glaucescens strain GLA.O plasmid pSglau1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccctgccccgcctgagcgcgaacgtgccg	CRISPR spacer
ccgccctgccccgcctgagcgcgaacgtgccg	Protospacer
********************************

51. spacer 3.1|51816|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccctgccccgcctgagcgcgaacgtgccg	CRISPR spacer
ccgccctgccccgcctgagcgcgaacgtgccg	Protospacer
********************************

52. spacer 3.2|51877|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

tgcgggaggccatccgccgcgctgtctgtgag	CRISPR spacer
tgcgggaggccatccgccgcgctgtctgtgag	Protospacer
********************************

53. spacer 3.2|51877|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

tgcgggaggccatccgccgcgctgtctgtgag	CRISPR spacer
tgcgggaggccatccgccgcgctgtctgtgag	Protospacer
********************************

54. spacer 3.3|51938|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

agttgcagacgctcccgctcgccgctcaccag	CRISPR spacer
agttgcagacgctcccgctcgccgctcaccag	Protospacer
********************************

55. spacer 3.3|51938|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

agttgcagacgctcccgctcgccgctcaccag	CRISPR spacer
agttgcagacgctcccgctcgccgctcaccag	Protospacer
********************************

56. spacer 3.4|51999|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cccgccgcgctcgccctggccactctgggcat	CRISPR spacer
cccgccgcgctcgccctggccactctgggcat	Protospacer
********************************

57. spacer 3.4|51999|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cccgccgcgctcgccctggccactctgggcat	CRISPR spacer
cccgccgcgctcgccctggccactctgggcat	Protospacer
********************************

58. spacer 3.5|52060|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

accgtccagtccaagtacacagctccctaccg	CRISPR spacer
accgtccagtccaagtacacagctccctaccg	Protospacer
********************************

59. spacer 3.5|52060|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

accgtccagtccaagtacacagctccctaccg	CRISPR spacer
accgtccagtccaagtacacagctccctaccg	Protospacer
********************************

60. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
ctgaacttcggcaaggcggtcggtgcacgctg	Protospacer
********************************

61. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
ctgaacttcggcaaggcggtcggtgcacgctg	Protospacer
********************************

62. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
caggcggcgcgcaccgtcgccgacacccacga	Protospacer
********************************

63. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
caggcggcgcgcaccgtcgccgacacccacga	Protospacer
********************************

64. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
caggcggcgcgcaccgtcgccgacacccacga	Protospacer
********************************

65. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 0, identity: 1.0

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
caggcggcgcgcaccgtcgccgacacccacga	Protospacer
********************************

66. spacer 3.8|52243|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gagctgtgcaccgccacgatcaacgaccgacg	CRISPR spacer
gagctgtgcaccgccacgatcaacgaccgacg	Protospacer
********************************

67. spacer 3.8|52243|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gagctgtgcaccgccacgatcaacgaccgacg	CRISPR spacer
gagctgtgcaccgccacgatcaacgaccgacg	Protospacer
********************************

68. spacer 3.9|52304|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtactcgcgtcaaggcgcgcgggtcaggcgt	CRISPR spacer
ggtactcgcgtcaaggcgcgcgggtcaggcgt	Protospacer
********************************

69. spacer 3.9|52304|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtactcgcgtcaaggcgcgcgggtcaggcgt	CRISPR spacer
ggtactcgcgtcaaggcgcgcgggtcaggcgt	Protospacer
********************************

70. spacer 3.10|52365|31|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
ccgccaacgtggtggccgaacggctgcgccc	Protospacer
*******************************

71. spacer 3.10|52365|31|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
ccgccaacgtggtggccgaacggctgcgccc	Protospacer
*******************************

72. spacer 3.11|52425|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

tggcggtgcatgcccgtgctcaccggcgccag	CRISPR spacer
tggcggtgcatgcccgtgctcaccggcgccag	Protospacer
********************************

73. spacer 3.11|52425|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

tggcggtgcatgcccgtgctcaccggcgccag	CRISPR spacer
tggcggtgcatgcccgtgctcaccggcgccag	Protospacer
********************************

74. spacer 3.12|52486|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gataccagcaatctctgtgagtcggcgtcccg	CRISPR spacer
gataccagcaatctctgtgagtcggcgtcccg	Protospacer
********************************

75. spacer 3.12|52486|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gataccagcaatctctgtgagtcggcgtcccg	CRISPR spacer
gataccagcaatctctgtgagtcggcgtcccg	Protospacer
********************************

76. spacer 3.13|51811|37|NC_020894|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

atccgccgccctgccccgcctgagcgcgaacgtgccg	CRISPR spacer
atccgccgccctgccccgcctgagcgcgaacgtgccg	Protospacer
*************************************

77. spacer 3.13|51811|37|NC_020894|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

atccgccgccctgccccgcctgagcgcgaacgtgccg	CRISPR spacer
atccgccgccctgccccgcctgagcgcgaacgtgccg	Protospacer
*************************************

78. spacer 3.14|51872|37|NC_020894|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

atccctgcgggaggccatccgccgcgctgtctgtgag	CRISPR spacer
atccctgcgggaggccatccgccgcgctgtctgtgag	Protospacer
*************************************

79. spacer 3.14|51872|37|NC_020894|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

atccctgcgggaggccatccgccgcgctgtctgtgag	CRISPR spacer
atccctgcgggaggccatccgccgcgctgtctgtgag	Protospacer
*************************************

80. spacer 3.15|51933|37|NC_020894|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

atcccagttgcagacgctcccgctcgccgctcaccag	CRISPR spacer
atcccagttgcagacgctcccgctcgccgctcaccag	Protospacer
*************************************

81. spacer 3.15|51933|37|NC_020894|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

atcccagttgcagacgctcccgctcgccgctcaccag	CRISPR spacer
atcccagttgcagacgctcccgctcgccgctcaccag	Protospacer
*************************************

82. spacer 3.16|51994|37|NC_020894|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

atccccccgccgcgctcgccctggccactctgggcat	CRISPR spacer
atccccccgccgcgctcgccctggccactctgggcat	Protospacer
*************************************

83. spacer 3.16|51994|37|NC_020894|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

atccccccgccgcgctcgccctggccactctgggcat	CRISPR spacer
atccccccgccgcgctcgccctggccactctgggcat	Protospacer
*************************************

84. spacer 3.17|52055|37|NC_020894|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

atcccaccgtccagtccaagtacacagctccctaccg	CRISPR spacer
atcccaccgtccagtccaagtacacagctccctaccg	Protospacer
*************************************

85. spacer 3.17|52055|37|NC_020894|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

atcccaccgtccagtccaagtacacagctccctaccg	CRISPR spacer
atcccaccgtccagtccaagtacacagctccctaccg	Protospacer
*************************************

86. spacer 3.18|52116|37|NC_020894|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

atcccctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
atcccctgaacttcggcaaggcggtcggtgcacgctg	Protospacer
*************************************

87. spacer 3.18|52116|37|NC_020894|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

atcccctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
atcccctgaacttcggcaaggcggtcggtgcacgctg	Protospacer
*************************************

88. spacer 3.19|52177|37|NC_020894|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

atccccaggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
atccccaggcggcgcgcaccgtcgccgacacccacga	Protospacer
*************************************

89. spacer 3.19|52177|37|NC_020894|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

atccccaggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
atccccaggcggcgcgcaccgtcgccgacacccacga	Protospacer
*************************************

90. spacer 3.20|52238|37|NC_020894|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

atcccgagctgtgcaccgccacgatcaacgaccgacg	CRISPR spacer
atcccgagctgtgcaccgccacgatcaacgaccgacg	Protospacer
*************************************

91. spacer 3.20|52238|37|NC_020894|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

atcccgagctgtgcaccgccacgatcaacgaccgacg	CRISPR spacer
atcccgagctgtgcaccgccacgatcaacgaccgacg	Protospacer
*************************************

92. spacer 3.21|52299|37|NC_020894|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gtcccggtactcgcgtcaaggcgcgcgggtcaggcgt	CRISPR spacer
gtcccggtactcgcgtcaaggcgcgcgggtcaggcgt	Protospacer
*************************************

93. spacer 3.21|52299|37|NC_020894|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gtcccggtactcgcgtcaaggcgcgcgggtcaggcgt	CRISPR spacer
gtcccggtactcgcgtcaaggcgcgcgggtcaggcgt	Protospacer
*************************************

94. spacer 3.22|52360|36|NC_020894|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

tcccaccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
tcccaccgccaacgtggtggccgaacggctgcgccc	Protospacer
************************************

95. spacer 3.22|52360|36|NC_020894|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

tcccaccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
tcccaccgccaacgtggtggccgaacggctgcgccc	Protospacer
************************************

96. spacer 3.23|52420|37|NC_020894|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gtccctggcggtgcatgcccgtgctcaccggcgccag	CRISPR spacer
gtccctggcggtgcatgcccgtgctcaccggcgccag	Protospacer
*************************************

97. spacer 3.23|52420|37|NC_020894|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gtccctggcggtgcatgcccgtgctcaccggcgccag	CRISPR spacer
gtccctggcggtgcatgcccgtgctcaccggcgccag	Protospacer
*************************************

98. spacer 3.24|52481|37|NC_020894|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gccccgataccagcaatctctgtgagtcggcgtcccg	CRISPR spacer
gccccgataccagcaatctctgtgagtcggcgtcccg	Protospacer
*************************************

99. spacer 3.24|52481|37|NC_020894|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gccccgataccagcaatctctgtgagtcggcgtcccg	CRISPR spacer
gccccgataccagcaatctctgtgagtcggcgtcccg	Protospacer
*************************************

100. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
ggtcaggaacgcggccacaccgacgccccgaa	Protospacer
********************************

101. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
ggtcaggaacgcggccacaccgacgccccgaa	Protospacer
********************************

102. spacer 4.2|53070|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gtcttctcgatcatctcgtccgtgttcaccgc	CRISPR spacer
gtcttctcgatcatctcgtccgtgttcaccgc	Protospacer
********************************

103. spacer 4.2|53070|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gtcttctcgatcatctcgtccgtgttcaccgc	CRISPR spacer
gtcttctcgatcatctcgtccgtgttcaccgc	Protospacer
********************************

104. spacer 4.3|53131|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagggaccgcgtcgtcagcggccacaccccg	CRISPR spacer
ccagggaccgcgtcgtcagcggccacaccccg	Protospacer
********************************

105. spacer 4.3|53131|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagggaccgcgtcgtcagcggccacaccccg	CRISPR spacer
ccagggaccgcgtcgtcagcggccacaccccg	Protospacer
********************************

106. spacer 5.1|54819|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

aagtacggcggatacgcgtacgggtccgatcc	CRISPR spacer
aagtacggcggatacgcgtacgggtccgatcc	Protospacer
********************************

107. spacer 5.1|54819|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

aagtacggcggatacgcgtacgggtccgatcc	CRISPR spacer
aagtacggcggatacgcgtacgggtccgatcc	Protospacer
********************************

108. spacer 5.2|54880|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ggagcattgccatgctcaagatcgaggtgaag	CRISPR spacer
ggagcattgccatgctcaagatcgaggtgaag	Protospacer
********************************

109. spacer 5.2|54880|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ggagcattgccatgctcaagatcgaggtgaag	CRISPR spacer
ggagcattgccatgctcaagatcgaggtgaag	Protospacer
********************************

110. spacer 5.3|54941|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cgggcccggtcaccttccagtccctcgtccaa	CRISPR spacer
cgggcccggtcaccttccagtccctcgtccaa	Protospacer
********************************

111. spacer 5.3|54941|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cgggcccggtcaccttccagtccctcgtccaa	CRISPR spacer
cgggcccggtcaccttccagtccctcgtccaa	Protospacer
********************************

112. spacer 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgctcagctcgcaccgccgggcggcgcggac	CRISPR spacer
ccgctcagctcgcaccgccgggcggcgcggac	Protospacer
********************************

113. spacer 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgctcagctcgcaccgccgggcggcgcggac	CRISPR spacer
ccgctcagctcgcaccgccgggcggcgcggac	Protospacer
********************************

114. spacer 6.2|55287|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ccatcagtactcccgacagagcccaccggttc	CRISPR spacer
ccatcagtactcccgacagagcccaccggttc	Protospacer
********************************

115. spacer 6.2|55287|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ccatcagtactcccgacagagcccaccggttc	CRISPR spacer
ccatcagtactcccgacagagcccaccggttc	Protospacer
********************************

116. spacer 6.3|55348|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgggtgccaatgtccttgctcatcaggggtt	CRISPR spacer
gcgggtgccaatgtccttgctcatcaggggtt	Protospacer
********************************

117. spacer 6.3|55348|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgggtgccaatgtccttgctcatcaggggtt	CRISPR spacer
gcgggtgccaatgtccttgctcatcaggggtt	Protospacer
********************************

118. spacer 6.4|55409|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gacatgcgctcgcccctggaacggcaagggcg	CRISPR spacer
gacatgcgctcgcccctggaacggcaagggcg	Protospacer
********************************

119. spacer 6.4|55409|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gacatgcgctcgcccctggaacggcaagggcg	CRISPR spacer
gacatgcgctcgcccctggaacggcaagggcg	Protospacer
********************************

120. spacer 6.5|55470|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

caggtgcgtgcacggcgcgtgcagtgggccgg	CRISPR spacer
caggtgcgtgcacggcgcgtgcagtgggccgg	Protospacer
********************************

121. spacer 6.5|55470|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

caggtgcgtgcacggcgcgtgcagtgggccgg	CRISPR spacer
caggtgcgtgcacggcgcgtgcagtgggccgg	Protospacer
********************************

122. spacer 6.6|55531|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

aaggtgacgagctggcccggcctgctcgccgt	CRISPR spacer
aaggtgacgagctggcccggcctgctcgccgt	Protospacer
********************************

123. spacer 6.6|55531|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

aaggtgacgagctggcccggcctgctcgccgt	CRISPR spacer
aaggtgacgagctggcccggcctgctcgccgt	Protospacer
********************************

124. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
cagttcatcgtcggcgtccgccaggacatcac	Protospacer
********************************

125. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
cagttcatcgtcggcgtccgccaggacatcac	Protospacer
********************************

126. spacer 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gacaccctcggctacaaccagttcgccaccaa	CRISPR spacer
gacaccctcggctacaaccagttcgccaccaa	Protospacer
********************************

127. spacer 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gacaccctcggctacaaccagttcgccaccaa	CRISPR spacer
gacaccctcggctacaaccagttcgccaccaa	Protospacer
********************************

128. spacer 6.9|55714|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ggggcacccttcgctgtcggcagcgtctggac	CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac	Protospacer
********************************

129. spacer 6.9|55714|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ggggcacccttcgctgtcggcagcgtctggac	CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac	Protospacer
********************************

130. spacer 6.9|55714|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ggggcacccttcgctgtcggcagcgtctggac	CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac	Protospacer
********************************

131. spacer 6.9|55714|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ggggcacccttcgctgtcggcagcgtctggac	CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac	Protospacer
********************************

132. spacer 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcgacgggttcgccgagaaggtgctacaccc	CRISPR spacer
ctcgacgggttcgccgagaaggtgctacaccc	Protospacer
********************************

133. spacer 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcgacgggttcgccgagaaggtgctacaccc	CRISPR spacer
ctcgacgggttcgccgagaaggtgctacaccc	Protospacer
********************************

134. spacer 7.2|56060|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cccatggcttggttcaaggacgtggacctgga	CRISPR spacer
cccatggcttggttcaaggacgtggacctgga	Protospacer
********************************

135. spacer 7.2|56060|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cccatggcttggttcaaggacgtggacctgga	CRISPR spacer
cccatggcttggttcaaggacgtggacctgga	Protospacer
********************************

136. spacer 7.3|56121|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cccactctggcactgtttcaggccattgcgta	CRISPR spacer
cccactctggcactgtttcaggccattgcgta	Protospacer
********************************

137. spacer 7.3|56121|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cccactctggcactgtttcaggccattgcgta	CRISPR spacer
cccactctggcactgtttcaggccattgcgta	Protospacer
********************************

138. spacer 7.4|56182|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gacttcccgcgaaagtgttgcgaacctagggt	CRISPR spacer
gacttcccgcgaaagtgttgcgaacctagggt	Protospacer
********************************

139. spacer 7.4|56182|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gacttcccgcgaaagtgttgcgaacctagggt	CRISPR spacer
gacttcccgcgaaagtgttgcgaacctagggt	Protospacer
********************************

140. spacer 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

tccggtcgtgcacgactgcgccgactgcggac	CRISPR spacer
tccggtcgtgcacgactgcgccgactgcggac	Protospacer
********************************

141. spacer 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

tccggtcgtgcacgactgcgccgactgcggac	CRISPR spacer
tccggtcgtgcacgactgcgccgactgcggac	Protospacer
********************************

142. spacer 7.6|56304|31|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gccacaatcgcgacctgttcgagaacaaggc	CRISPR spacer
gccacaatcgcgacctgttcgagaacaaggc	Protospacer
*******************************

143. spacer 7.6|56304|31|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gccacaatcgcgacctgttcgagaacaaggc	CRISPR spacer
gccacaatcgcgacctgttcgagaacaaggc	Protospacer
*******************************

144. spacer 7.7|56364|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gctcctaggtggggtgcccgccggggacgtgg	CRISPR spacer
gctcctaggtggggtgcccgccggggacgtgg	Protospacer
********************************

145. spacer 7.7|56364|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gctcctaggtggggtgcccgccggggacgtgg	CRISPR spacer
gctcctaggtggggtgcccgccggggacgtgg	Protospacer
********************************

146. spacer 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
cacgctgggacctcaccctcggcgcggcctcc	Protospacer
********************************

147. spacer 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
cacgctgggacctcaccctcggcgcggcctcc	Protospacer
********************************

148. spacer 7.9|56486|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gccacggcctcccggccggagagcttgtgccg	CRISPR spacer
gccacggcctcccggccggagagcttgtgccg	Protospacer
********************************

149. spacer 7.9|56486|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gccacggcctcccggccggagagcttgtgccg	CRISPR spacer
gccacggcctcccggccggagagcttgtgccg	Protospacer
********************************

150. spacer 7.10|56547|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtcgtagaggcggcgatcgttgctgccctg	CRISPR spacer
gcgtcgtagaggcggcgatcgttgctgccctg	Protospacer
********************************

151. spacer 7.10|56547|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtcgtagaggcggcgatcgttgctgccctg	CRISPR spacer
gcgtcgtagaggcggcgatcgttgctgccctg	Protospacer
********************************

152. spacer 7.11|56608|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcctgagggggtcccctatccgaaagaaac	CRISPR spacer
ctgcctgagggggtcccctatccgaaagaaac	Protospacer
********************************

153. spacer 7.11|56608|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcctgagggggtcccctatccgaaagaaac	CRISPR spacer
ctgcctgagggggtcccctatccgaaagaaac	Protospacer
********************************

154. spacer 7.12|56669|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcagaccagggcgatgcgggaactgtcccgg	CRISPR spacer
ggcagaccagggcgatgcgggaactgtcccgg	Protospacer
********************************

155. spacer 7.12|56669|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcagaccagggcgatgcgggaactgtcccgg	CRISPR spacer
ggcagaccagggcgatgcgggaactgtcccgg	Protospacer
********************************

156. spacer 7.13|56730|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gaggtcgccagtcgaacggcaccgacttcacc	CRISPR spacer
gaggtcgccagtcgaacggcaccgacttcacc	Protospacer
********************************

157. spacer 7.13|56730|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gaggtcgccagtcgaacggcaccgacttcacc	CRISPR spacer
gaggtcgccagtcgaacggcaccgacttcacc	Protospacer
********************************

158. spacer 7.14|56791|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gggacacccttcgctgtcggcagcgtctggac	CRISPR spacer
gggacacccttcgctgtcggcagcgtctggac	Protospacer
********************************

159. spacer 7.14|56791|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gggacacccttcgctgtcggcagcgtctggac	CRISPR spacer
gggacacccttcgctgtcggcagcgtctggac	Protospacer
********************************

160. spacer 7.15|56304|32|NC_020894|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ggccacaatcgcgacctgttcgagaacaaggc	CRISPR spacer
ggccacaatcgcgacctgttcgagaacaaggc	Protospacer
********************************

161. spacer 7.15|56304|32|NC_020894|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ggccacaatcgcgacctgttcgagaacaaggc	CRISPR spacer
ggccacaatcgcgacctgttcgagaacaaggc	Protospacer
********************************

162. spacer 7.16|56365|32|NC_020894|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gctcctaggtggggtgcccgccggggacgtgg	CRISPR spacer
gctcctaggtggggtgcccgccggggacgtgg	Protospacer
********************************

163. spacer 7.16|56365|32|NC_020894|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gctcctaggtggggtgcccgccggggacgtgg	CRISPR spacer
gctcctaggtggggtgcccgccggggacgtgg	Protospacer
********************************

164. spacer 7.17|56426|32|NC_020894|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
cacgctgggacctcaccctcggcgcggcctcc	Protospacer
********************************

165. spacer 7.17|56426|32|NC_020894|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
cacgctgggacctcaccctcggcgcggcctcc	Protospacer
********************************

166. spacer 7.18|56487|32|NC_020894|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gccacggcctcccggccggagagcttgtgccg	CRISPR spacer
gccacggcctcccggccggagagcttgtgccg	Protospacer
********************************

167. spacer 7.18|56487|32|NC_020894|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gccacggcctcccggccggagagcttgtgccg	CRISPR spacer
gccacggcctcccggccggagagcttgtgccg	Protospacer
********************************

168. spacer 7.19|56548|32|NC_020894|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtcgtagaggcggcgatcgttgctgccctg	CRISPR spacer
gcgtcgtagaggcggcgatcgttgctgccctg	Protospacer
********************************

169. spacer 7.19|56548|32|NC_020894|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtcgtagaggcggcgatcgttgctgccctg	CRISPR spacer
gcgtcgtagaggcggcgatcgttgctgccctg	Protospacer
********************************

170. spacer 7.20|56609|32|NC_020894|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcctgagggggtcccctatccgaaagaaac	CRISPR spacer
ctgcctgagggggtcccctatccgaaagaaac	Protospacer
********************************

171. spacer 7.20|56609|32|NC_020894|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcctgagggggtcccctatccgaaagaaac	CRISPR spacer
ctgcctgagggggtcccctatccgaaagaaac	Protospacer
********************************

172. spacer 7.21|56670|32|NC_020894|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcagaccagggcgatgcgggaactgtcccgg	CRISPR spacer
ggcagaccagggcgatgcgggaactgtcccgg	Protospacer
********************************

173. spacer 7.21|56670|32|NC_020894|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcagaccagggcgatgcgggaactgtcccgg	CRISPR spacer
ggcagaccagggcgatgcgggaactgtcccgg	Protospacer
********************************

174. spacer 8.1|57076|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gacgtgctcacttggcgatctccttacgggcg	CRISPR spacer
gacgtgctcacttggcgatctccttacgggcg	Protospacer
********************************

175. spacer 8.1|57076|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gacgtgctcacttggcgatctccttacgggcg	CRISPR spacer
gacgtgctcacttggcgatctccttacgggcg	Protospacer
********************************

176. spacer 8.2|57137|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gacgaggtagtcaccctggtccggatccgtcg	CRISPR spacer
gacgaggtagtcaccctggtccggatccgtcg	Protospacer
********************************

177. spacer 8.2|57137|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gacgaggtagtcaccctggtccggatccgtcg	CRISPR spacer
gacgaggtagtcaccctggtccggatccgtcg	Protospacer
********************************

178. spacer 8.3|57198|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

atcgagaatcatttcgtcgtcgaccccgcgaa	CRISPR spacer
atcgagaatcatttcgtcgtcgaccccgcgaa	Protospacer
********************************

179. spacer 8.3|57198|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

atcgagaatcatttcgtcgtcgaccccgcgaa	CRISPR spacer
atcgagaatcatttcgtcgtcgaccccgcgaa	Protospacer
********************************

180. spacer 8.4|57259|33|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cccacgaagcccccgtccgagtctgggcggggg	CRISPR spacer
cccacgaagcccccgtccgagtctgggcggggg	Protospacer
*********************************

181. spacer 8.4|57259|33|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cccacgaagcccccgtccgagtctgggcggggg	CRISPR spacer
cccacgaagcccccgtccgagtctgggcggggg	Protospacer
*********************************

182. spacer 8.4|57259|33|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cccacgaagcccccgtccgagtctgggcggggg	CRISPR spacer
cccacgaagcccccgtccgagtctgggcggggg	Protospacer
*********************************

183. spacer 8.4|57259|33|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cccacgaagcccccgtccgagtctgggcggggg	CRISPR spacer
cccacgaagcccccgtccgagtctgggcggggg	Protospacer
*********************************

184. spacer 8.5|57321|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

aggttcccgtactggcggagcggcaggccgaa	CRISPR spacer
aggttcccgtactggcggagcggcaggccgaa	Protospacer
********************************

185. spacer 8.5|57321|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

aggttcccgtactggcggagcggcaggccgaa	CRISPR spacer
aggttcccgtactggcggagcggcaggccgaa	Protospacer
********************************

186. spacer 8.6|57382|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gtctggcccaactggtgccaggatcatcccca	CRISPR spacer
gtctggcccaactggtgccaggatcatcccca	Protospacer
********************************

187. spacer 8.6|57382|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gtctggcccaactggtgccaggatcatcccca	CRISPR spacer
gtctggcccaactggtgccaggatcatcccca	Protospacer
********************************

188. spacer 8.7|57443|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

caaggtgtcagcacgagacacaggggaggcca	CRISPR spacer
caaggtgtcagcacgagacacaggggaggcca	Protospacer
********************************

189. spacer 8.7|57443|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

caaggtgtcagcacgagacacaggggaggcca	CRISPR spacer
caaggtgtcagcacgagacacaggggaggcca	Protospacer
********************************

190. spacer 8.8|57504|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggccagtgcgttgaggtcgccaccaacct	CRISPR spacer
ggcggccagtgcgttgaggtcgccaccaacct	Protospacer
********************************

191. spacer 8.8|57504|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggccagtgcgttgaggtcgccaccaacct	CRISPR spacer
ggcggccagtgcgttgaggtcgccaccaacct	Protospacer
********************************

192. spacer 8.9|57565|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

cgggcccggtcaccttccagtccctcttccaa	CRISPR spacer
cgggcccggtcaccttccagtccctcttccaa	Protospacer
********************************

193. spacer 8.9|57565|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

cgggcccggtcaccttccagtccctcttccaa	CRISPR spacer
cgggcccggtcaccttccagtccctcttccaa	Protospacer
********************************

194. spacer 8.10|57626|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ggggcacccttcgctgtcggcagcgtctggac	CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac	Protospacer
********************************

195. spacer 8.10|57626|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ggggcacccttcgctgtcggcagcgtctggac	CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac	Protospacer
********************************

196. spacer 8.10|57626|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ggggcacccttcgctgtcggcagcgtctggac	CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac	Protospacer
********************************

197. spacer 8.10|57626|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ggggcacccttcgctgtcggcagcgtctggac	CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac	Protospacer
********************************

198. spacer 9.1|57911|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

accgcgaccttccggtggagggcgtgcagttc	CRISPR spacer
accgcgaccttccggtggagggcgtgcagttc	Protospacer
********************************

199. spacer 9.1|57911|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

accgcgaccttccggtggagggcgtgcagttc	CRISPR spacer
accgcgaccttccggtggagggcgtgcagttc	Protospacer
********************************

200. spacer 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ggccgcatcaccggccccggcttcgaactgcg	CRISPR spacer
ggccgcatcaccggccccggcttcgaactgcg	Protospacer
********************************

201. spacer 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ggccgcatcaccggccccggcttcgaactgcg	CRISPR spacer
ggccgcatcaccggccccggcttcgaactgcg	Protospacer
********************************

202. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
tgaccgcaggccgccgccacgtcgcgcgcctt	Protospacer
********************************

203. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
tgaccgcaggccgccgccacgtcgcgcgcctt	Protospacer
********************************

204. spacer 9.4|58094|31|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gacgcgctcgtgaaggtggccaagcagtacc	CRISPR spacer
gacgcgctcgtgaaggtggccaagcagtacc	Protospacer
*******************************

205. spacer 9.4|58094|31|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gacgcgctcgtgaaggtggccaagcagtacc	CRISPR spacer
gacgcgctcgtgaaggtggccaagcagtacc	Protospacer
*******************************

206. spacer 9.5|58154|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

tacgagaacggccgctccgagccgaagtcgcc	CRISPR spacer
tacgagaacggccgctccgagccgaagtcgcc	Protospacer
********************************

207. spacer 9.5|58154|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

tacgagaacggccgctccgagccgaagtcgcc	CRISPR spacer
tacgagaacggccgctccgagccgaagtcgcc	Protospacer
********************************

208. spacer 9.5|58154|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 0, identity: 1.0

tacgagaacggccgctccgagccgaagtcgcc	CRISPR spacer
tacgagaacggccgctccgagccgaagtcgcc	Protospacer
********************************

209. spacer 9.6|58215|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gaccctggtaccggatcaccgaccggtaccag	CRISPR spacer
gaccctggtaccggatcaccgaccggtaccag	Protospacer
********************************

210. spacer 9.6|58215|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gaccctggtaccggatcaccgaccggtaccag	CRISPR spacer
gaccctggtaccggatcaccgaccggtaccag	Protospacer
********************************

211. spacer 9.7|58276|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgactcgggccgccatcgaacgtgccgaggc	CRISPR spacer
gcgactcgggccgccatcgaacgtgccgaggc	Protospacer
********************************

212. spacer 9.7|58276|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgactcgggccgccatcgaacgtgccgaggc	CRISPR spacer
gcgactcgggccgccatcgaacgtgccgaggc	Protospacer
********************************

213. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
gaaggcgcgatggccggacgccgggcgatcga	Protospacer
********************************

214. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
gaaggcgcgatggccggacgccgggcgatcga	Protospacer
********************************

215. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
ccgccgacgatcaggccgaacgtgccggtcag	Protospacer
********************************

216. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
ccgccgacgatcaggccgaacgtgccggtcag	Protospacer
********************************

217. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
gcgggtgggtcgccgccgaccggcgcaccgcc	Protospacer
********************************

218. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
gcgggtgggtcgccgccgaccggcgcaccgcc	Protospacer
********************************

219. spacer 9.11|58520|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gactctgggaccacgatggtggtcaacgtcct	CRISPR spacer
gactctgggaccacgatggtggtcaacgtcct	Protospacer
********************************

220. spacer 9.11|58520|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gactctgggaccacgatggtggtcaacgtcct	CRISPR spacer
gactctgggaccacgatggtggtcaacgtcct	Protospacer
********************************

221. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
catttcgatccagagcacgccggccgccgcca	Protospacer
********************************

222. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
catttcgatccagagcacgccggccgccgcca	Protospacer
********************************

223. spacer 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

gccctgcaccaccaccatttcgtcggccggcg	CRISPR spacer
gccctgcaccaccaccatttcgtcggccggcg	Protospacer
********************************

224. spacer 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

gccctgcaccaccaccatttcgtcggccggcg	CRISPR spacer
gccctgcaccaccaccatttcgtcggccggcg	Protospacer
********************************

225. spacer 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

atcacccccgtgccgaacacgccgacgtcggt	CRISPR spacer
atcacccccgtgccgaacacgccgacgtcggt	Protospacer
********************************

226. spacer 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

atcacccccgtgccgaacacgccgacgtcggt	CRISPR spacer
atcacccccgtgccgaacacgccgacgtcggt	Protospacer
********************************

227. spacer 10.1|86892|60|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 0, identity: 1.0

tgggagggagaccgtggtgggcaaggttgcgggcaaggcccgcatcaagacctaccgcgg	CRISPR spacer
tgggagggagaccgtggtgggcaaggttgcgggcaaggcccgcatcaagacctaccgcgg	Protospacer
************************************************************

228. spacer 10.1|86892|60|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 0, identity: 1.0

tgggagggagaccgtggtgggcaaggttgcgggcaaggcccgcatcaagacctaccgcgg	CRISPR spacer
tgggagggagaccgtggtgggcaaggttgcgggcaaggcccgcatcaagacctaccgcgg	Protospacer
************************************************************

229. spacer 3.1|51816|32|NC_020894|CRISPRCasFinder matches to NZ_CP030863 (Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgccctgccccgcctgagcgcgaacgtgccg	CRISPR spacer
ccgccctgccccgcctgagctcgaacgtgccg	Protospacer
******************** ***********

230. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
caggtggcgcgcaccgtcgccgacacccacga	Protospacer
****.***************************

231. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NC_022001 (Streptomyces collinus Tu 365 plasmid pSCO1, complete sequence) position: , mismatch: 1, identity: 0.969

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
caggcggcgcgcaccgtcgccgacacccatga	Protospacer
*****************************.**

232. spacer 5.3|54941|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 1, identity: 0.969

cgggcccggtcaccttccagtccctcgtccaa	CRISPR spacer
cgggcccggtcaccttccagtccctcttccaa	Protospacer
************************** *****

233. spacer 5.3|54941|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 1, identity: 0.969

cgggcccggtcaccttccagtccctcgtccaa	CRISPR spacer
cgggcccggtcaccttccagtccctcttccaa	Protospacer
************************** *****

234. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to MH834623 (Arthrobacter phage Peas, complete genome) position: , mismatch: 1, identity: 0.969

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
cagttcgtcgtcggcgtccgccaggacatcac	Protospacer
******.*************************

235. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to NC_048094 (Arthrobacter phage Eileen, complete genome) position: , mismatch: 1, identity: 0.969

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
cagttcgtcgtcggcgtccgccaggacatcac	Protospacer
******.*************************

236. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to MH834605 (Arthrobacter phage Constance, complete genome) position: , mismatch: 1, identity: 0.969

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
cagttcgtcgtcggcgtccgccaggacatcac	Protospacer
******.*************************

237. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to NC_048095 (Arthrobacter phage Judy, complete genome) position: , mismatch: 1, identity: 0.969

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
cagttcgtcgtcggcgtccgccaggacatcac	Protospacer
******.*************************

238. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to MH834603 (Arthrobacter phage Bridgette, complete genome) position: , mismatch: 1, identity: 0.969

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
cagttcgtcgtcggcgtccgccaggacatcac	Protospacer
******.*************************

239. spacer 6.9|55714|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 1, identity: 0.969

ggggcacccttcgctgtcggcagcgtctggac	CRISPR spacer
gggacacccttcgctgtcggcagcgtctggac	Protospacer
***.****************************

240. spacer 6.9|55714|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 1, identity: 0.969

ggggcacccttcgctgtcggcagcgtctggac	CRISPR spacer
gggacacccttcgctgtcggcagcgtctggac	Protospacer
***.****************************

241. spacer 7.14|56791|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 1, identity: 0.969

gggacacccttcgctgtcggcagcgtctggac	CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac	Protospacer
***.****************************

242. spacer 7.14|56791|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 1, identity: 0.969

gggacacccttcgctgtcggcagcgtctggac	CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac	Protospacer
***.****************************

243. spacer 7.14|56791|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 1, identity: 0.969

gggacacccttcgctgtcggcagcgtctggac	CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac	Protospacer
***.****************************

244. spacer 7.14|56791|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 1, identity: 0.969

gggacacccttcgctgtcggcagcgtctggac	CRISPR spacer
ggggcacccttcgctgtcggcagcgtctggac	Protospacer
***.****************************

245. spacer 8.3|57198|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_010851 (Streptomyces sp. FR1 plasmid pFRL1, complete sequence) position: , mismatch: 1, identity: 0.969

atcgagaatcatttcgtcgtcgaccccgcgaa	CRISPR spacer
atcgagaatcatttcgtggtcgaccccgcgaa	Protospacer
***************** **************

246. spacer 8.9|57565|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 1, identity: 0.969

cgggcccggtcaccttccagtccctcttccaa	CRISPR spacer
cgggcccggtcaccttccagtccctcgtccaa	Protospacer
************************** *****

247. spacer 8.9|57565|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 1, identity: 0.969

cgggcccggtcaccttccagtccctcttccaa	CRISPR spacer
cgggcccggtcaccttccagtccctcgtccaa	Protospacer
************************** *****

248. spacer 8.10|57626|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 1, identity: 0.969

ggggcacccttcgctgtcggcagcgtctggac	CRISPR spacer
gggacacccttcgctgtcggcagcgtctggac	Protospacer
***.****************************

249. spacer 8.10|57626|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 1, identity: 0.969

ggggcacccttcgctgtcggcagcgtctggac	CRISPR spacer
gggacacccttcgctgtcggcagcgtctggac	Protospacer
***.****************************

250. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to NC_016972 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG2, complete sequence) position: , mismatch: 1, identity: 0.969

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
catctcgatccagagcacgccggccgccgcca	Protospacer
***.****************************

251. spacer 7.6|56304|31|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP043961 (Streptomyces tendae strain 139 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.935

gccacaatcgcgacctgttcgagaacaaggc	CRISPR spacer
gccacaagcacgacctgttcgagaacaaggc	Protospacer
******* *.*********************

252. spacer 7.15|56304|32|NC_020894|PILER-CR matches to NZ_CP043961 (Streptomyces tendae strain 139 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

ggccacaatcgcgacctgttcgagaacaaggc	CRISPR spacer
ggccacaagcacgacctgttcgagaacaaggc	Protospacer
******** *.*********************

253. spacer 8.3|57198|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.938

atcgagaatcatttcgtcgtcgaccccgcgaa	CRISPR spacer
atcgagaaccatttcgtcgtcgatcccgcgaa	Protospacer
********.**************.********

254. spacer 9.5|58154|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 2, identity: 0.938

tacgagaacggccgctccgagccgaagtcgcc	CRISPR spacer
tgggagaacggccgctccgagccgaagtcgcc	Protospacer
*. *****************************

255. spacer 9.5|58154|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 2, identity: 0.938

tacgagaacggccgctccgagccgaagtcgcc	CRISPR spacer
tacgagaacggccgctcggaaccgaagtcgcc	Protospacer
***************** **.***********

256. spacer 9.5|58154|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938

tacgagaacggccgctccgagccgaagtcgcc	CRISPR spacer
tgggagaacggccgctccgagccgaagtcgcc	Protospacer
*. *****************************

257. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 3, identity: 0.906

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
gcggcggcgcgtaccgtcgccgacacccacga	Protospacer
  *********.********************

258. spacer 3.19|52177|37|NC_020894|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 3, identity: 0.919

atccccaggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
agggccaggcggcgcgcaccgtcgccgacacccacga	Protospacer
*   *********************************

259. spacer 3.19|52177|37|NC_020894|CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.919

atccccaggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
agcagcaggcggcgcgcaccgtcgccgacacccacga	Protospacer
* *  ********************************

260. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 4, identity: 0.875

caggcggcg-cgcaccgtcgccgacacccacga	CRISPR spacer
-atgcggcgacgcaccgtcgccgactccctcga	Protospacer
 * ****** *************** *** ***

261. spacer 3.13|51811|37|NC_020894|CRT matches to NZ_CP009439 (Streptomyces glaucescens strain GLA.O plasmid pSglau1, complete sequence) position: , mismatch: 4, identity: 0.892

atccgccgccctgccccgcctgagcgcgaacgtgccg	CRISPR spacer
cctggccgccctgccccgcctgagcgcgaacgtgccg	Protospacer
 .. *********************************

262. spacer 3.19|52177|37|NC_020894|CRT matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.892

atccccaggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
agggccaggtggcgcgcaccgtcgccgacacccacga	Protospacer
*   *****.***************************

263. spacer 3.4|51999|32|NC_020894|CRISPRCasFinder matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 5, identity: 0.844

cccgccgcgctcgccctggccac-tctgggcat	CRISPR spacer
cccgcccggctcgccctggccacggccgggca-	Protospacer
******  ***************  *.***** 

264. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NC_004719 (Streptomyces avermitilis MA-4680 = NBRC 14893 plasmid SAP1, complete sequence) position: , mismatch: 5, identity: 0.844

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
gcggccgcgcgcaccgtcgccgacacgcacgc	Protospacer
  *** ******************** **** 

265. spacer 3.13|51811|37|NC_020894|CRT matches to NZ_CP030863 (Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.865

atccgccgccctgccccgcctgagcgcgaacgtgccg	CRISPR spacer
cctggccgccctgccccgcctgagctcgaacgtgccg	Protospacer
 .. ********************* ***********

266. spacer 3.19|52177|37|NC_020894|CRT matches to NC_022001 (Streptomyces collinus Tu 365 plasmid pSCO1, complete sequence) position: , mismatch: 5, identity: 0.865

atccccaggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
aggagcaggcggcgcgcaccgtcgccgacacccatga	Protospacer
*    *****************************.**

267. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

cagttcatcgtcggcgtccgccaggac-atcac	CRISPR spacer
caggtcatcgtctgcgtccgccatggcgatca-	Protospacer
*** ******** ********** *.* **** 

268. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.844

cagttcatcgtcggcgtccgccaggac-atcac	CRISPR spacer
caggtcatcgtctgcgtccgccatggcgatca-	Protospacer
*** ******** ********** *.* **** 

269. spacer 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.844

tccggtcgtgcacgactgcgccgactgcggac-	CRISPR spacer
tccggtcgcgcacggctgcgccga-ggcgaacg	Protospacer
********.*****.*********  ***.** 

270. spacer 8.3|57198|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026654 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844

atcgagaatcatttcgtcgtcgaccccgcgaa	CRISPR spacer
atcgagaaccacttcgtcgtcgacccgggcaa	Protospacer
********.**.************** *  **

271. spacer 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 5, identity: 0.844

ggccgcatcaccggccccggcttcgaactgcg-	CRISPR spacer
cgccgcatcaccggccccggcgccg-accgcgg	Protospacer
 ******************** .** **.*** 

272. spacer 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.844

ggccgcatcaccggccccggcttcgaactgcg-	CRISPR spacer
cgccgcatcaccggccccggcgccg-accgcgg	Protospacer
 ******************** .** **.*** 

273. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021029 (Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence) position: , mismatch: 5, identity: 0.844

-gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
cgcgcat-cgtctccgccgaccggcgcaccgcc	Protospacer
 *** .*  *** ********************

274. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 5, identity: 0.844

-gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
cgcgcat-cgtctccgccgaccggcgcaccgcc	Protospacer
 *** .*  *** ********************

275. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NC_021911 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence) position: , mismatch: 5, identity: 0.844

-gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
cgcgcat-cgtctccgccgaccggcgcaccgcc	Protospacer
 *** .*  *** ********************

276. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013515 (Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence) position: , mismatch: 5, identity: 0.844

-gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
cgcgcat-cgtctccgccgaccggcgcaccgcc	Protospacer
 *** .*  *** ********************

277. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013605 (Rhizobium sp. N731 plasmid pRspN731d, complete sequence) position: , mismatch: 5, identity: 0.844

-gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
cgcgcat-cgtctccgccgaccggcgcaccgcc	Protospacer
 *** .*  *** ********************

278. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 5, identity: 0.844

--gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc	Protospacer
  **** *  ******************  ****

279. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.844

--gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc	Protospacer
  **** *  ******************  ****

280. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 5, identity: 0.844

--gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc	Protospacer
  **** *  ******************  ****

281. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 5, identity: 0.844

--gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc	Protospacer
  **** *  ******************  ****

282. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.844

--gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc	Protospacer
  **** *  ******************  ****

283. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021803 (Sinorhizobium meliloti strain USDA1021 plasmid accessoryA, complete sequence) position: , mismatch: 5, identity: 0.844

--gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc	Protospacer
  **** *  ******************  ****

284. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.844

--gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc	Protospacer
  **** *  ******************  ****

285. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.844

--gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc	Protospacer
  **** *  ******************  ****

286. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.844

--gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc	Protospacer
  **** *  ******************  ****

287. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.844

--gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc	Protospacer
  **** *  ******************  ****

288. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.844

--gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc	Protospacer
  **** *  ******************  ****

289. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NC_019313 (Sinorhizobium meliloti plasmid pHRC017, complete sequence) position: , mismatch: 5, identity: 0.844

--gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ctgcggtt--gtcgccgccgaccggcgctgcgcc	Protospacer
  **** *  ******************  ****

290. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 5, identity: 0.844

--gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ttgcggtt--gtcgccgccgaccggcgctgcgcc	Protospacer
  **** *  ******************  ****

291. spacer 1.2|40596|29|NC_020894|CRISPRCasFinder matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

cgtggcgggctcaccggccgcgatgacct	CRISPR spacer
ctgaccgggctgaccggccgcgatgtcct	Protospacer
*  . ****** ************* ***

292. spacer 1.2|40596|29|NC_020894|CRISPRCasFinder matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 6, identity: 0.793

cgtggcgggctcaccggccgcgatgacct	CRISPR spacer
ctgaccgggctgaccggccgcgatgtcct	Protospacer
*  . ****** ************* ***

293. spacer 1.2|40596|29|NC_020894|CRISPRCasFinder matches to NZ_CP040821 (Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence) position: , mismatch: 6, identity: 0.793

cgtggcgggctcaccggccgcgatgacct	CRISPR spacer
cgccgcgggctgaccggccgcgatggcaa	Protospacer
**. ******* *************.*  

294. spacer 1.2|40596|29|NC_020894|CRISPRCasFinder matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 6, identity: 0.793

cgtggcgggctcaccggccgcgatgacct	CRISPR spacer
ggcgtcgggctcgccggccgcgatcaccg	Protospacer
 *.* *******.*********** *** 

295. spacer 1.2|40596|29|NC_020894|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.793

cgtggcgggctcaccggccgcgatgacct--	CRISPR spacer
actggcgggctcgccggccgcga--gcctgc	Protospacer
  **********.**********  .***  

296. spacer 1.6|40596|30|NC_020894|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 6, identity: 0.8

cgtggcgggctcaccggccgcgatgacctc	CRISPR spacer
ggcgtcgggctcgccggccgcgatcaccgc	Protospacer
 *.* *******.*********** *** *

297. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to MK801721 (Gordonia phage William, complete genome) position: , mismatch: 6, identity: 0.812

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
tccggcaggcgacggcgcaggaggttgtggcg	Protospacer
* . *******************.*.***** 

298. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_011003 (Burkholderia cenocepacia J2315 plasmid pBCJ2315, complete sequence) position: , mismatch: 6, identity: 0.812

tgttg-caggcgacggcgcaggagatcgtggct	CRISPR spacer
-atcgtcaggcgacggcgccggcgatcgtggcc	Protospacer
 .*.* ************* ** *********.

299. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 6, identity: 0.812

tgttgcag--gcgacggcgcaggagatcgtggct	CRISPR spacer
--tcgccgtcgcgacggcggaggagatcgaggct	Protospacer
  *.** *  ********* ********* ****

300. spacer 2.7|51119|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.812

--cagctcggcgcgcaggaacggtccgggctgcg	CRISPR spacer
gtcggcc--gcgcgcaggaacaggccgggctgcg	Protospacer
  *.**.  ************.* **********

301. spacer 2.7|51119|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007144 (Hymenobacter swuensis DY53 plasmid pHsw1, complete sequence) position: , mismatch: 6, identity: 0.812

cagctcgg-cgcgcaggaacggtccgggctgcg	CRISPR spacer
-aacgaggccgcgcaggaacggcccgagctgcg	Protospacer
 *.*  ** *************.***.******

302. spacer 2.8|51180|32|NC_020894|CRISPRCasFinder,CRT matches to NC_023067 (Streptomyces sp. F2 plasmid pFP3, complete sequence) position: , mismatch: 6, identity: 0.812

cagtccaggccgtccttgatgtgaccgaccgt	CRISPR spacer
acgtccaggccgtgcttgatgtggccgacgga	Protospacer
  *********** *********.***** * 

303. spacer 2.8|51180|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017833 (Streptomyces sp. FR1 plasmid pFP4, complete sequence) position: , mismatch: 6, identity: 0.812

cagtccaggccgtccttgatgtgaccgaccgt	CRISPR spacer
acgtccaggccgtgcttgatgtggccgacgga	Protospacer
  *********** *********.***** * 

304. spacer 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

gtcgacgtcgcgttcgtgccgcgctc---cgcgtt	CRISPR spacer
ggcgacgtcgccatcgtgccgcgctcgctcgc---	Protospacer
* *********  *************   ***   

305. spacer 2.14|51546|32|NC_020894|CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

ccttgaccttgtcgaccttcatctcgaacagg	CRISPR spacer
ccttgaccttgacgaccttcatcgacacccgg	Protospacer
*********** ***********   * * **

306. spacer 2.14|51546|32|NC_020894|CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

ccttgaccttgtcgaccttcatctcgaacagg	CRISPR spacer
ccttgaccttgacgaccttcatcgacacccgg	Protospacer
*********** ***********   * * **

307. spacer 2.14|51546|32|NC_020894|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 6, identity: 0.812

ccttgaccttgtcgaccttcatctcgaacagg	CRISPR spacer
ccttgaccttgtcgaactgcatctggttctgg	Protospacer
*************** ** ***** *  * **

308. spacer 3.2|51877|32|NC_020894|CRISPRCasFinder matches to MN234216 (Streptomyces phage Gilgamesh, complete genome) position: , mismatch: 6, identity: 0.812

tgcgggaggccatccgccgcgctg----tctgtgag	CRISPR spacer
tgcgggagatcatccgccgcgctgaggctctg----	Protospacer
********..**************    ****    

309. spacer 3.4|51999|32|NC_020894|CRISPRCasFinder matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

cccgccgcgctcgccctggccactctgggcat	CRISPR spacer
gccgccgcgctcgccctggccccgctggccga	Protospacer
 ******************** * **** *. 

310. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_CP011666 (Streptomyces sp. Mg1 plasmid pSMg1-2, complete sequence) position: , mismatch: 6, identity: 0.812

caggcggcgcgcaccgtcgccgacacccacga-	CRISPR spacer
cgggcggcgggcagcgtcgccgaca-gcatgac	Protospacer
*.******* *** ***********  **.** 

311. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 6, identity: 0.812

caggcggcgcgcaccgtcgccgacacccacga-	CRISPR spacer
tcgacgccgcgcaccgtcgccgtca-ccacgag	Protospacer
. *.** *************** ** ****** 

312. spacer 3.8|52243|32|NC_020894|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.812

gagctgtgcaccgccacgatcaacgaccgacg	CRISPR spacer
gcggtgtgcaccccgacgatcaacgaccgggg	Protospacer
* * ******** * **************. *

313. spacer 3.10|52365|31|NC_020894|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 6, identity: 0.806

ccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
tggcgctcgtggtggccgaacggctgcgcgc	Protospacer
. **   ********************** *

314. spacer 3.10|52365|31|NC_020894|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.806

ccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
cggccctggtggtggccgaacggcggcgcca	Protospacer
* ***   **************** ***** 

315. spacer 3.19|52177|37|NC_020894|CRT matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 6, identity: 0.838

atccccaggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
agacggcggcggcgcgtaccgtcgccgacacccacga	Protospacer
*  *   *********.********************

316. spacer 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ccgctcagc-tcgcaccgccgggcggcgcggac	CRISPR spacer
-tgcgcaccgtcgcaccgccgagcggcgcagac	Protospacer
 .** ** * ***********.*******.***

317. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to KM083128 (Mycobacterium phage Sparky, complete genome) position: , mismatch: 6, identity: 0.812

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
cgcgtcatcatcggcgtccgccaggacatcca	Protospacer
*.  *****.********************  

318. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015232 (Epibacterium mobile F1926 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
tcgaagcaggccgccgccccggcgcgcgcctt	Protospacer
* .  ************* ** **********

319. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.812

tgaccgcag--gccgccgccacgtcgcgcgcctt	CRISPR spacer
--agcgccgccgccgccgccccgtcgcgcgcgtt	Protospacer
  * *** *  ********* ********** **

320. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to EU307292 (Burkholderia phage Bups phi1 clone 2 partial sequence) position: , mismatch: 6, identity: 0.812

-tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
atga-agcaggccgccgacatgtcgcgcgcgct	Protospacer
 ***  *********** **.********* .*

321. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

--tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
ctcgcccgc--gccgccgccaccgcgcgcgcctt	Protospacer
  .* ****  ***********  **********

322. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 6, identity: 0.812

tgaccgc-aggccgccgccacgtcgcgcgcctt	CRISPR spacer
-gaccccgaggccgccgccaccgcgcgcgccga	Protospacer
 **** * *************  ********  

323. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 6, identity: 0.812

--tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
ctcgcccgc--gccgccgccaccgcgcgcgcctt	Protospacer
  .* ****  ***********  **********

324. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP033585 (Streptomyces sp. ADI95-16 plasmid pADI95-16d, complete sequence) position: , mismatch: 6, identity: 0.812

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
gagcaggcgatggcgggccgccgggcgatcga	Protospacer
**. . ******** ** **************

325. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.812

gaaggcgcgatggccggacgccgggcgatcga-	CRISPR spacer
caaggcgctctggccggacgcc-ggcgatggcg	Protospacer
 *******  ************ ****** *  

326. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.812

gaaggcgcgatggccggacgccgggcgatcga-	CRISPR spacer
caaggcgctctggccggacgcc-ggcgatggcg	Protospacer
 *******  ************ ****** *  

327. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to MN175604 (Gordonia phage PhorbesPhlower, complete genome) position: , mismatch: 6, identity: 0.812

--gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
ccgaag--tcgaaggccggacgccggacgatcaa	Protospacer
  ****   *** *************.*****.*

328. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.812

ccgccg--acgatcaggccgaacgtgccggtcag	CRISPR spacer
--gccggagcggtcaggccgaacgtgccggccat	Protospacer
  ****  .**.******************.** 

329. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.812

ccgccgac-gatcaggccgaacgtgccggtcag	CRISPR spacer
-ggcggatggatcaggcccagcgtgccggtcag	Protospacer
  ** **. ********* *.************

330. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

ccgccgac-gatcaggccgaacgtgccggtcag	CRISPR spacer
-ggcggatggatcaggcccagcgtgccggtcag	Protospacer
  ** **. ********* *.************

331. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to JQ680376 (Unidentified phage clone 2209_scaffold1451 genomic sequence) position: , mismatch: 6, identity: 0.812

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
ccgccgatgatcacgccgaacgtggtcgtccg	Protospacer
*******.***** ********** . *** *

332. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

ccgccgacg-atcaggccgaacgtgccggtcag	CRISPR spacer
-ggcggatgaatcaggcccagcgtgccggtcag	Protospacer
  ** **.* ******** *.************

333. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NC_006571 (Streptomyces albulus plasmid pNO33 DNA, complete sequence) position: , mismatch: 6, identity: 0.812

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ccggccgcatcgccgccgaccgccgcaccgcc	Protospacer
 *** .* .************* *********

334. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 6, identity: 0.812

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ccggccgattcgccgccgaccggctcaccgcc	Protospacer
 *** .*. *************** *******

335. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 6, identity: 0.812

-gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
cgcgcat-cgtctccgccgaccggcgcaccacc	Protospacer
 *** .*  *** *****************.**

336. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.812

-gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tgctgg-aggtcgacgccgaccgccgcaccgtc	Protospacer
 ** ** .***** ********* *******.*

337. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 6, identity: 0.812

-gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tgctgg-aggtcgacgccgaccgccgcaccgtc	Protospacer
 ** ** .***** ********* *******.*

338. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 6, identity: 0.812

-gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tgctgg-aggtcgacgccgaccgccgcaccgtc	Protospacer
 ** ** .***** ********* *******.*

339. spacer 1.2|40596|29|NC_020894|CRISPRCasFinder matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 7, identity: 0.759

cgtggcgggctcaccggccgcgatgacct	CRISPR spacer
aaaaccggcctcaccggccgcgacgacct	Protospacer
 . . *** **************.*****

340. spacer 1.2|40596|29|NC_020894|CRISPRCasFinder matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 7, identity: 0.759

cgtggcgggctcaccggccgcgatgacct	CRISPR spacer
gagttcggtgtcaccggccgcgatgacct	Protospacer
 .   ***  *******************

341. spacer 1.2|40596|29|NC_020894|CRISPRCasFinder matches to NZ_LR134445 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.759

cgtggcgggctcaccggccgcgatgacct	CRISPR spacer
acgggcgtgctcaccggccgcgatccccg	Protospacer
   **** ****************  ** 

342. spacer 1.2|40596|29|NC_020894|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.759

cgtggcgggctcaccggccgcgatgacct	CRISPR spacer
cttggcgggctcaccggccacgacgcggg	Protospacer
* *****************.***.*    

343. spacer 1.2|40596|29|NC_020894|CRISPRCasFinder matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 7, identity: 0.759

cgtggcgggctcaccggccgcgatgacct	CRISPR spacer
gcaggctggctccccggccgcgatgagca	Protospacer
   *** ***** ************* * 

344. spacer 1.4|40716|31|NC_020894|CRISPRCasFinder matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 7, identity: 0.774

cgggttgcgggggcgtggatggtcgtggtca	CRISPR spacer
cgacatgcgggcgcgtggatggtcttggccc	Protospacer
**.  ****** ************ ***.* 

345. spacer 1.5|40777|31|NC_020894|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774

cttcttggcggccttgttgatgcgcttcttg	CRISPR spacer
cgcatcgccggccttgtcgatgcgcttcgtg	Protospacer
* . *.* *********.********** **

346. spacer 1.5|40777|31|NC_020894|CRISPRCasFinder matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 7, identity: 0.774

cttcttggcggccttgttgatgcgcttcttg	CRISPR spacer
ccgttcggtggccttgtcgatgcgcttctgg	Protospacer
*. .*.**.********.*********** *

347. spacer 1.5|40777|31|NC_020894|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.774

cttcttggcggccttgttgatgcgcttcttg	CRISPR spacer
cgcatcgccggccttgtcgatgcgcttcgtg	Protospacer
* . *.* *********.********** **

348. spacer 1.6|40596|30|NC_020894|CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 7, identity: 0.767

cgtggcgggctcaccggccgcgatgacctc	CRISPR spacer
aaaaccggcctcaccggccgcgacgacctc	Protospacer
 . . *** **************.******

349. spacer 1.6|40596|30|NC_020894|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

cgtggcgggctcaccggccgcgatgacctc	CRISPR spacer
ctgaccgggctgaccggccgcgatgtcctg	Protospacer
*  . ****** ************* *** 

350. spacer 1.6|40596|30|NC_020894|CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 7, identity: 0.767

cgtggcgggctcaccggccgcgatgacctc	CRISPR spacer
ctgaccgggctgaccggccgcgatgtcctg	Protospacer
*  . ****** ************* *** 

351. spacer 1.6|40596|30|NC_020894|CRT matches to NC_014839 (Pantoea sp. At-9b plasmid pPAT9B02, complete sequence) position: , mismatch: 7, identity: 0.767

cgtggcgggctcaccggccgcgatgacctc	CRISPR spacer
tgaagacggctcaccggccgccgtgacctc	Protospacer
.* .*  ************** .*******

352. spacer 1.6|40596|30|NC_020894|CRT matches to NZ_LR134445 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.767

cgtggcgggctcaccggccgcgatgacctc	CRISPR spacer
acgggcgtgctcaccggccgcgatccccgc	Protospacer
   **** ****************  ** *

353. spacer 1.6|40596|30|NC_020894|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.767

cgtggcgggctcaccggccgcgatgacctc	CRISPR spacer
cttggcgggctcaccggccacgacgcgggc	Protospacer
* *****************.***.*    *

354. spacer 1.6|40596|30|NC_020894|CRT matches to NZ_CP040821 (Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence) position: , mismatch: 7, identity: 0.767

cgtggcgggctcaccggccgcgatgacctc	CRISPR spacer
cgccgcgggctgaccggccgcgatggcaag	Protospacer
**. ******* *************.*   

355. spacer 1.9|40777|32|NC_020894|CRT,PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

cttcttggcggccttgttgatgcgcttcttgt	CRISPR spacer
cgcatcgccggccttgtcgatgcgcttcgtgt	Protospacer
* . *.* *********.********** ***

356. spacer 1.9|40777|32|NC_020894|CRT,PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.781

cttcttggcggccttgttgatgcgcttcttgt	CRISPR spacer
cgcatcgccggccttgtcgatgcgcttcgtgt	Protospacer
* . *.* *********.********** ***

357. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026305 (Streptomyces lunaelactis strain MM109 plasmid pSLUN1, complete sequence) position: , mismatch: 7, identity: 0.781

tgttgca-ggcgacggcgcaggagatcgtggct	CRISPR spacer
-acagcatggcgacggcgcaggagatggaggcc	Protospacer
 .. *** ****************** * ***.

358. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781

-tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
acggtg-acgcgacggcgctggcgatcgtggcc	Protospacer
 .* ** * ********** ** *********.

359. spacer 2.8|51180|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

cagtccaggccgtccttgatgtgaccgaccgt	CRISPR spacer
tgacccaggccgtcctcgatgagaccgaccgc	Protospacer
....************.**** *********.

360. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to KU160671 (Arthrobacter phage Vulture, complete genome) position: , mismatch: 7, identity: 0.781

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
ggggccaggatcgtcggccagcgcgccgggga	Protospacer
*.**. *** *********** ******* .*

361. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to KU160648 (Arthrobacter phage HunterDalle, complete genome) position: , mismatch: 7, identity: 0.781

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
ggggccaggatcgtcggccagcgcgccgggga	Protospacer
*.**. *** *********** ******* .*

362. spacer 3.1|51816|32|NC_020894|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 7, identity: 0.781

ccgccctgccccgcctgagcgcgaacgtgccg	CRISPR spacer
ccgccctgccccgtctcagcgcggcggatccg	Protospacer
*************.** ******.  *  ***

363. spacer 3.3|51938|32|NC_020894|CRISPRCasFinder matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 7, identity: 0.781

agttgcagacgctcccgctcgccgctcaccag	CRISPR spacer
agatgcagacgctccagctcgccgccgacggc	Protospacer
** ************ *********. ** . 

364. spacer 3.3|51938|32|NC_020894|CRISPRCasFinder matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 7, identity: 0.781

agttgcagacgctcccgctcgccgct-caccag	CRISPR spacer
cgcggcagacgctctggctcgccgctccaaca-	Protospacer
 *. **********. ********** ** ** 

365. spacer 3.3|51938|32|NC_020894|CRISPRCasFinder matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 7, identity: 0.781

agttgcagacgctcccgctcgccgct-caccag	CRISPR spacer
cgcggcagacgctctggctcgccgctccaaca-	Protospacer
 *. **********. ********** ** ** 

366. spacer 3.4|51999|32|NC_020894|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 7, identity: 0.781

cccgccgcgctcgccctggcca---ctctgggcat	CRISPR spacer
gccgccgccctcgccctggccactgctacggg---	Protospacer
 ******* *************   ** .***   

367. spacer 3.4|51999|32|NC_020894|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 7, identity: 0.781

cccgccgcgctcgccctggcca---ctctgggcat	CRISPR spacer
gccgccgccctcgccctggccactgctacggg---	Protospacer
 ******* *************   ** .***   

368. spacer 3.4|51999|32|NC_020894|CRISPRCasFinder matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 7, identity: 0.781

cccgccgcgctcgccctggccactctgggcat	CRISPR spacer
cccgccgggctggccctggccacctcggacaa	Protospacer
******* *** ***********...**.** 

369. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 7, identity: 0.781

ctgaacttcggcaaggcggtcggtgcacgctg-	CRISPR spacer
tacaacttcggcaaggcggccggtgc-cgtcgc	Protospacer
.  ****************.****** **..* 

370. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_LR134455 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence) position: , mismatch: 7, identity: 0.781

caggcg-gcgcgcaccgtcgccgacacccacga	CRISPR spacer
-gtgcgtatgcgcaccgtcgccgacacgctcga	Protospacer
 . *** ..****************** * ***

371. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_CP011666 (Streptomyces sp. Mg1 plasmid pSMg1-2, complete sequence) position: , mismatch: 7, identity: 0.781

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
caggcagcgcgcaccgccgccgacgctctcac	Protospacer
*****.**********.*******.*.* *. 

372. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NC_016972 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG2, complete sequence) position: , mismatch: 7, identity: 0.781

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
caggccgtgcgcaccgtcgccgacggccgccc	Protospacer
***** *.****************. **.*  

373. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 7, identity: 0.781

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
caggcggcgctcaccgtcgtcgaagctgccga	Protospacer
********** ********.*** .*.  ***

374. spacer 3.10|52365|31|NC_020894|CRISPRCasFinder matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774

--ccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
tgctgc--gcgtggtggccgagcggctgcgcgg	Protospacer
  *.**  .************.*********  

375. spacer 3.10|52365|31|NC_020894|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.774

ccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
tggcgctcgtggtggccgagcggctgcgcgc	Protospacer
. **   ************.********* *

376. spacer 3.10|52365|31|NC_020894|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.774

ccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
tggcgctcgtggtggccgagcggctgcgcgc	Protospacer
. **   ************.********* *

377. spacer 3.10|52365|31|NC_020894|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.774

ccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
tggcgctcgtggtggccgagcggctgcgcgc	Protospacer
. **   ************.********* *

378. spacer 3.10|52365|31|NC_020894|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.774

ccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
tggcgctcgtggtggccgagcggctgcgcgc	Protospacer
. **   ************.********* *

379. spacer 3.11|52425|32|NC_020894|CRISPRCasFinder matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 7, identity: 0.781

tggcggtg-catgcccgtgctcaccggcgccag	CRISPR spacer
-gacgaagccatcaccgtgctcaccggcgccac	Protospacer
 *.**. * ***  ****************** 

380. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to MN813681 (Mycobacterium phage Roary, complete genome) position: , mismatch: 7, identity: 0.781

--ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
gaggcca--cactcggccacaccgacgccctgat	Protospacer
  **.**   ** *****************.** 

381. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to KT184694 (Mycobacterium phage Smeadley, complete genome) position: , mismatch: 7, identity: 0.781

--ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
gaggcca--cactcggccacaccgacgccctgat	Protospacer
  **.**   ** *****************.** 

382. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to MK524492 (Mycobacterium phage Expelliarmus, complete genome) position: , mismatch: 7, identity: 0.781

--ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
gaggcca--cactcggccacaccgacgccctgat	Protospacer
  **.**   ** *****************.** 

383. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to MH825708 (Mycobacterium phage NearlyHeadless, complete genome) position: , mismatch: 7, identity: 0.781

--ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
gaggcca--cactcggccacaccgacgccctgat	Protospacer
  **.**   ** *****************.** 

384. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to NC_022753 (Mycobacterium phage Fredward, complete genome) position: , mismatch: 7, identity: 0.781

--ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
gaggcca--cactcggccacaccgacgccctgat	Protospacer
  **.**   ** *****************.** 

385. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to MH651173 (Mycobacterium phage Dixon, complete genome) position: , mismatch: 7, identity: 0.781

--ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
gaggcca--cactcggccacaccgacgccctgat	Protospacer
  **.**   ** *****************.** 

386. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to MT310857 (Mycobacterium phage Danforth, complete genome) position: , mismatch: 7, identity: 0.781

--ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
gaggcca--cactcggccacaccgacgccctgat	Protospacer
  **.**   ** *****************.** 

387. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to JX015524 (Mycobacterium virus Astro, complete genome) position: , mismatch: 7, identity: 0.781

--ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
gaggcca--cactcggccacaccgacgccctgat	Protospacer
  **.**   ** *****************.** 

388. spacer 4.3|53131|32|NC_020894|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggaccgcgtcgtcagcggccacaccccg	CRISPR spacer
ggatcgaccgcgtcgtcagcggcctcatccag	Protospacer
  *  ******************* **.** *

389. spacer 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 7, identity: 0.781

ccgctcagctcgcaccgccgggcggcgcggac	CRISPR spacer
ccgacgggctcgccccgcagggcggcgcggat	Protospacer
*** . .****** **** ************.

390. spacer 6.6|55531|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 7, identity: 0.781

aaggtgacgagctggcccggcctgctcgccgt	CRISPR spacer
taccgggcgagctggcccggcccgctggccgt	Protospacer
 *   *.***************.*** *****

391. spacer 6.6|55531|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 7, identity: 0.781

aaggtga---cgagctggcccggcctgctcgccgt	CRISPR spacer
---gtcaattcgaactggaccggcctgctcgccgc	Protospacer
   ** *   ***.**** ***************.

392. spacer 6.6|55531|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 7, identity: 0.781

aaggtga---cgagctggcccggcctgctcgccgt	CRISPR spacer
---gtcaattcgaactggaccggcctgctcgccgc	Protospacer
   ** *   ***.**** ***************.

393. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to MH727545 (Mycobacterium phage DismalStressor, complete genome) position: , mismatch: 7, identity: 0.781

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
cgggtgaaggtcggtgtccgtcaggacatcac	Protospacer
*.* * *  *****.*****.***********

394. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to NC_026598 (Mycobacterium phage Milly, complete genome) position: , mismatch: 7, identity: 0.781

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
cgggtgaaggtcggtgtccgtcaggacatcac	Protospacer
*.* * *  *****.*****.***********

395. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to KX688047 (Mycobacterium phage Marcoliusprime, complete genome) position: , mismatch: 7, identity: 0.781

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
cgggtgaaggtcggtgtccgtcaggacatcac	Protospacer
*.* * *  *****.*****.***********

396. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to MF140408 (Mycobacterium phage DismalFunk, complete genome) position: , mismatch: 7, identity: 0.781

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
cgggtgaaggtcggtgtccgtcaggacatcac	Protospacer
*.* * *  *****.*****.***********

397. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to MF140411 (Mycobacterium phage Findley, complete genome) position: , mismatch: 7, identity: 0.781

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
cgggtgaaggtcggtgtccgtcaggacatcac	Protospacer
*.* * *  *****.*****.***********

398. spacer 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT matches to MK510962 (Pseudomonas phage CF3, partial genome) position: , mismatch: 7, identity: 0.781

gacaccctcggctacaaccagttcgccaccaa	CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa	Protospacer
 .** * .*******.*********.******

399. spacer 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT matches to MK510987 (Pseudomonas phage BR233, partial genome) position: , mismatch: 7, identity: 0.781

gacaccctcggctacaaccagttcgccaccaa	CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa	Protospacer
 .** * .*******.*********.******

400. spacer 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT matches to MG707188 (Pseudomonas phage TC7, partial genome) position: , mismatch: 7, identity: 0.781

gacaccctcggctacaaccagttcgccaccaa	CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa	Protospacer
 .** * .*******.*********.******

401. spacer 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT matches to MK510974 (Pseudomonas phage CF140, partial genome) position: , mismatch: 7, identity: 0.781

gacaccctcggctacaaccagttcgccaccaa	CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa	Protospacer
 .** * .*******.*********.******

402. spacer 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT matches to NC_007805 (Pseudomonas phage F10, complete genome) position: , mismatch: 7, identity: 0.781

gacaccctcggctacaaccagttcgccaccaa	CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa	Protospacer
 .** * .*******.*********.******

403. spacer 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT matches to MK510978 (Pseudomonas phage CF208, partial genome) position: , mismatch: 7, identity: 0.781

gacaccctcggctacaaccagttcgccaccaa	CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa	Protospacer
 .** * .*******.*********.******

404. spacer 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT matches to MK510988 (Pseudomonas phage BR299, partial genome) position: , mismatch: 7, identity: 0.781

gacaccctcggctacaaccagttcgccaccaa	CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa	Protospacer
 .** * .*******.*********.******

405. spacer 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT matches to MK510976 (Pseudomonas phage CF165, partial genome) position: , mismatch: 7, identity: 0.781

gacaccctcggctacaaccagttcgccaccaa	CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa	Protospacer
 .** * .*******.*********.******

406. spacer 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT matches to KM389229 (UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence) position: , mismatch: 7, identity: 0.781

gacaccctcggctacaaccagttcgccaccaa	CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa	Protospacer
 .** * .*******.*********.******

407. spacer 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT matches to MK510992 (Pseudomonas phage BR144, partial genome) position: , mismatch: 7, identity: 0.781

gacaccctcggctacaaccagttcgccaccaa	CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa	Protospacer
 .** * .*******.*********.******

408. spacer 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT matches to MK510975 (Pseudomonas phage CF145, partial genome) position: , mismatch: 7, identity: 0.781

gacaccctcggctacaaccagttcgccaccaa	CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa	Protospacer
 .** * .*******.*********.******

409. spacer 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT matches to MK510986 (Pseudomonas phage BR213, partial genome) position: , mismatch: 7, identity: 0.781

gacaccctcggctacaaccagttcgccaccaa	CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa	Protospacer
 .** * .*******.*********.******

410. spacer 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT matches to DQ163912 (Bacteriophage F10, complete genome) position: , mismatch: 7, identity: 0.781

gacaccctcggctacaaccagttcgccaccaa	CRISPR spacer
cgcagcaccggctacgaccagttcgtcaccaa	Protospacer
 .** * .*******.*********.******

411. spacer 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ctcgacgggttcgccgagaaggtgctacaccc	CRISPR spacer
ttcgtcgggttcgccgaggaggtgcggcagca	Protospacer
.*** *************.****** .** * 

412. spacer 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ctcgacgggttcgccgagaaggtgctacaccc	CRISPR spacer
ttcgtcgggttcgccgaggaggtgcggcagca	Protospacer
.*** *************.****** .** * 

413. spacer 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781

ctcgacgggttcgccgagaaggtgctacaccc	CRISPR spacer
ttcgtcgggttcgccgaggaggtgcggcagca	Protospacer
.*** *************.****** .** * 

414. spacer 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ctcgacgggttcgccgagaaggtgctacaccc	CRISPR spacer
ttcgtcgggttcgccgaggaggtgcggcagca	Protospacer
.*** *************.****** .** * 

415. spacer 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781

ctcgacgggttcgccgagaaggtgctacaccc	CRISPR spacer
ttcgtcgggttcgccgaggaggtgcggcagca	Protospacer
.*** *************.****** .** * 

416. spacer 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_LR699074 (Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2) position: , mismatch: 7, identity: 0.781

ctcgacgggttcgccgagaaggtgctacaccc-	CRISPR spacer
ggcgacgggttcgacgagatggtgc-gcacaca	Protospacer
  *********** ***** ***** .*** * 

417. spacer 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_LR699074 (Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2) position: , mismatch: 7, identity: 0.781

ctcgacgggttcgccgagaaggtgctacaccc-	CRISPR spacer
ggcgacgggttcgacgagatggtgc-gcacaca	Protospacer
  *********** ***** ***** .*** * 

418. spacer 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_LR699074 (Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2) position: , mismatch: 7, identity: 0.781

ctcgacgggttcgccgagaaggtgctacaccc-	CRISPR spacer
ggcgacgggttcgacgagatggtgc-gcacaca	Protospacer
  *********** ***** ***** .*** * 

419. spacer 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_LR699074 (Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2) position: , mismatch: 7, identity: 0.781

ctcgacgggttcgccgagaaggtgctacaccc-	CRISPR spacer
ggcgacgggttcgacgagatggtgc-gcacaca	Protospacer
  *********** ***** ***** .*** * 

420. spacer 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_LR699074 (Beijerinckiaceae bacterium RH AL1 isolate RH_AL1 plasmid 2) position: , mismatch: 7, identity: 0.781

ctcgacgggttcgccgagaaggtgctacaccc-	CRISPR spacer
ggcgacgggttcgacgagatggtgc-gcacaca	Protospacer
  *********** ***** ***** .*** * 

421. spacer 7.6|56304|31|NC_020894|CRISPRCasFinder,CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 7, identity: 0.774

gccacaatcgcgacctgttcgagaacaaggc	CRISPR spacer
agggctatcgcgacctgttcgagaacccggc	Protospacer
.  .* ********************  ***

422. spacer 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT matches to MH590604 (Microbacterium phage ColaCorta, complete genome) position: , mismatch: 7, identity: 0.781

-cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca	Protospacer
 .*** *  ****** ***.************ 

423. spacer 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT matches to MT553340 (Microbacterium phage Glamour, complete genome) position: , mismatch: 7, identity: 0.781

-cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca	Protospacer
 .*** *  ****** ***.************ 

424. spacer 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT matches to MN096378 (Microbacterium phage MCubed, complete genome) position: , mismatch: 7, identity: 0.781

-cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca	Protospacer
 .*** *  ****** ***.************ 

425. spacer 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT matches to MH513982 (Microbacterium phage Sansa, complete genome) position: , mismatch: 7, identity: 0.781

-cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca	Protospacer
 .*** *  ****** ***.************ 

426. spacer 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT matches to MK894432 (Microbacterium phage Finny, complete genome) position: , mismatch: 7, identity: 0.781

-cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca	Protospacer
 .*** *  ****** ***.************ 

427. spacer 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT matches to MH590606 (Microbacterium phage Andromedas, complete genome) position: , mismatch: 7, identity: 0.781

-cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca	Protospacer
 .*** *  ****** ***.************ 

428. spacer 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT matches to MG839027 (Microbacterium phage Eleri, complete genome) position: , mismatch: 7, identity: 0.781

-cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca	Protospacer
 .*** *  ****** ***.************ 

429. spacer 7.9|56486|32|NC_020894|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781

gccacggcctcccggccggagagcttgtgccg	CRISPR spacer
gccacggcgtcccggccggtgagcacccggcg	Protospacer
******** ********** **** . .* **

430. spacer 7.9|56486|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781

gccacggcctcccggccggagagcttgtgccg	CRISPR spacer
gccacggcgtcccggccggtgagcacccggcg	Protospacer
******** ********** **** . .* **

431. spacer 7.10|56547|32|NC_020894|CRISPRCasFinder,CRT matches to MK494108 (Mycobacterium phage Charm, complete genome) position: , mismatch: 7, identity: 0.781

gcgtcgtagaggcggcgatcgttgctgccctg---	CRISPR spacer
tcgtcgtagaggccgcgaccgttggt---ctgggc	Protospacer
 ************ ****.***** *   ***   

432. spacer 7.10|56547|32|NC_020894|CRISPRCasFinder,CRT matches to MN585974 (Mycobacterium phage DreamTeam1, complete genome) position: , mismatch: 7, identity: 0.781

gcgtcgtagaggcggcgatcgttgctgccctg---	CRISPR spacer
tcgtcgtagaggccgcgaccgttggt---ctgggc	Protospacer
 ************ ****.***** *   ***   

433. spacer 7.12|56669|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP026653 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggcagaccagggcgatgcgggaactgtcccgg	CRISPR spacer
ggcagaccagggcgatgcgcgagctgagcgcc	Protospacer
******************* **.***  *   

434. spacer 7.12|56669|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggcagaccagggcgatgcgggaactgtcccgg	CRISPR spacer
gtccagccagggcgatgcgggaatagtccccg	Protospacer
* * ..*****************. ***** *

435. spacer 7.12|56669|32|NC_020894|CRISPRCasFinder,CRT matches to NC_019387 (Thermus oshimai JL-2 plasmid pTHEOS01, complete sequence) position: , mismatch: 7, identity: 0.781

ggcagaccagggcgatgcgggaactgtcccgg--	CRISPR spacer
ggcagaccaggacgatgctggaa--gccagggcg	Protospacer
***********.****** ****  *.*  **  

436. spacer 7.17|56426|32|NC_020894|PILER-CR matches to MH590604 (Microbacterium phage ColaCorta, complete genome) position: , mismatch: 7, identity: 0.781

-cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca	Protospacer
 .*** *  ****** ***.************ 

437. spacer 7.17|56426|32|NC_020894|PILER-CR matches to MT553340 (Microbacterium phage Glamour, complete genome) position: , mismatch: 7, identity: 0.781

-cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca	Protospacer
 .*** *  ****** ***.************ 

438. spacer 7.17|56426|32|NC_020894|PILER-CR matches to MN096378 (Microbacterium phage MCubed, complete genome) position: , mismatch: 7, identity: 0.781

-cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca	Protospacer
 .*** *  ****** ***.************ 

439. spacer 7.17|56426|32|NC_020894|PILER-CR matches to MH513982 (Microbacterium phage Sansa, complete genome) position: , mismatch: 7, identity: 0.781

-cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca	Protospacer
 .*** *  ****** ***.************ 

440. spacer 7.17|56426|32|NC_020894|PILER-CR matches to MK894432 (Microbacterium phage Finny, complete genome) position: , mismatch: 7, identity: 0.781

-cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca	Protospacer
 .*** *  ****** ***.************ 

441. spacer 7.17|56426|32|NC_020894|PILER-CR matches to MH590606 (Microbacterium phage Andromedas, complete genome) position: , mismatch: 7, identity: 0.781

-cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca	Protospacer
 .*** *  ****** ***.************ 

442. spacer 7.17|56426|32|NC_020894|PILER-CR matches to MG839027 (Microbacterium phage Eleri, complete genome) position: , mismatch: 7, identity: 0.781

-cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
ctacggt-cgacctctcccccggcgcggcctca	Protospacer
 .*** *  ****** ***.************ 

443. spacer 7.18|56487|32|NC_020894|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781

gccacggcctcccggccggagagcttgtgccg	CRISPR spacer
gccacggcgtcccggccggtgagcacccggcg	Protospacer
******** ********** **** . .* **

444. spacer 7.18|56487|32|NC_020894|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781

gccacggcctcccggccggagagcttgtgccg	CRISPR spacer
gccacggcgtcccggccggtgagcacccggcg	Protospacer
******** ********** **** . .* **

445. spacer 7.19|56548|32|NC_020894|PILER-CR matches to MK494108 (Mycobacterium phage Charm, complete genome) position: , mismatch: 7, identity: 0.781

gcgtcgtagaggcggcgatcgttgctgccctg---	CRISPR spacer
tcgtcgtagaggccgcgaccgttggt---ctgggc	Protospacer
 ************ ****.***** *   ***   

446. spacer 7.19|56548|32|NC_020894|PILER-CR matches to MN585974 (Mycobacterium phage DreamTeam1, complete genome) position: , mismatch: 7, identity: 0.781

gcgtcgtagaggcggcgatcgttgctgccctg---	CRISPR spacer
tcgtcgtagaggccgcgaccgttggt---ctgggc	Protospacer
 ************ ****.***** *   ***   

447. spacer 7.21|56670|32|NC_020894|PILER-CR matches to NZ_CP026653 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggcagaccagggcgatgcgggaactgtcccgg	CRISPR spacer
ggcagaccagggcgatgcgcgagctgagcgcc	Protospacer
******************* **.***  *   

448. spacer 7.21|56670|32|NC_020894|PILER-CR matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggcagaccagggcgatgcgggaactgtcccgg	CRISPR spacer
gtccagccagggcgatgcgggaatagtccccg	Protospacer
* * ..*****************. ***** *

449. spacer 7.21|56670|32|NC_020894|PILER-CR matches to NC_019387 (Thermus oshimai JL-2 plasmid pTHEOS01, complete sequence) position: , mismatch: 7, identity: 0.781

ggcagaccagggcgatgcgggaactgtcccgg--	CRISPR spacer
ggcagaccaggacgatgctggaa--gccagggcg	Protospacer
***********.****** ****  *.*  **  

450. spacer 8.3|57198|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032827 (Sphingomonas sp. YZ-8 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

atcgagaa-----tcatttcgtcgtcgaccccgcgaa	CRISPR spacer
-----gaagcccttcatgtcgtcgtcgaccccgagaa	Protospacer
     ***     **** *************** ***

451. spacer 8.5|57321|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046903 (Pseudomonas stutzeri strain PM101005 plasmid p1_PM101005, complete sequence) position: , mismatch: 7, identity: 0.781

aggttcccgtactggcggagcggcaggccgaa	CRISPR spacer
cgatttgcgaactggcggagtggcaggccgca	Protospacer
 *.**. ** **********.********* *

452. spacer 8.6|57382|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_001387 (Streptomyces lividans plasmid pIJ101, complete sequence) position: , mismatch: 7, identity: 0.781

gtctggcccaactggtgccaggatcatcccca	CRISPR spacer
ctctggcccgattggtgccaggattcccacca	Protospacer
 ********.*.************. .* ***

453. spacer 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to MN585994 (Mycobacterium phage SheaKeira, complete genome) position: , mismatch: 7, identity: 0.781

-ggccgcatcaccggccccggcttcgaactgcg	CRISPR spacer
ggggcgt-tcaacggccccggctccgaactgta	Protospacer
 ** **. *** ***********.*******..

454. spacer 9.4|58094|31|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

gacgcgctcgtgaaggtggccaagcagtacc	CRISPR spacer
aacgcgctcatgaaggtggcgaagcgggccg	Protospacer
.********.********** ****.*  * 

455. spacer 9.4|58094|31|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_011273 (Mycobacterium phage Myrna, complete genome) position: , mismatch: 7, identity: 0.774

gacgcgctcgtgaaggtggccaagcagtacc	CRISPR spacer
ggcgacgtcgtgaaggtggccaacctgtact	Protospacer
*.**   **************** * ****.

456. spacer 9.4|58094|31|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to LR606149 (Rhizobium sp. Q54 genome assembly, plasmid: 6) position: , mismatch: 7, identity: 0.774

gacgcgctcgtgaaggtggccaagcagtacc	CRISPR spacer
gacgcgctcgtggagctggccaatgactcac	Protospacer
************.** *******  * *  *

457. spacer 9.6|58215|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

gaccctggt--accggatcaccgaccggtaccag	CRISPR spacer
--cccgcattaaccggatcatcgatcggtaccag	Protospacer
  ***  .*  *********.***.*********

458. spacer 9.7|58276|32|NC_020894|CRISPRCasFinder,CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 7, identity: 0.781

gcgac-tcgggccgccatcgaacgtgccgaggc	CRISPR spacer
-cgccgccaggccgccatcgaccgtggcgagga	Protospacer
 ** * .*.************ **** ***** 

459. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021375 (Rhizobium sp. ACO-34A plasmid pRACO34Aa, complete sequence) position: , mismatch: 7, identity: 0.781

gaaggcgcgatggccggacgccgggcgatcga-	CRISPR spacer
caaggcgctctggccggacgccgga-gatggcg	Protospacer
 *******  **************. *** *  

460. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
gcgccgaccatcaggccgaacgcgccaaggag	Protospacer
 ******* *************.***..  **

461. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.781

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
gcgccgaccatcaggccgaacgcgccaaggag	Protospacer
 ******* *************.***..  **

462. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to MH727561 (Mycobacterium phage Serendipitous, complete genome) position: , mismatch: 7, identity: 0.781

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
ccgatatggatcaggccgagcgtgctggtcag	Protospacer
*** ..  ***********.*****.******

463. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to MG711460 (Faecalibacterium phage FP_Mushu, complete genome) position: , mismatch: 7, identity: 0.781

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
ccgccgatgatcacgccgaacgtggtcgcccg	Protospacer
*******.***** ********** . *.* *

464. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NC_012849 (Ralstonia pickettii 12D plasmid pRp12D02, complete sequence) position: , mismatch: 7, identity: 0.781

ccgccgacgatcaggccgaacgtgccggtcag--	CRISPR spacer
tggtcgacggtcaggccgaacgtgtcg--cagta	Protospacer
. *.*****.**************.**  ***  

465. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
ccgccggcgagcaggccgaacgtcacgccgag	Protospacer
******.*** ************  ** . **

466. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NC_007766 (Rhizobium etli CFN 42 plasmid p42f, complete sequence) position: , mismatch: 7, identity: 0.781

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
gacgcatcgtctccgccgaccggcgcaccgcc	Protospacer
*  *    *** ********************

467. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
acgccttcgtcgccgccgccctgcgcaccgcc	Protospacer
.**  *  ********** ** **********

468. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tcgtggagttcgccgccgactggtgcaccgcc	Protospacer
 ** * .* ***********.**.********

469. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP028569 (Acinetobacter pittii strain WCHAP005046 plasmid p1_005046, complete sequence) position: , mismatch: 7, identity: 0.781

---gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tgcgcgaat---tcgacgccgaccggctcaccgcc	Protospacer
   ***..*   *** *********** *******

470. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to CP033559 (Acinetobacter nosocomialis strain 2012C01-137 plasmid p2012C01-137-2, complete sequence) position: , mismatch: 7, identity: 0.781

---gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tgcgcgaat---tcgacgccgaccggctcaccgcc	Protospacer
   ***..*   *** *********** *******

471. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to CP033551 (Acinetobacter nosocomialis strain 2014S01-097 plasmid p2014S01-097-1, complete sequence) position: , mismatch: 7, identity: 0.781

---gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tgcgcgaat---tcgacgccgaccggctcaccgcc	Protospacer
   ***..*   *** *********** *******

472. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to CP033546 (Acinetobacter nosocomialis strain 2014N23-120 plasmid p2014N23-120-1, complete sequence) position: , mismatch: 7, identity: 0.781

---gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tgcgcgaat---tcgacgccgaccggctcaccgcc	Protospacer
   ***..*   *** *********** *******

473. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.781

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
gcgacctgatcgccgccgacccgcgcgccgcc	Protospacer
***. . *.************ ****.*****

474. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP044357 (Acinetobacter baumannii strain CAM180-1 plasmid pCAM180A, complete sequence) position: , mismatch: 7, identity: 0.781

---gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tgcgcgaat---tcgacgccgaccggctcaccgcc	Protospacer
   ***..*   *** *********** *******

475. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NC_016978 (Comamonas testosteroni plasmid pI2, complete sequence) position: , mismatch: 7, identity: 0.781

--gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tgtcgggc--atcgccgccgacctgggcaccgcc	Protospacer
   ****.  .************ * ********

476. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP028139 (Acinetobacter baumannii strain NCIMB 8209 plasmid pAbNCIMB8209_134, complete sequence) position: , mismatch: 7, identity: 0.781

---gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tgcgcgaat---tcgacgccgaccggctcaccgcc	Protospacer
   ***..*   *** *********** *******

477. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 7, identity: 0.781

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
gatttcaatccagagcaagccggccgcgcgcg	Protospacer
 *****.********** *********   *.

478. spacer 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP017304 (Rhodococcus sp. YL-1 plasmid pYLL2 sequence) position: , mismatch: 7, identity: 0.781

gccctgcaccaccaccatttcgtcggccggcg	CRISPR spacer
gtgcatcaccatcaccatttcgtcggccgcag	Protospacer
*. *  *****.*****************  *

479. spacer 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021356 (Rhodococcus sp. S2-17 plasmid pRB29, complete sequence) position: , mismatch: 7, identity: 0.781

gccctgcaccaccaccatttcgtcggccggcg	CRISPR spacer
gtgcatgaccatgaccatttcgtcggccggcg	Protospacer
*. *   ****. *******************

480. spacer 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP050125 (Rhodococcus erythropolis strain KB1 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gccctgcaccaccaccatttcgtcggccggcg	CRISPR spacer
gtgcatcaccatcaccatttcgtcggccgctg	Protospacer
*. *  *****.***************** .*

481. spacer 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP046575 (Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence) position: , mismatch: 7, identity: 0.781

gccctgcaccaccaccatttcgtcggccggcg	CRISPR spacer
gtgcatgaccatgaccatttcgtcggccggcg	Protospacer
*. *   ****. *******************

482. spacer 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT matches to NC_005073 (Rhodococcus erythropolis linear plasmid pBD2, complete sequence) position: , mismatch: 7, identity: 0.781

gccctgcaccaccaccatttcgtcggccggcg	CRISPR spacer
gtgcatcaccatcaccatttcgtcggccgctg	Protospacer
*. *  *****.***************** .*

483. spacer 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781

gccctgcaccaccaccatttcgtcggccggcg	CRISPR spacer
gtgcatcaccatcaccatttcgtcggccgctg	Protospacer
*. *  *****.***************** .*

484. spacer 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP042915 (Rhodococcus qingshengii strain RL1 plasmid unnamed2) position: , mismatch: 7, identity: 0.781

gccctgcaccaccaccatttcgtcggccggcg	CRISPR spacer
gtgcatcaccatcaccatttcgtcggccgctg	Protospacer
*. *  *****.***************** .*

485. spacer 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP042915 (Rhodococcus qingshengii strain RL1 plasmid unnamed2) position: , mismatch: 7, identity: 0.781

gccctgcaccaccaccatttcgtcggccggcg	CRISPR spacer
gtgcatcaccatcaccatttcgtcggccgctg	Protospacer
*. *  *****.***************** .*

486. spacer 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 7, identity: 0.781

gccctgcaccaccaccatttcgtcggccggcg	CRISPR spacer
gtgcatcaccatcaccatttcgtccgccgggg	Protospacer
*. *  *****.************ ***** *

487. spacer 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP020385 (Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence) position: , mismatch: 7, identity: 0.781

gccctgcac-caccaccatttcgtcggccggcg	CRISPR spacer
-ctcgacgcgcaccaccatttcctcgggcggcg	Protospacer
 *.* .*.* ************ **** *****

488. spacer 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP009294 (Novosphingobium pentaromativorans US6-1 plasmid pLA1, complete sequence) position: , mismatch: 7, identity: 0.781

atcacccccgtgccgaacacgccgacgtcggt	CRISPR spacer
atcacccgcgtgccgaccacgccgcctacgtg	Protospacer
******* ******** ******* *  **  

489. spacer 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP044976 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-1, complete sequence) position: , mismatch: 7, identity: 0.781

atcacccccgtgccgaacacgccga--cgtcggt	CRISPR spacer
accaccgtcgtgccgaacacgccgaagcgctg--	Protospacer
*.**** .*****************  **..*  

490. spacer 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP044976 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-1, complete sequence) position: , mismatch: 7, identity: 0.781

atcacccccgtgccgaacacgccga--cgtcggt	CRISPR spacer
accaccgtcgtgccgaacacgccgaagcgctg--	Protospacer
*.**** .*****************  **..*  

491. spacer 1.2|40596|29|NC_020894|CRISPRCasFinder matches to NZ_CP011450 (Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence) position: , mismatch: 8, identity: 0.724

cgtggcgggctcaccggccgcgatgacct	CRISPR spacer
tatggcgggctcaccggcctcgacaaggc	Protospacer
..***************** ***..*  .

492. spacer 1.2|40596|29|NC_020894|CRISPRCasFinder matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 8, identity: 0.724

cgtggcgggctcaccggccgcgatgacct	CRISPR spacer
tatggcgggctcaccggcctcgacaaggc	Protospacer
..***************** ***..*  .

493. spacer 1.3|40655|31|NC_020894|CRISPRCasFinder matches to MH834602 (Microbacterium phage Brahms, complete genome) position: , mismatch: 8, identity: 0.742

agtgcctcgaagacgagggtggaggctgcgg	CRISPR spacer
gggtcgccgtagacgagggtggcggctgcga	Protospacer
.*  * .** ************ *******.

494. spacer 1.3|40655|31|NC_020894|CRISPRCasFinder matches to MN183281 (Microbacterium phage Vitas, complete genome) position: , mismatch: 8, identity: 0.742

agtgcctcgaagacgagggtggaggctgcgg	CRISPR spacer
gggtcgccgtagacgagggtggcggctgcga	Protospacer
.*  * .** ************ *******.

495. spacer 1.3|40655|31|NC_020894|CRISPRCasFinder matches to MH834604 (Microbacterium phage Coltrane, complete genome) position: , mismatch: 8, identity: 0.742

agtgcctcgaagacgagggtggaggctgcgg	CRISPR spacer
gggtcgccgtagacgagggtggcggctgcga	Protospacer
.*  * .** ************ *******.

496. spacer 1.3|40655|31|NC_020894|CRISPRCasFinder matches to MH834596 (Microbacterium phage Armstrong, complete genome) position: , mismatch: 8, identity: 0.742

agtgcctcgaagacgagggtggaggctgcgg	CRISPR spacer
gggtcgccgtagacgagggtggcggctgcga	Protospacer
.*  * .** ************ *******.

497. spacer 1.4|40716|31|NC_020894|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.742

cgggttgcgggggcgtggatggtcgtggtca	CRISPR spacer
gtggacaggggggcggggaaggtcgtggtca	Protospacer
  ** .. ******* *** ***********

498. spacer 1.5|40777|31|NC_020894|CRISPRCasFinder matches to KX815338 (Streptomyces phage Joe, complete genome) position: , mismatch: 8, identity: 0.742

cttcttggcggccttgttgatgcgcttcttg	CRISPR spacer
gctgttgacggccttgttgatgcgctccagc	Protospacer
 .* ***.******************.*   

499. spacer 1.6|40596|30|NC_020894|CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 8, identity: 0.733

cgtggcgggctcaccggccgcgatgacctc	CRISPR spacer
gagttcggtgtcaccggccgcgatgacctg	Protospacer
 .   ***  ******************* 

500. spacer 1.6|40596|30|NC_020894|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 8, identity: 0.733

cgtggcgggctcaccggccgcgatgacctc	CRISPR spacer
gcaggctggctccccggccgcgatgagcag	Protospacer
   *** ***** ************* *  

501. spacer 1.8|40716|32|NC_020894|CRT,PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.75

cgggttgcgggggcgtggatggtcgtggtcat	CRISPR spacer
gtggacaggggggcggggaaggtcgtggtcat	Protospacer
  ** .. ******* *** ************

502. spacer 1.8|40716|32|NC_020894|CRT,PILER-CR matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 8, identity: 0.75

cgggttgcgggggcgtggatggtcgtggtcat	CRISPR spacer
cgacatgcgggcgcgtggatggtcttggcccg	Protospacer
**.  ****** ************ ***.*  

503. spacer 1.9|40777|32|NC_020894|CRT,PILER-CR matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 8, identity: 0.75

cttcttggcggccttgttgatgcgcttcttgt	CRISPR spacer
ccgttcggtggccttgtcgatgcgcttctgga	Protospacer
*. .*.**.********.*********** * 

504. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 8, identity: 0.75

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
acaagcaggcgacggcgcacgggatcgtgggg	Protospacer
    *************** *.********  

505. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 8, identity: 0.75

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
acaagcaggcgacggcgcacgggatcgtgggg	Protospacer
    *************** *.********  

506. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
ggcggacggcgacggcgtaggagatggtggcc	Protospacer
 *. *  **********.******* *****.

507. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
ggcggacggcgacggcgtaggagatggtggcc	Protospacer
 *. *  **********.******* *****.

508. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034811 (Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

-tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
gcgat-caggcggcggcgcaggagttcgtgcgc	Protospacer
 .* * ******.*********** *****  .

509. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017078 (Novosphingobium resinovorum strain SA1 plasmid pSA3, complete sequence) position: , mismatch: 8, identity: 0.75

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
cgccgcacgcgacggcgcaggagaacgcgccc	Protospacer
.*..*** **************** **.* *.

510. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021031 (Rhizobium sp. NXC14 plasmid pRspNXC14a, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gtgcgccggcgagtcggccagggcgccggcag	Protospacer
* *    ***  *******************.

511. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP020910 (Rhizobium etli strain NXC12 plasmid pRetNXC12d, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gtgcgccggcgagtcggccagggcgccggcag	Protospacer
* *    ***  *******************.

512. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

513. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

514. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

515. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

516. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

517. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

518. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

519. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

520. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

521. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

522. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

523. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

524. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

525. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

526. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

527. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

528. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

529. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

530. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

531. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

532. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

533. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgcggccgctcgtcgggcggggcgccggcag	Protospacer
* *  *  ********* *.***********.

534. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcggtgagccttgtcggccagggcggagacgg	Protospacer
* ****** **.*************  *.*..

535. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to MK376954 (Gordonia phage WhoseManz, complete genome) position: , mismatch: 8, identity: 0.75

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
tcggcgaggctcgtcggccggggcgatgtcga	Protospacer
  **.**************.***** .* *.*

536. spacer 2.12|51424|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP037915 (Sphingomonas sp. AAP5 plasmid p150, complete sequence) position: , mismatch: 8, identity: 0.75

gagtccgggctgtgggcgttgaagggctacaa	CRISPR spacer
ccggccgcgctgtgggcgctgaagggctatcc	Protospacer
  * *** **********.**********.  

537. spacer 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgacgtcgcgttcgtgccgcgctccgcgtt	CRISPR spacer
gcgtgcgtcgcattcgtgccgcgctcggcgac	Protospacer
*.  .******.************** *** .

538. spacer 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgacgtcgcgttcgtgccgcgctccgcgtt	CRISPR spacer
gtcgacgccgcgttcatgccgcgtccgctgct	Protospacer
*******.*******.*******..*  .*.*

539. spacer 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP027794 (Rhodococcus hoagii strain DSSKP-R-001 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgacgtcgcgttcgtgccgcgctccgcgtt	CRISPR spacer
gcgagcatcgcgttcttgacgcgctccgcggt	Protospacer
*. ..*.******** ** *********** *

540. spacer 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75

gtcgacgtcgcgttcgtgccgcgctccgcgtt	CRISPR spacer
gcggggctcgcgctcgagccgcgctccgcgct	Protospacer
*. *.  *****.*** *************.*

541. spacer 2.14|51546|32|NC_020894|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.75

ccttgaccttgtcgaccttcatctcgaacagg	CRISPR spacer
tggcggctttttcgaccttcatctcgagcagg	Protospacer
.  .*.*.** ****************.****

542. spacer 2.14|51546|32|NC_020894|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ccttgaccttgtcgaccttcatctcgaacagg	CRISPR spacer
tggcggctttttcgaccttcatctcgagcagg	Protospacer
.  .*.*.** ****************.****

543. spacer 2.14|51546|32|NC_020894|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ccttgaccttgtcgaccttcatctcgaacagg	CRISPR spacer
ccttggccttggcgaccttcatcccttcgcgg	Protospacer
*****.***** ***********.*     **

544. spacer 3.3|51938|32|NC_020894|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75

agttgcagacgctcccgctcgccgctcaccag	CRISPR spacer
ggctgctgacgctgccgctcgccgctcccgtc	Protospacer
.*.*** ****** ************* *   

545. spacer 3.4|51999|32|NC_020894|CRISPRCasFinder matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cccgccgcgctcgccctggccactctgggcat	CRISPR spacer
caggccgcgctcgccctggccgccctcaccac	Protospacer
*  ******************.*.** . **.

546. spacer 3.4|51999|32|NC_020894|CRISPRCasFinder matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

cccgccgcgctcgccctggccactctgggcat	CRISPR spacer
caggccgcgctcgccctggccgccctcaccac	Protospacer
*  ******************.*.** . **.

547. spacer 3.4|51999|32|NC_020894|CRISPRCasFinder matches to NC_017771 (Deinococcus gobiensis I-0 plasmid P3, complete sequence) position: , mismatch: 8, identity: 0.75

cccgccgcgctcgccctggccactctgggcat	CRISPR spacer
cccgatgcgctcgccctggccacaccgaccgc	Protospacer
**** .***************** *.*. *..

548. spacer 3.4|51999|32|NC_020894|CRISPRCasFinder matches to NZ_CP016821 (Rhodococcus sp. p52 plasmid pDF01, complete sequence) position: , mismatch: 8, identity: 0.75

cccgccgcgctcgccctggccactctgggcat	CRISPR spacer
caggccgcgctcgccctggccgccctcaccac	Protospacer
*  ******************.*.** . **.

549. spacer 3.4|51999|32|NC_020894|CRISPRCasFinder matches to NZ_CP038031 (Rhodococcus ruber strain R1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cccgccgcgctcgccctggccactctgggcat	CRISPR spacer
caggccgcgctcgccctggccgccctcaccac	Protospacer
*  ******************.*.** . **.

550. spacer 3.4|51999|32|NC_020894|CRISPRCasFinder matches to MH744423 (Mycobacterium phage Saguaro, complete genome) position: , mismatch: 8, identity: 0.75

cccgccgcgctcgccctggccactctgggcat	CRISPR spacer
cccgccgggctggccctggccacctccgacaa	Protospacer
******* *** ***********... *.** 

551. spacer 3.4|51999|32|NC_020894|CRISPRCasFinder matches to KU998247 (Gordonia phage Bachita, complete genome) position: , mismatch: 8, identity: 0.75

cccgccgcgctcgccctggccactctgggcat	CRISPR spacer
cccgccgcgcgcgcccgggccacacagtcgac	Protospacer
********** ***** ****** * *   *.

552. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 8, identity: 0.75

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
gcgatggcacgcaccatcgccgacacccaaca	Protospacer
  *..***.******.*************  *

553. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 8, identity: 0.75

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
gcgatggcacgcaccatcgccgacacccaaca	Protospacer
  *..***.******.*************  *

554. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_CP046575 (Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence) position: , mismatch: 8, identity: 0.75

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
gcgatggcacgcaccatcgccgacacccagca	Protospacer
  *..***.******.*************  *

555. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
tcgtcgcggcccaccgtcgccgccacccacgc	Protospacer
. * **  ** *********** ******** 

556. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 8, identity: 0.75

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
ctgacggtgcgcaccttcgccgacaccgtccg	Protospacer
* *.***.******* ***********  * .

557. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
gaggcggcccgcaccgtcgacgacgtgcgcaa	Protospacer
 ******* ********** ****.. *.*.*

558. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NC_011990 (Agrobacterium radiobacter K84 plasmid pAtK84b, complete sequence) position: , mismatch: 8, identity: 0.75

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
cgcgaggcgcgcaccgtcgactacacccgtaa	Protospacer
*. * ************** * ******...*

559. spacer 3.10|52365|31|NC_020894|CRISPRCasFinder matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742

ccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
aaagccgcgtggtggccgaacgggtgcgccg	Protospacer
  . * .**************** ****** 

560. spacer 3.10|52365|31|NC_020894|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.742

ccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
cggaattcgtggtggacgaacggctgcgcga	Protospacer
* *    ******** *************  

561. spacer 3.10|52365|31|NC_020894|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.742

ccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
cggaattcgtggtggacgaacggctgcgcga	Protospacer
* *    ******** *************  

562. spacer 3.10|52365|31|NC_020894|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.742

ccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
tggtcgccgtggtgtcggaacggctgcgcca	Protospacer
. *.*. ******* * ************* 

563. spacer 3.10|52365|31|NC_020894|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.742

ccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
tggtcgccgtggtgtcggaacggctgcgcca	Protospacer
. *.*. ******* * ************* 

564. spacer 3.10|52365|31|NC_020894|CRISPRCasFinder matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 8, identity: 0.742

ccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
tggtcgccgtggtgtcggaacggctgcgcca	Protospacer
. *.*. ******* * ************* 

565. spacer 3.11|52425|32|NC_020894|CRISPRCasFinder matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 8, identity: 0.75

tggcggtgcatgcccgtgctcaccggc--gccag	CRISPR spacer
aactggtggaggcccgtgctcaccggcaagcc--	Protospacer
 . .**** * ****************  ***  

566. spacer 3.19|52177|37|NC_020894|CRT matches to NC_004719 (Streptomyces avermitilis MA-4680 = NBRC 14893 plasmid SAP1, complete sequence) position: , mismatch: 8, identity: 0.784

atccccaggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
agagcgcggccgcgcgcaccgtcgccgacacgcacgc	Protospacer
*   *  *** ******************** **** 

567. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to MH588547 (Caulobacter phage CcrSC, complete genome) position: , mismatch: 8, identity: 0.75

ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
acctacgaactcgaccacaccgacgccccgga	Protospacer
. ..* **** **.****************.*

568. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to MH588547 (Caulobacter phage CcrSC, complete genome) position: , mismatch: 8, identity: 0.75

ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
acctacgaactcgaccacaccgacgccccgga	Protospacer
. ..* **** **.****************.*

569. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 8, identity: 0.75

ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
acctacgaactcgaccacaccgacgccccgga	Protospacer
. ..* **** **.****************.*

570. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 8, identity: 0.75

ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
acctacgaactcgaccacaccgacgccccgga	Protospacer
. ..* **** **.****************.*

571. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to NZ_CP011453 (Altererythrobacter atlanticus strain 26DY36 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
ggtcagcaacgtggccacaccgaagatgccga	Protospacer
****** ****.*********** * . * .*

572. spacer 4.2|53070|32|NC_020894|CRISPRCasFinder matches to NC_011962 (Rhodobacter sphaeroides KD131 plasmid pRSKD131A, complete sequence) position: , mismatch: 8, identity: 0.75

gtcttctcgatcatctcgtccgtgttcaccgc	CRISPR spacer
ggcttctcgatcatctcggccgggtcctgggg	Protospacer
* **************** *** **.*   * 

573. spacer 4.2|53070|32|NC_020894|CRISPRCasFinder matches to NZ_CP027930 (Microbacterium sp. SGAir0570 plasmid pSGAir0570_2, complete sequence) position: , mismatch: 8, identity: 0.75

gtcttctcgatcatctcgtccgtgttcaccgc	CRISPR spacer
gccttctcgatcagctcgtccgcgtacgcgct	Protospacer
*.*********** ********.** *.*  .

574. spacer 4.3|53131|32|NC_020894|CRISPRCasFinder matches to NZ_CP033873 (Caulobacter sp. FWC26 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

ccagggaccgcgtcgtcagcggccacaccccg	CRISPR spacer
gccaggtgagcgtccacagcggccacaccccg	Protospacer
 * .**   *****  ****************

575. spacer 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75

ccgctcagctcgcaccgccgggcggcgcggac	CRISPR spacer
tctacctgatcggaccgccgggcggcgaggac	Protospacer
.*  .* * *** ************** ****

576. spacer 6.4|55409|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

gacatgcgctcgcccctggaacggcaagggcg	CRISPR spacer
gcctgctgctcgctccgggaacggcaagggcc	Protospacer
* *   .******.** ************** 

577. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP020811 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
gacgaactcgtcggcggccgccaggacctcac	Protospacer
 *     ********* ********** ****

578. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.75

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
cacggccgggtcggcgtccgcccggacgtcac	Protospacer
**   *   ************* ****.****

579. spacer 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT matches to NC_030931 (Pseudomonas phage phi2, complete genome) position: , mismatch: 8, identity: 0.75

gacaccctcggctacaaccagttcgccaccaa	CRISPR spacer
cgcggcaccggctacgaccagttcgtcaccaa	Protospacer
 .*. * .*******.*********.******

580. spacer 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgacgggttcgccgagaaggtgctacaccc	CRISPR spacer
ctcgacgagttcgccgacaaggtcgttccgct	Protospacer
*******.********* *****  * *  *.

581. spacer 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP041044 (Paracoccus sp. AK26 plasmid pAK2, complete sequence) position: , mismatch: 8, identity: 0.75

ctcgacgggttcgccgagaaggtgctacaccc	CRISPR spacer
ttcgacgggttcggcgacaaggtggaattcct	Protospacer
.************ *** ******  *. **.

582. spacer 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75

tccggtcgtgcacgactgcgccgactgcggac	CRISPR spacer
cccggtcgtcctcgactgcgccgaccaggccc	Protospacer
.******** * *************.. *  *

583. spacer 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75

tccggtcgtgcacgactgcgccgactgcggac	CRISPR spacer
cccggtcgtcctcgactgcgccgaccaggccc	Protospacer
.******** * *************.. *  *

584. spacer 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.75

tccggtcgtgcacgactgcgccgactgcggac	CRISPR spacer
tccggacgtgcacgaatgcgccgtcatggcgc	Protospacer
***** ********* ******* *   * .*

585. spacer 7.7|56364|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.75

gctcctaggtggggtgcccgccggggacgtgg	CRISPR spacer
ccgacgaggtggggtgccggccggggccgaag	Protospacer
 *  * ************ ******* ** .*

586. spacer 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT matches to MT657343 (Microbacterium phage GaeCeo, complete genome) position: , mismatch: 8, identity: 0.75

cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
agagctgggacctcaccttcggcacggtcggc	Protospacer
 . **************.*****.***.*  *

587. spacer 7.15|56304|32|NC_020894|PILER-CR matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 8, identity: 0.75

ggccacaatcgcgacctgttcgagaacaaggc	CRISPR spacer
aagggctatcgcgacctgttcgagaacccggc	Protospacer
..  .* ********************  ***

588. spacer 7.16|56365|32|NC_020894|PILER-CR matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.75

gctcctaggtggggtgcccgccggggacgtgg	CRISPR spacer
ccgacgaggtggggtgccggccggggccgaag	Protospacer
 *  * ************ ******* ** .*

589. spacer 7.17|56426|32|NC_020894|PILER-CR matches to MT657343 (Microbacterium phage GaeCeo, complete genome) position: , mismatch: 8, identity: 0.75

cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
agagctgggacctcaccttcggcacggtcggc	Protospacer
 . **************.*****.***.*  *

590. spacer 8.3|57198|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048426 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

atcgagaatcatttcgtcgtcgaccccgcgaa	CRISPR spacer
ggccttgatcatctcgttgtcgaccccgcgaa	Protospacer
. *   .*****.****.**************

591. spacer 8.5|57321|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

aggttcc--cgtactggcggagcggcaggccgaa	CRISPR spacer
--gctgcgatgtactggccgagccgcaggccgat	Protospacer
  *.* *  .******** **** ********* 

592. spacer 8.5|57321|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to MG592544 (Vibrio phage 1.177.O._10N.286.45.E10, partial genome) position: , mismatch: 8, identity: 0.75

aggttcccgtactggcggagcggcaggccgaa	CRISPR spacer
aatctccagtactggcggagcggctggttcaa	Protospacer
*. .*** **************** **.. **

593. spacer 9.1|57911|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 8, identity: 0.75

accgcgaccttccggtggagggcgtgcagttc	CRISPR spacer
gccgcgggcttccggtggagggcgtctcggcc	Protospacer
.*****. ***************** . * .*

594. spacer 9.1|57911|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 8, identity: 0.75

accgcgaccttccggtggagggcgtgcagttc	CRISPR spacer
tcgtcgaccttccggtggagggagcgcctttg	Protospacer
 *  ****************** *.**  ** 

595. spacer 9.1|57911|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.75

accgcgaccttccggtggagggcgtgcagttc	CRISPR spacer
tcgtcgaccttccggtggagggagcgcctttg	Protospacer
 *  ****************** *.**  ** 

596. spacer 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 8, identity: 0.75

ggccgcatcaccggccccggcttcgaactgcg-	CRISPR spacer
atccgcaccaccggccacggcttcg-tcggcat	Protospacer
. *****.******** ********  * **. 

597. spacer 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 8, identity: 0.75

ggccgcatcaccggccccggcttcgaactgcg-	CRISPR spacer
atccgcaccaccggccacggcttcg-tcggcat	Protospacer
. *****.******** ********  * **. 

598. spacer 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 8, identity: 0.75

ggccgcatcaccggccccggcttcgaactgcg-	CRISPR spacer
atccgcaccaccggccacggcttcg-tcggcat	Protospacer
. *****.******** ********  * **. 

599. spacer 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 8, identity: 0.75

ggccgcatcaccggccccggcttcgaactgcg	CRISPR spacer
gacgacggcaccggcccccgcttcgcactgcc	Protospacer
*.* .*. ********** ****** ***** 

600. spacer 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047177 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ggccgcatcaccggccccggcttcgaactgcg	CRISPR spacer
gcgcgcatcaccggcgccggcgtcgacgagag	Protospacer
*  ************ ***** ****   * *

601. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
gttcccgaggccgccgccgcgtcgcgcgcccg	Protospacer
   **  ***********.***********. 

602. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.75

tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
ccatcgcagtccgccgccacgtggcgcgcgcc	Protospacer
. *.***** ************ ****** ..

603. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR536451 (Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 2) position: , mismatch: 8, identity: 0.75

tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
agcccgcaggccgcctccacctcgcgccacag	Protospacer
 * ************ **** ******  *  

604. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
cgctcgccggccgccaccacgtcgcgcgggtg	Protospacer
.* .*** *******.************  * 

605. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.75

--tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
cccggcag--ggccgccgccgcgtcgcgcggctg	Protospacer
  .*.* *  **********.********* ** 

606. spacer 9.7|58276|32|NC_020894|CRISPRCasFinder,CRT matches to MN234226 (Mycobacterium phage Curiosium, complete genome) position: , mismatch: 8, identity: 0.75

gcgactcgggccgccatcgaacgtgccgaggc	CRISPR spacer
gtgatcgctgccgccgtcgagcgtgccgaggc	Protospacer
*.**..   ******.****.***********

607. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NC_014818 (Asticcacaulis excentricus CB 48 plasmid pASTEX01, complete sequence) position: , mismatch: 8, identity: 0.75

gaaggcgcgatggccggacgccgggcgatcga--	CRISPR spacer
agcggcgcgctggccagacgccgggc--ccgatg	Protospacer
.. ****** *****.**********  .***  

608. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 8, identity: 0.75

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
gtcggaatgatggccggatcccgggcgatcgg	Protospacer
*  ** ..**********. ***********.

609. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
gcgccgacgatcaggcagaccgtgcagtcgaa	Protospacer
 *************** ** ***** * . *.

610. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.75

ccgccgacgatcaggccgaacgtgc--cggtcag	CRISPR spacer
gggccgtcgatcaggccgaacctgcggtggcc--	Protospacer
  **** ************** ***  .**.*  

611. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.75

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
ggaccagcgatcaggccgaacggaccggtcaa	Protospacer
  .**..*************** .*******.

612. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.75

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
ggaccagcgatcaggccgaacggaccggtcaa	Protospacer
  .**..*************** .*******.

613. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 8, identity: 0.75

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
gcgccgacgatcaggcagaccgtgcagtcgaa	Protospacer
 *************** ** ***** * . *.

614. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 8, identity: 0.75

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
ctcgccacgataaggccgatcgtgccggtgac	Protospacer
*.  * ***** ******* ********* * 

615. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 8, identity: 0.75

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ctcgcatcgtctccgccgaccggcgcaccgcc	Protospacer
 . *    *** ********************

616. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.75

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ctcgcatcgtctccgccgaccggcgcaccgcc	Protospacer
 . *    *** ********************

617. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NC_007949 (Polaromonas sp. JS666 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ctgggtggctcgcggccgaccggcgcatgccg	Protospacer
 .****** **** *************.  * 

618. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_LR134449 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 7, complete sequence) position: , mismatch: 8, identity: 0.75

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tccgccggatcgccgccggccggcgcaccgtt	Protospacer
 * * .**.*********.***********..

619. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.75

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
aagcccgcgtcgtcgccgaccagcgcaccgcc	Protospacer
. *  .* ****.********.**********

620. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP042995 (Acinetobacter nosocomialis strain J1A plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

---gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tgcacgaat---tcgacgccgaccggctcaccgcc	Protospacer
   .**..*   *** *********** *******

621. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_KX426229 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.1, complete sequence) position: , mismatch: 8, identity: 0.75

---gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tgcacgaat---tcgacgccgaccggctcaccgcc	Protospacer
   .**..*   *** *********** *******

622. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

-gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
cgcaga-aaatcgccgccgacctgcgcacggcc	Protospacer
 **.*. ...************ ****** ***

623. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to CP033573 (Acinetobacter nosocomialis strain 2010N17-248 plasmid p2010N17-248, complete sequence) position: , mismatch: 8, identity: 0.75

---gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tgcacgaat---tcgacgccgaccggctcaccgcc	Protospacer
   .**..*   *** *********** *******

624. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgggtg-ggtcgccgccgaccggcgcaccgcc	CRISPR spacer
-cgaacgcggtcggcgccgacgggcgcaccgtg	Protospacer
 **...* ***** ******* *********. 

625. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to CP019144 (Acinetobacter lwoffii strain ZS207 plasmid pmZS, complete sequence) position: , mismatch: 8, identity: 0.75

---gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tgcacgaat---tcgacgccgaccggctcaccgcc	Protospacer
   .**..*   *** *********** *******

626. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP026129 (Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence) position: , mismatch: 8, identity: 0.75

---gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tgcacgaat---tcgacgccgaccggctcaccgcc	Protospacer
   .**..*   *** *********** *******

627. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gcgggtg-ggtcgccgccgaccggcgcaccgcc	CRISPR spacer
-tggacgcggtcgccgccgacctgcgcgccgag	Protospacer
 .**..* ************** ****.***  

628. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 8, identity: 0.75

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
gcccgatcatcgccgccgcccgccgcaccgcc	Protospacer
**  *   .********* *** *********

629. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_AP018825 (Acinetobacter ursingii strain M3 plasmid pAURM-1, complete sequence) position: , mismatch: 8, identity: 0.75

---gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tgcacgaat---tcgacgccgaccggctcaccgcc	Protospacer
   .**..*   *** *********** *******

630. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP032290 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.6, complete sequence) position: , mismatch: 8, identity: 0.75

---gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tgcacgaat---tcgacgccgaccggctcaccgcc	Protospacer
   .**..*   *** *********** *******

631. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to FJ937737 (Burkholderia cenocepacia phage BcepIL02, complete genome) position: , mismatch: 8, identity: 0.75

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
gaagtcgatccagcgcccgccggccgccgtgc	Protospacer
 *  ********* ** ************.  

632. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to NC_012743 (Burkholderia phage BcepIL02, complete genome) position: , mismatch: 8, identity: 0.75

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
gaagtcgatccagcgcccgccggccgccgtgc	Protospacer
 *  ********* ** ************.  

633. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

catttcg---atccagagcacgccggccgccgcca	CRISPR spacer
---gtcgggtgcccagagcaggcccgccgccgcca	Protospacer
    ***   ..******** *** **********

634. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to NC_009939 (Deinococcus geothermalis DSM 11300 plasmid pDGEO02, complete sequence) position: , mismatch: 8, identity: 0.75

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
cagcgggtaccagagcacgccgcccgcagcca	Protospacer
** .  *  ************* **** ****

635. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP011666 (Streptomyces sp. Mg1 plasmid pSMg1-2, complete sequence) position: , mismatch: 8, identity: 0.75

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
gaagtggctccagaacaccccggccgccgccc	Protospacer
 *  * * ******.*** ************ 

636. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to MK494124 (Mycobacterium phage Kristoff, complete genome) position: , mismatch: 8, identity: 0.75

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
caacacgatccaggtcacgccggccgccatcg	Protospacer
** . ********. *************..*.

637. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to MN586038 (Mycobacterium phage WalterMcMickey, complete genome) position: , mismatch: 8, identity: 0.75

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
caacacgatccaggtcacgccggccgccatcg	Protospacer
** . ********. *************..*.

638. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to JX411619 (Mycobacterium virus Rebeuca, complete genome) position: , mismatch: 8, identity: 0.75

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
caacacgatccaggtcacgccggccgccatcg	Protospacer
** . ********. *************..*.

639. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to NC_041982 (Mycobacterium phage Twister, complete genome) position: , mismatch: 8, identity: 0.75

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
caacacgatccaggtcacgccggccgccatcg	Protospacer
** . ********. *************..*.

640. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to MT522002 (Mycobacterium phage Topanga, complete genome) position: , mismatch: 8, identity: 0.75

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
caacacgatccaggtcacgccggccgccatcg	Protospacer
** . ********. *************..*.

641. spacer 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 8, identity: 0.75

gccctgcaccaccaccatttcgtcggccggcg	CRISPR spacer
tccctgcaccaccatcatttggtccgtgggat	Protospacer
 *************.***** *** *. **  

642. spacer 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT matches to KM659098 (Sinorhizobium sp. LM21 plasmid pLM21S1, complete sequence) position: , mismatch: 8, identity: 0.75

gccctgcaccaccaccatttcgtcggccggcg	CRISPR spacer
aacgttcggcaccaccttttcgccggccggcg	Protospacer
. * * *. ******* *****.*********

643. spacer 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT matches to NC_019917 (Burkholderia phage BcepMigl, complete genome) position: , mismatch: 8, identity: 0.75

atcacccccgtgccgaacacgccgacgtcggt	CRISPR spacer
gcgggcgccgtgccgaacacgctgacgtcgga	Protospacer
.. . * ***************.******** 

644. spacer 1.2|40596|29|NC_020894|CRISPRCasFinder matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.69

cgtggcgggctcaccggccgcgatgacct	CRISPR spacer
cgtggcgggctgaccggccgcaggagtgc	Protospacer
*********** *********.. ... .

645. spacer 1.5|40777|31|NC_020894|CRISPRCasFinder matches to NZ_CP015204 (Rhodococcus sp. 008 plasmid pR8C1, complete sequence) position: , mismatch: 9, identity: 0.71

cttcttggcggccttgttgatgcgcttcttg	CRISPR spacer
tttctcggcggccttgtcgatgcggcgcaac	Protospacer
.****.***********.****** . *   

646. spacer 1.5|40777|31|NC_020894|CRISPRCasFinder matches to MN703407 (Microbacterium phage Leaf, complete genome) position: , mismatch: 9, identity: 0.71

cttcttggcggccttgttgatgcgcttcttg	CRISPR spacer
gcgcgcggccgccttgttgttgcgcttctgc	Protospacer
 . * .*** ********* *********  

647. spacer 1.5|40777|31|NC_020894|CRISPRCasFinder matches to MN703414 (Microbacterium phage Dewdrop, complete genome) position: , mismatch: 9, identity: 0.71

cttcttggcggccttgttgatgcgcttcttg	CRISPR spacer
gcgcgcggccgccttgttgttgcgcttctgc	Protospacer
 . * .*** ********* *********  

648. spacer 1.6|40596|30|NC_020894|CRT matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 9, identity: 0.7

cgtggcgggctcaccggccgcgatgacctc	CRISPR spacer
tatggcgggctcaccggcctcgacaaggca	Protospacer
..***************** ***..*  . 

649. spacer 1.6|40596|30|NC_020894|CRT matches to NZ_CP011450 (Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence) position: , mismatch: 9, identity: 0.7

cgtggcgggctcaccggccgcgatgacctc	CRISPR spacer
tatggcgggctcaccggcctcgacaaggca	Protospacer
..***************** ***..*  . 

650. spacer 1.6|40596|30|NC_020894|CRT matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 9, identity: 0.7

cgtggcgggctcaccggccgcgatgacctc	CRISPR spacer
actggcgggctcgccggccgcgagcctgcc	Protospacer
  **********.**********   . .*

651. spacer 1.7|40655|32|NC_020894|CRT,PILER-CR matches to MH834602 (Microbacterium phage Brahms, complete genome) position: , mismatch: 9, identity: 0.719

agtgcctcgaagacgagggtggaggctgcggc	CRISPR spacer
gggtcgccgtagacgagggtggcggctgcgat	Protospacer
.*  * .** ************ *******..

652. spacer 1.7|40655|32|NC_020894|CRT,PILER-CR matches to MN183281 (Microbacterium phage Vitas, complete genome) position: , mismatch: 9, identity: 0.719

agtgcctcgaagacgagggtggaggctgcggc	CRISPR spacer
gggtcgccgtagacgagggtggcggctgcgat	Protospacer
.*  * .** ************ *******..

653. spacer 1.7|40655|32|NC_020894|CRT,PILER-CR matches to MH834604 (Microbacterium phage Coltrane, complete genome) position: , mismatch: 9, identity: 0.719

agtgcctcgaagacgagggtggaggctgcggc	CRISPR spacer
gggtcgccgtagacgagggtggcggctgcgat	Protospacer
.*  * .** ************ *******..

654. spacer 1.7|40655|32|NC_020894|CRT,PILER-CR matches to MH834596 (Microbacterium phage Armstrong, complete genome) position: , mismatch: 9, identity: 0.719

agtgcctcgaagacgagggtggaggctgcggc	CRISPR spacer
gggtcgccgtagacgagggtggcggctgcgat	Protospacer
.*  * .** ************ *******..

655. spacer 1.9|40777|32|NC_020894|CRT,PILER-CR matches to MN703407 (Microbacterium phage Leaf, complete genome) position: , mismatch: 9, identity: 0.719

cttcttggcggccttgttgatgcgcttcttgt	CRISPR spacer
gcgcgcggccgccttgttgttgcgcttctgct	Protospacer
 . * .*** ********* *********  *

656. spacer 1.9|40777|32|NC_020894|CRT,PILER-CR matches to MN703414 (Microbacterium phage Dewdrop, complete genome) position: , mismatch: 9, identity: 0.719

cttcttggcggccttgttgatgcgcttcttgt	CRISPR spacer
gcgcgcggccgccttgttgttgcgcttctgct	Protospacer
 . * .*** ********* *********  *

657. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134467 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 25, complete sequence) position: , mismatch: 9, identity: 0.719

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
tcgcggcggcgacggcggagcagatcgtggtg	Protospacer
*  .*  ********** ** *********. 

658. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 9, identity: 0.719

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
agacggtcgcgacggcgcaggcgaacgtggcg	Protospacer
 * .*   ************* ** ****** 

659. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 9, identity: 0.719

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
cggcggccgcgatggcgcaggagaccgtggcc	Protospacer
.* .*   ****.***********.******.

660. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.719

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
cgccagaggctggtcggccaggacgccggccc	Protospacer
 .   ****** **********.*******  

661. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.719

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
cgccagaggctggtcggccaggacgccggccc	Protospacer
 .   ****** **********.*******  

662. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.719

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcccgcgggctcgccggccggggcgccggcca	Protospacer
*     .******.*****.********** *

663. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
ggtgtgaggctcggcggccaaggcgccatatc	Protospacer
*. ********** ******.******.    

664. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
tcgctgaggctggtcggcgagggcgccgaact	Protospacer
  * ******* ****** *********.   

665. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 9, identity: 0.719

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
tggcagagcctcgtcggccagggcggcgacgg	Protospacer
 .*  *** **************** **.*..

666. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.719

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gccggtcggctcgtcggccaggacgacggcgg	Protospacer
*  *   ***************.** ****..

667. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
aacagggaactcgtcggccagggcaccgccaa	Protospacer
.* . *...***************.*** ***

668. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
atcgaagggctcgtcgtcaagggcgccggcga	Protospacer
.  * ..********* * ***********.*

669. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 9, identity: 0.719

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gccggtcggctcgtcggccaggacgacggcgg	Protospacer
*  *   ***************.** ****..

670. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 9, identity: 0.719

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gccggtcggctcgtcggccaggacgacggcgg	Protospacer
*  *   ***************.** ****..

671. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 9, identity: 0.719

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gccggtcggctcgtcggccaggacgacggcgg	Protospacer
*  *   ***************.** ****..

672. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 9, identity: 0.719

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcccggccgctcgtcggccgcggcgccggcat	Protospacer
*    *  ***********. ********** 

673. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.719

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
gcgaactggctcgtcggccagtgcgacggccc	Protospacer
* *.   ************** *** ****  

674. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to JX042579 (Mycobacterium virus MacnCheese, complete genome) position: , mismatch: 9, identity: 0.719

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
cccgtcggggtcgtcggccagggcgccagcct	Protospacer
   ** .** *****************.**  

675. spacer 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP052758 (Cellulosimicrobium sp. BI34T plasmid pCPRO01, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgacgtcgcgttcgtgccgcgctccgcgtt	CRISPR spacer
gagcgcgtcgcgctcgtgccgcgcgccgggga	Protospacer
*   .*******.*********** *** *  

676. spacer 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgacgtcgcgttcgtgccgcgctccgcgtt	CRISPR spacer
aaggccgtcgcgatcgtgccgcgcgccgggga	Protospacer
.  * ******* *********** *** *  

677. spacer 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgacgtcgcgttcgtgccgcgctccgcgtt	CRISPR spacer
aaggccgtcgcgatcgtgccgcgcgccgggga	Protospacer
.  * ******* *********** *** *  

678. spacer 2.13|51485|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

gtcgacgtcgcgttcgtgccgcgctccgcgtt	CRISPR spacer
aaggccgtcgcgatcgtgccgcgcgccgggga	Protospacer
.  * ******* *********** *** *  

679. spacer 3.3|51938|32|NC_020894|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.719

agttgcagacgctcccgctcgccgctcaccag	CRISPR spacer
gattgctgacgctgccgctcgccgcccccgtc	Protospacer
..**** ****** ***********.* *   

680. spacer 3.3|51938|32|NC_020894|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 9, identity: 0.719

agttgcagacgctcccgctcgccgctcaccag	CRISPR spacer
gattgctgacgctgccgctcgccgcccccgtc	Protospacer
..**** ****** ***********.* *   

681. spacer 3.4|51999|32|NC_020894|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cccgccgcgctcgccctggccactctgggcat	CRISPR spacer
ctggccgcgctggccctggccgctctcacgac	Protospacer
*. ******** *********.**** .  *.

682. spacer 3.4|51999|32|NC_020894|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cccgccgcgctcgccctggccactctgggcat	CRISPR spacer
ctggccgcgctggccctggccgctctcacgac	Protospacer
*. ******** *********.**** .  *.

683. spacer 3.4|51999|32|NC_020894|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cccgccgcgctcgccctggccactctgggcat	CRISPR spacer
ctggccgcgctggccctggccgctctcacgac	Protospacer
*. ******** *********.**** .  *.

684. spacer 3.4|51999|32|NC_020894|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cccgccgcgctcgccctggccactctgggcat	CRISPR spacer
ctggccgcgctggccctggccgctctcacgac	Protospacer
*. ******** *********.**** .  *.

685. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 9, identity: 0.719

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
tataacttcggcaaggcggccggtgctatcgc	Protospacer
.  ****************.******   *  

686. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 9, identity: 0.719

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
cgtcacgtcggcaatgcggtcggtgcagacgt	Protospacer
*   ** ******* ************ .*  

687. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP011296 (Rhodococcus erythropolis strain BG43 plasmid pRLCBG43, complete sequence) position: , mismatch: 9, identity: 0.719

ctgaac--ttcggcaaggcggtcggtgcacgctg	CRISPR spacer
--ggatcgttcggcaagacggtcggtggacgaac	Protospacer
  *.*.  *********.********* ***   

688. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 9, identity: 0.719

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
cgtcacgtcggcaatgcggtcggtgcagacgt	Protospacer
*   ** ******* ************ .*  

689. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 9, identity: 0.719

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
cgtcacgtcggcaatgcggtcggtgcagacgt	Protospacer
*   ** ******* ************ .*  

690. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
caggcgctgcgcaccgtcgccgagtgggccgg	Protospacer
****** .***************      **.

691. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_CP020716 (Cnuibacter physcomitrellae strain XA(T) plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
gaggaggctcgcaccgtcgccgacgaggtcgg	Protospacer
 *** *** ***************.    **.

692. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 9, identity: 0.719

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
caccaacggcgcaccgccgccggcacccacgc	Protospacer
**   .  ********.*****.******** 

693. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
gccccgcagcgcatcgtcgccgacacccgcgc	Protospacer
    **  *****.**************.** 

694. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
cgcccggcccgcaccgtcgccgacgcctgcac	Protospacer
*.  **** ***************.**..*. 

695. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
ccactcccccgcacccacgccgacacccacga	Protospacer
* . .  * ******  ***************

696. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
ccactcccccgcacccacgccgacacccacga	Protospacer
* . .  * ******  ***************

697. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to MN586026 (Gordonia phage Leonard, complete genome) position: , mismatch: 9, identity: 0.719

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
caggccgcgcgcaccggcgccgaggctgcccg	Protospacer
***** ********** ****** .*.  * .

698. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NC_031112 (Gordonia phage Phinally, complete genome) position: , mismatch: 9, identity: 0.719

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
caggccgcgcgcaccggcgccgaggctgcccg	Protospacer
***** ********** ****** .*.  * .

699. spacer 3.8|52243|32|NC_020894|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gagctgtgcaccgccacgatcaacgaccgacg	CRISPR spacer
cggctgtccaccgccacggtcaacgcctatct	Protospacer
 .***** **********.****** *.. * 

700. spacer 3.9|52304|32|NC_020894|CRISPRCasFinder matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 9, identity: 0.719

ggtactcgcgtcaaggcgcgcgggtcaggcgt	CRISPR spacer
aggtcacgcgtcagggcgcgcggggcagggtc	Protospacer
.*  * *******.********** ****  .

701. spacer 3.10|52365|31|NC_020894|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 9, identity: 0.71

ccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
aaagccgggtggtggccgaacgggtgcgccg	Protospacer
  . * . *************** ****** 

702. spacer 3.10|52365|31|NC_020894|CRISPRCasFinder matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

ccgccaacgtggtggccgaacggctgcgccc	CRISPR spacer
tgaccgacgtggtggccggacggctgtcggc	Protospacer
. .**.************.*******.   *

703. spacer 3.14|51872|37|NC_020894|CRT matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.757

atccctgcgggaggccatccgccgcgctgtctgtgag	CRISPR spacer
ctccctgcaggaggcgatccgccgcgcgaccaaggag	Protospacer
 *******.****** *********** ..* . ***

704. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to NZ_CP047896 (Sphingomonas sp. C33 plasmid pC33, complete sequence) position: , mismatch: 9, identity: 0.719

ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
gtcgcggaacgcggccagaccgaagcccgtga	Protospacer
* .  ************ ***** ****  .*

705. spacer 4.2|53070|32|NC_020894|CRISPRCasFinder matches to NZ_CP049142 (Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence) position: , mismatch: 9, identity: 0.719

gtcttctcgatcatctcgtccgtgttcaccgc	CRISPR spacer
gcgaactccatcatctcgtccttgttcagggt	Protospacer
*.   *** ************ ******  *.

706. spacer 5.1|54819|32|NC_020894|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 9, identity: 0.719

aagtacggcggatacgcgtacgggtccgatcc	CRISPR spacer
cgccgcggcgggtacgcgtacgggtccgcggc	Protospacer
 . ..******.****************   *

707. spacer 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgctcagctcgcaccgccgggcggcgcggac	CRISPR spacer
ttgtattcctcgctcagccgggcggcgcggac	Protospacer
..*. .  ***** * ****************

708. spacer 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026745 (Nocardia cyriacigeorgica strain MDA3349 isolate MDA3349 ancestor plasmid p_unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ccgctcagctcgcaccgccgggcggcgcggac	CRISPR spacer
ttgtattcctcgctcagccgggcggcgcggac	Protospacer
..*. .  ***** * ****************

709. spacer 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgctcagctcgcaccgccgggcggcgcggac	CRISPR spacer
acgtgtcgctcgcactgccggccggcgcggtg	Protospacer
 **. . ********.***** ********  

710. spacer 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046917 (Paraburkholderia sp. DHF22 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgctcagctcgcaccgccgggcggcgcggac	CRISPR spacer
attcttcgctcgcaccgccggtcgacgcggtg	Protospacer
 . **. ************** **.*****  

711. spacer 6.4|55409|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

gacatgcgctcgcccctggaacggcaagggcg	CRISPR spacer
ccgatgcgatcgcgcctggaacggcaggcggc	Protospacer
   ***** **** ************.* *  

712. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
gagttcctcgtcggcgtcctccagggcgaggt	Protospacer
 ***** ************ *****.*.  ..

713. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP020948 (Rhizobium sp. CIAT894 plasmid pRheCIAT894a, complete sequence) position: , mismatch: 9, identity: 0.719

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
ggcgtcgacgtcggcgcccgccatgacatcat	Protospacer
 .  **. ********.****** *******.

714. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.719

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
ggcgtcgacgtcggcgcccgccacgacatcat	Protospacer
 .  **. ********.****** *******.

715. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
cagttcatcgtcggcgtctaccacaaacgcga	Protospacer
******************..*** .*   *. 

716. spacer 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP022197 (Celeribacter ethanolicus strain TSPH2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gacaccctcggctacaaccagttcgccaccaa	CRISPR spacer
gacaccttcggcaacaaccagttcttctgggc	Protospacer
******.***** *********** .*   . 

717. spacer 6.9|55714|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 9, identity: 0.719

ggggcacccttcgctgtcggcagcgtctggac	CRISPR spacer
acgctcgccttcgctggcggcagcgtcaggat	Protospacer
. * .  ********* ********** ***.

718. spacer 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 9, identity: 0.719

ctcgacgggttcgccgagaaggtgctacaccc	CRISPR spacer
ctcggcgggttcgccaagaaggtccgaagaga	Protospacer
****.**********.******* * * .   

719. spacer 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 9, identity: 0.719

ctcgacgggttcgccgagaaggtgctacaccc	CRISPR spacer
ctcggcgggttcgccaagaaggtccgaagaga	Protospacer
****.**********.******* * * .   

720. spacer 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

ctcgacgggttcgccgagaaggtgctacaccc	CRISPR spacer
ctcgacgggctcgccgagacggttcggaagtt	Protospacer
*********.********* *** * . * ..

721. spacer 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719

tccggtcgtgcacgactgcgccgactgcggac	CRISPR spacer
cgcgcatcagcacggctgcgacgactgcggac	Protospacer
. **  .  *****.***** ***********

722. spacer 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 9, identity: 0.719

tccggtcgtgcacgactgcgccgactgcggac	CRISPR spacer
cgcgcatcagcacggctgcgacgactgcggac	Protospacer
. **  .  *****.***** ***********

723. spacer 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719

tccggtcgtgcacgactgcgccgactgcggac	CRISPR spacer
cgcgcatcagcacggctgcgacgactgcggac	Protospacer
. **  .  *****.***** ***********

724. spacer 7.6|56304|31|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP017427 (Methylobacterium sp. XJLW plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

gccacaatcgcgacctgttcgagaacaaggc	CRISPR spacer
taggcaatcccgacctgttcgagaaccttga	Protospacer
   .***** ****************   * 

725. spacer 7.6|56304|31|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP045223 (Achromobacter xylosoxidans strain DN002 plasmid unnamed) position: , mismatch: 9, identity: 0.71

gccacaatcgcgacctgttcgagaacaaggc	CRISPR spacer
taggcaatcccgacctgttcgagaaccttga	Protospacer
   .***** ****************   * 

726. spacer 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 9, identity: 0.719

cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
cggtgccggaactcacccccggcgcggcctcg	Protospacer
*.   . *** *******.************ 

727. spacer 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT matches to MN310543 (Microbacterium phage ChickenKing, complete genome) position: , mismatch: 9, identity: 0.719

cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
agagctgggacctcaccttcggcacggtgggc	Protospacer
 . **************.*****.***.   *

728. spacer 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.719

cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
acctgggggtcctcaccctcggcgccgccggc	Protospacer
  *   *** *************** ***  *

729. spacer 7.9|56486|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP016820 (Rhodococcus sp. p52 plasmid pDF02, complete sequence) position: , mismatch: 9, identity: 0.719

gccacggcctcccggccggagagcttgtgccg	CRISPR spacer
tccacggcctcccggtcggagtgcccaaacag	Protospacer
 **************.***** **... .* *

730. spacer 7.10|56547|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP039694 (Agrobacterium larrymoorei strain CFBP5473 plasmid pTiCFBP5473, complete sequence) position: , mismatch: 9, identity: 0.719

gcgtcgtagaggcggcgatcgttgctgccctg	CRISPR spacer
agctcgaagaggcggcgatcgttgatggcgcc	Protospacer
.  *** ***************** ** * . 

731. spacer 7.12|56669|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP040763 (Paracoccus sp. 2251 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagaccagggcgatgcgggaactgtcccgg	CRISPR spacer
cattgcccagggggatgcgggaacggtccaga	Protospacer
 .. * ****** *********** **** *.

732. spacer 7.14|56791|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 9, identity: 0.719

gggacacccttcgctgtcggcagcgtctggac	CRISPR spacer
acgctcgccttcgctggcggcagcgtcaggat	Protospacer
. * .  ********* ********** ***.

733. spacer 7.17|56426|32|NC_020894|PILER-CR matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 9, identity: 0.719

cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
cggtgccggaactcacccccggcgcggcctcg	Protospacer
*.   . *** *******.************ 

734. spacer 7.17|56426|32|NC_020894|PILER-CR matches to MN310543 (Microbacterium phage ChickenKing, complete genome) position: , mismatch: 9, identity: 0.719

cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
agagctgggacctcaccttcggcacggtgggc	Protospacer
 . **************.*****.***.   *

735. spacer 7.17|56426|32|NC_020894|PILER-CR matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.719

cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
acctgggggtcctcaccctcggcgccgccggc	Protospacer
  *   *** *************** ***  *

736. spacer 7.18|56487|32|NC_020894|PILER-CR matches to NZ_CP016820 (Rhodococcus sp. p52 plasmid pDF02, complete sequence) position: , mismatch: 9, identity: 0.719

gccacggcctcccggccggagagcttgtgccg	CRISPR spacer
tccacggcctcccggtcggagtgcccaaacag	Protospacer
 **************.***** **... .* *

737. spacer 7.19|56548|32|NC_020894|PILER-CR matches to NZ_CP039694 (Agrobacterium larrymoorei strain CFBP5473 plasmid pTiCFBP5473, complete sequence) position: , mismatch: 9, identity: 0.719

gcgtcgtagaggcggcgatcgttgctgccctg	CRISPR spacer
agctcgaagaggcggcgatcgttgatggcgcc	Protospacer
.  *** ***************** ** * . 

738. spacer 7.21|56670|32|NC_020894|PILER-CR matches to NZ_CP040763 (Paracoccus sp. 2251 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

ggcagaccagggcgatgcgggaactgtcccgg	CRISPR spacer
cattgcccagggggatgcgggaacggtccaga	Protospacer
 .. * ****** *********** **** *.

739. spacer 8.3|57198|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 9, identity: 0.719

atcgagaatcatttcgtcgtcgaccccgcgaa	CRISPR spacer
gtgccggatcatttcgccttcgaccccgcgcg	Protospacer
.*   *.*********.* *********** .

740. spacer 8.8|57504|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.719

ggcggccagtgcgttgaggtcgccaccaacct	CRISPR spacer
ggcggccagggcgtcgaggtcgcgggcgaggc	Protospacer
********* ****.******** . *.*  .

741. spacer 8.8|57504|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_009426 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcggccagtgcgttgaggtcgccaccaacct	CRISPR spacer
tgcggccagttcgttgcggtcgccgggatcga	Protospacer
 ********* ***** *******.  * *  

742. spacer 8.8|57504|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031116 (Rubrobacter indicoceani strain SCSIO 08198 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcggccagtgcgttgaggtcgccaccaacct	CRISPR spacer
cgcgtccattgcgttgaggtcgcctgcggcga	Protospacer
 *** *** ***************  *..*  

743. spacer 8.8|57504|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NC_002033 (Novosphingobium aromaticivorans plasmid pNL1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcggccagtgcgttgaggtcgccaccaacct	CRISPR spacer
tgcggccagttcgttgcggtcgccgggatcga	Protospacer
 ********* ***** *******.  * *  

744. spacer 8.9|57565|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

cgggcccggtcaccttccagtccctcttccaa	CRISPR spacer
atcgcccggtcacctccctgtccctcggcccg	Protospacer
   ************.** *******  ** .

745. spacer 8.9|57565|32|NC_020894|CRISPRCasFinder,CRT matches to NC_021347 (Rhodococcus phage E3, complete genome) position: , mismatch: 9, identity: 0.719

cgggcccggtcaccttccagtccctcttccaa	CRISPR spacer
tgaactgggtgaccttccagtccatcttcccg	Protospacer
.*..*. *** ************ ****** .

746. spacer 8.10|57626|32|NC_020894|CRISPRCasFinder matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 9, identity: 0.719

ggggcacccttcgctgtcggcagcgtctggac	CRISPR spacer
acgctcgccttcgctggcggcagcgtcaggat	Protospacer
. * .  ********* ********** ***.

747. spacer 9.1|57911|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to MN234220 (Gordonia phage Lambo, complete genome) position: , mismatch: 9, identity: 0.719

accgcgaccttccggtggagggcgtgcagttc	CRISPR spacer
tccgcaaccttcaggtggagggcggcaagcga	Protospacer
 ****.****** ***********   **.  

748. spacer 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014682 (Kozakia baliensis strain NBRC 16680 plasmid pKB16680_1, complete sequence) position: , mismatch: 9, identity: 0.719

ggccgcatcaccggccccggcttcgaactgcg	CRISPR spacer
gtcgatatcaccggcaccggcttcgatctcga	Protospacer
* * ..********* ********** **  .

749. spacer 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014675 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence) position: , mismatch: 9, identity: 0.719

ggccgcatcaccggccccggcttcgaactgcg	CRISPR spacer
gtcgatatcaccggcaccggcttcgatctcga	Protospacer
* * ..********* ********** **  .

750. spacer 9.2|57972|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_047992 (Microbacterium phage Zeta1847, complete genome) position: , mismatch: 9, identity: 0.719

ggccgcatcaccggccccggcttcgaactgcg	CRISPR spacer
taccgcatcaccggcaccggcgtcgtcgtcct	Protospacer
 .************* ***** ***   * * 

751. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
acgtcgcaggccgccgccacatcgcccgcgcg	Protospacer
  ..****************.**** *** . 

752. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
accgcgcaggccgcctcgacgtcgcgcggcca	Protospacer
    *********** * ********** *. 

753. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035513 (Haematobacter massiliensis strain OT1 plasmid pOT1-3, complete sequence) position: , mismatch: 9, identity: 0.719

tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
gcgctggaggccgctgccacgacgcgcgcccc	Protospacer
  .*.* *******.****** ********..

754. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042998 (Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence) position: , mismatch: 9, identity: 0.719

tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
tggccgcaggccgccgcctcgtcctacctggt	Protospacer
**.*************** **** ..* .  *

755. spacer 9.6|58215|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016821 (Rhodococcus sp. p52 plasmid pDF01, complete sequence) position: , mismatch: 9, identity: 0.719

gaccctggtaccggatcaccgaccggtaccag	CRISPR spacer
agtactgggaccggttcaccgaccggttcggg	Protospacer
... **** ***** ************ * .*

756. spacer 9.7|58276|32|NC_020894|CRISPRCasFinder,CRT matches to KT898134 (Aeromonas phage phiARM81mr, complete genome) position: , mismatch: 9, identity: 0.719

gcgactcgggccgccatcgaacgtgccgaggc	CRISPR spacer
accaaggaggccgccattgagcgtgccgagga	Protospacer
.* *   .*********.**.********** 

757. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP032692 (Rhizobium sp. CCGE532 plasmid pRCCGE532b, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
gctttgccgatggccgaacgccggccgatcgc	Protospacer
*      *********.******* ****** 

758. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
atgcgggcgtcggccggacgccgggcgatctt	Protospacer
. . * *** .*******************  

759. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NC_020061 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899b, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
gctttgccgatggccgaacgccggccgatcgc	Protospacer
*      *********.******* ****** 

760. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg	Protospacer
*  .* ****** *** ************  .

761. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg	Protospacer
*  .* ****** *** ************  .

762. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg	Protospacer
*  .* ****** *** ************  .

763. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg	Protospacer
*  .* ****** *** ************  .

764. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg	Protospacer
*  .* ****** *** ************  .

765. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg	Protospacer
*  .* ****** *** ************  .

766. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg	Protospacer
*  .* ****** *** ************  .

767. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg	Protospacer
*  .* ****** *** ************  .

768. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP011772 (Croceicoccus naphthovorans strain PQ-2 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
ccacgggcgatggctggacgcccggcgatatc	Protospacer
  * * ********.******* ******   

769. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg	Protospacer
*  .* ****** *** ************  .

770. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
gccagggcgatgcccgcacgccgggcgatgcg	Protospacer
*  .* ****** *** ************  .

771. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
cacgaggcgatcagcccgaacgtgcccgtcgt	Protospacer
*    *.******* *********** ***. 

772. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 9, identity: 0.719

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
gcgccgacgatcacgccgaaggtgagaccgag	Protospacer
 ************ ****** ***  . . **

773. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 9, identity: 0.719

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
gcgccgacgatcacgccgaaggtgagaccgag	Protospacer
 ************ ****** ***  . . **

774. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
cgatcgccgatcaggccgagcgtgccgctttt	Protospacer
* ..** ************.******* *.  

775. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 9, identity: 0.719

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
acgagatcgatcaggccgaaaatgccggtctt	Protospacer
 **  . ************* .********  

776. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.719

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
cgatcgccgatcaggccgagcgtgccgctttt	Protospacer
* ..** ************.******* *.  

777. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP025584 (Paracoccus jeotgali strain CBA4604 plasmid pCBA4604-01, complete sequence) position: , mismatch: 9, identity: 0.719

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
gccccgacgatcaggccgatcgagccacccgc	Protospacer
 * **************** ** ***. .*. 

778. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 9, identity: 0.719

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ctcgcggggtcgccgccgaccggcgatccgag	Protospacer
 . *  *******************  ***  

779. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NC_048019 (Gordonia phage Ruthy, complete genome) position: , mismatch: 9, identity: 0.719

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ctctcggcgtcgccaccgacctgcgcaccgcc	Protospacer
 .    * ******.****** **********

780. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 9, identity: 0.719

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tttcgagggtcgcctcagaccggcgcaccaca	Protospacer
 .  * ******** * ************.* 

781. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ggcaccggctcgccgccgacccgcgcacccac	Protospacer
*  . .** ************ *******  *

782. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
cccagctggtcgccgccgactggctcaccgaa	Protospacer
 * .*. *************.*** *****  

783. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
tcgacgccctcgccgcccaccggcgcgccgcc	Protospacer
 **.     ******** ********.*****

784. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 9, identity: 0.719

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
aggtcgcgctcgccgccaaccggcgcatcgcc	Protospacer
. *    * ********.*********.****

785. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP030830 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750c, complete sequence) position: , mismatch: 9, identity: 0.719

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
gatttcgatccagagcacgcctgcattgacgt	Protospacer
 ******************** **  . .*  

786. spacer 9.13|58642|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 9, identity: 0.719

gccctgcaccaccaccatttcgtcggccggcg	CRISPR spacer
cgcgtgcatcaccacgatttcgtcggcaagga	Protospacer
  * ****.****** *********** .* .

787. spacer 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.719

atcacccccgtgccgaacacgccgacgtcggt	CRISPR spacer
ctggcccccgtgccgatcacgccgacgcgccg	Protospacer
 * .************ **********.    

788. spacer 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719

atcacccccgtgccgaacacgccgacgtcggt	CRISPR spacer
acatgcaccgggccgaccacgccgacgtcgtc	Protospacer
*.   * *** ***** ************* .

789. spacer 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 9, identity: 0.719

atcacccccgtgccgaacacgccgacgtcggt	CRISPR spacer
gaccccctcgcgccgaacacgccgacggcaac	Protospacer
. * ***.**.**************** *...

790. spacer 1.5|40777|31|NC_020894|CRISPRCasFinder matches to NC_000867 (Pseudoalteromonas phage PM2, complete genome) position: , mismatch: 10, identity: 0.677

cttcttggcggccttgttgatgcgcttcttg	CRISPR spacer
accgaccacggcctagttgatgcgcttgttg	Protospacer
 ..  . .****** ************ ***

791. spacer 1.5|40777|31|NC_020894|CRISPRCasFinder matches to NC_042121 (Pseudoalteromonas phage Cr39582, complete genome) position: , mismatch: 10, identity: 0.677

cttcttggcggccttgttgatgcgcttcttg	CRISPR spacer
accgaccacggcctagttgatgcgcttgttg	Protospacer
 ..  . .****** ************ ***

792. spacer 1.5|40777|31|NC_020894|CRISPRCasFinder matches to AF155037 (Alteromonas phage PM2, complete genome) position: , mismatch: 10, identity: 0.677

cttcttggcggccttgttgatgcgcttcttg	CRISPR spacer
accgaccacggcctagttgatgcgcttgttg	Protospacer
 ..  . .****** ************ ***

793. spacer 1.5|40777|31|NC_020894|CRISPRCasFinder matches to M26134 (Bacteriophage PM2 structural protein gene containing purine/pyrimidine rich regions and anti-Z-DNA-IgG binding regions, complete cds) position: , mismatch: 10, identity: 0.677

cttcttggcggccttgttgatgcgcttcttg	CRISPR spacer
accgaccacggcctagttgatgcgcttgttg	Protospacer
 ..  . .****** ************ ***

794. spacer 1.6|40596|30|NC_020894|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.667

cgtggcgggctcaccggccgcgatgacctc	CRISPR spacer
cgtggcgggctgaccggccgcaggagtgcg	Protospacer
*********** *********.. ... . 

795. spacer 1.9|40777|32|NC_020894|CRT,PILER-CR matches to NZ_CP015204 (Rhodococcus sp. 008 plasmid pR8C1, complete sequence) position: , mismatch: 10, identity: 0.688

cttcttggcggccttgttgatgcgcttcttgt	CRISPR spacer
tttctcggcggccttgtcgatgcggcgcaacg	Protospacer
.****.***********.****** . *    

796. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.688

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
agatgcaggcggcggcgaaggagatcacccgc	Protospacer
 * ********.***** ********..   .

797. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.688

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
agatgcaggcggcggcgaaggagatcacccgc	Protospacer
 * ********.***** ********..   .

798. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 10, identity: 0.688

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
gccatcaggcgacggcgaaggagaacgttggc	Protospacer
  .  ************ ****** *** * .

799. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013109 (Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence) position: , mismatch: 10, identity: 0.688

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
cgcgcattgcgacggcggaggagatcgtcgcc	Protospacer
.*.     ********* ********** **.

800. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 10, identity: 0.688

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
gcgcgcgggcgaaggcgcaggagatcggcgtg	Protospacer
   .**.***** **************  *. 

801. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024309 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3b, complete sequence) position: , mismatch: 10, identity: 0.688

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
cgcgcattgcgacggcggaggagatcgtcgcc	Protospacer
.*.     ********* ********** **.

802. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013053 (Sinorhizobium americanum CCGM7 plasmid B, complete sequence) position: , mismatch: 10, identity: 0.688

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
cgcgcattgcgacggcggaggagatcgtcgcc	Protospacer
.*.     ********* ********** **.

803. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.688

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
agatgcaggcggcggcgaaggagatcacccgc	Protospacer
 * ********.***** ********..   .

804. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NC_008757 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP01, complete sequence) position: , mismatch: 10, identity: 0.688

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
atgcgccggatcgtcggccagggcgccagccc	Protospacer
. *    ** *****************.**  

805. spacer 2.9|51241|32|NC_020894|CRISPRCasFinder,CRT matches to NC_007950 (Polaromonas sp. JS666 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.688

gaggtgaggctcgtcggccagggcgccggcaa	CRISPR spacer
atgcgccggatcgtcggccagggcgccagccc	Protospacer
. *    ** *****************.**  

806. spacer 2.14|51546|32|NC_020894|CRT matches to MH450125 (Arthrobacter phage MediumFry, complete genome) position: , mismatch: 10, identity: 0.688

ccttgaccttgtcgaccttcatctcgaacagg	CRISPR spacer
gcttgaccttgttgaccttcttcttgtctgac	Protospacer
 ***********.******* ***.*  ... 

807. spacer 3.1|51816|32|NC_020894|CRISPRCasFinder matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ccgccctgccccgcctgagcgcgaacgtgccg	CRISPR spacer
ccgccctgccccggctgaccgcgtccccaggc	Protospacer
************* **** ****  * ..   

808. spacer 3.2|51877|32|NC_020894|CRISPRCasFinder matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tgcgggaggccatccgccgcgctgtctgtgag	CRISPR spacer
tgcgtcaggccatccgccgcgctcagggctca	Protospacer
****  *****************    *.  .

809. spacer 3.3|51938|32|NC_020894|CRISPRCasFinder matches to NZ_KX443388 (Rhodococcus hoagii strain PAM1216 plasmid pVAPA1216, complete sequence) position: , mismatch: 10, identity: 0.688

agttgcagacgctcccgctcgccgctcaccag	CRISPR spacer
gccagcagacgctcccgctcgcggcgcaggtt	Protospacer
. . ****************** ** **    

810. spacer 3.3|51938|32|NC_020894|CRISPRCasFinder matches to NZ_KX443406 (Rhodococcus hoagii strain PAM1413 plasmid pVAPB1413, complete sequence) position: , mismatch: 10, identity: 0.688

agttgcagacgctcccgctcgccgctcaccag	CRISPR spacer
gccagcagacgctcccgctcgcggcgcaggtt	Protospacer
. . ****************** ** **    

811. spacer 3.3|51938|32|NC_020894|CRISPRCasFinder matches to NZ_KX443397 (Rhodococcus hoagii strain PAM1475 plasmid pVAPB1475, complete sequence) position: , mismatch: 10, identity: 0.688

agttgcagacgctcccgctcgccgctcaccag	CRISPR spacer
gccagcagacgctcccgctcgcggcgcaggtt	Protospacer
. . ****************** ** **    

812. spacer 3.3|51938|32|NC_020894|CRISPRCasFinder matches to NZ_KX443407 (Rhodococcus hoagii strain PAM1533 plasmid PVAPB1533, complete sequence) position: , mismatch: 10, identity: 0.688

agttgcagacgctcccgctcgccgctcaccag	CRISPR spacer
gccagcagacgctcccgctcgcggcgcaggtt	Protospacer
. . ****************** ** **    

813. spacer 3.3|51938|32|NC_020894|CRISPRCasFinder matches to NZ_CP027795 (Rhodococcus hoagii strain DSSKP-R-001 plasmid plas2, complete sequence) position: , mismatch: 10, identity: 0.688

agttgcagacgctcccgctcgccgctcaccag	CRISPR spacer
gccagcagacgctcccgctcgcggcgcaggtt	Protospacer
. . ****************** ** **    

814. spacer 3.3|51938|32|NC_020894|CRISPRCasFinder matches to NZ_CP041646 (Rhodococcus hoagii strain WY plasmid pWY, complete sequence) position: , mismatch: 10, identity: 0.688

agttgcagacgctcccgctcgccgctcaccag	CRISPR spacer
gccagcagacgctcccgctcgcggcgcaggtt	Protospacer
. . ****************** ** **    

815. spacer 3.3|51938|32|NC_020894|CRISPRCasFinder matches to NC_014247 (Rhodococcus equi plasmid pVAPAMBE116, complete sequence) position: , mismatch: 10, identity: 0.688

agttgcagacgctcccgctcgccgctcaccag	CRISPR spacer
gccagcagacgctcccgctcgcggcgcaggtt	Protospacer
. . ****************** ** **    

816. spacer 3.3|51938|32|NC_020894|CRISPRCasFinder matches to NZ_CP039433 (Rhodococcus sp. SGAir0479 plasmid unnamed) position: , mismatch: 10, identity: 0.688

agttgcagacgctcccgctcgccgctcaccag	CRISPR spacer
gccagcagacgctcccgctcgcggcgcaggtt	Protospacer
. . ****************** ** **    

817. spacer 3.3|51938|32|NC_020894|CRISPRCasFinder matches to NC_011150 (Rhodococcus equi plasmid pVAPB1593, complete sequence) position: , mismatch: 10, identity: 0.688

agttgcagacgctcccgctcgccgctcaccag	CRISPR spacer
gccagcagacgctcccgctcgcggcgcaggtt	Protospacer
. . ****************** ** **    

818. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

819. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_LR134445 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 3, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
catcggctcggccaggcggtcggtgcgcgccc	Protospacer
*   . .***** *************.***. 

820. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

821. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP011450 (Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
cccggcttcggcaaggcgctcggtgtacttga	Protospacer
*. ..************* ******.** . .

822. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

823. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

824. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

825. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

826. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

827. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

828. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

829. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

830. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

831. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

832. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

833. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

834. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

835. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

836. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

837. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

838. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

839. spacer 3.6|52121|32|NC_020894|CRISPRCasFinder matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacttcggcaaggcggtcggtgcacgctg	CRISPR spacer
gcccgcctcggcaaggcggtcgggggacgccc	Protospacer
 .  .*.**************** * ****. 

840. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
gctgcggcgcacaccgccgccgacacatcgaa	Protospacer
   *******.*****.********* .  .*

841. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_CP030841 (Acidisarcina polymorpha strain SBC82 plasmid pACPOL1, complete sequence) position: , mismatch: 10, identity: 0.688

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
gggccggcgcgcaaggtcgccgacaccactct	Protospacer
 .* *********  ************  .  

842. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 10, identity: 0.688

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
agggcggcgcgctccgccgccgacaggtcggc	Protospacer
 .********** ***.********  .  * 

843. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
gctgcggcgcacaccgccgccgacacatcgaa	Protospacer
   *******.*****.********* .  .*

844. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
gctgcggcgcacaccgccgccgacacatcgaa	Protospacer
   *******.*****.********* .  .*

845. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
gctgcggcgcacaccgacgccgacacatcgaa	Protospacer
   *******.***** ********* .  .*

846. spacer 3.11|52425|32|NC_020894|CRISPRCasFinder matches to NZ_CP032091 (Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tggcggtgcatgcccgtgctcaccggcgccag	CRISPR spacer
cagtagtacatgcccgtgctcagcggcgttgt	Protospacer
..*..**.************** *****... 

847. spacer 3.13|51811|37|NC_020894|CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.73

atccgccgccctgccccgcctgagcgcgaacgtgccg	CRISPR spacer
atccgccgccctgccccggctgaccgcgtccccaggc	Protospacer
****************** **** ****  * ..   

848. spacer 3.15|51933|37|NC_020894|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 10, identity: 0.73

atcccagttgcagacgctcccgctcgccgctcaccag	CRISPR spacer
cccgcagatgcagacgctccagctcgccgccgacggc	Protospacer
 .* *** ************ *********. ** . 

849. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 10, identity: 0.688

ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
gggcaggaacgcgggcacaccgacctgtttgc	Protospacer
** *********** ********* . .. . 

850. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 10, identity: 0.688

ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
tccttggaacgcgaccacaccgacggccgaag	Protospacer
  .. ********.*********** ** .*.

851. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
cacaaggacctcggccacaccgacgccgccgc	Protospacer
 .. **** * **************** * . 

852. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to NC_024995 (Gluconacetobacter europaeus plasmid pGE3 genomic DNA, complete sequence, strain: KGMA0119) position: , mismatch: 10, identity: 0.688

ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
ataccggaacgcggccacaacgccgcccacgg	Protospacer
.  * ************** ** *****  ..

853. spacer 4.1|53009|32|NC_020894|CRISPRCasFinder matches to MN234170 (Mycobacterium phage MalagasyRose, complete genome) position: , mismatch: 10, identity: 0.688

ggtcaggaacgcggccacaccgacgccccgaa	CRISPR spacer
ctccaggaacgcgaccacaccggcgctcttgc	Protospacer
  .**********.********.***.*. . 

854. spacer 4.2|53070|32|NC_020894|CRISPRCasFinder matches to NZ_CP048424 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gtcttctcgatcatctcgtccgtgttcaccgc	CRISPR spacer
cgtttctcgaacatctcgaccgtgttccagaa	Protospacer
  .******* ******* ********   . 

855. spacer 4.2|53070|32|NC_020894|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 10, identity: 0.688

gtcttctcgatcatctcgtccgtgttcaccgc	CRISPR spacer
aacttctcgatcatcgcgtcggtgtcgagtcg	Protospacer
. ************* **** ****. * .  

856. spacer 4.2|53070|32|NC_020894|CRISPRCasFinder matches to MN694806 (Marine virus AFVG_250M690, complete genome) position: , mismatch: 10, identity: 0.688

gtcttctcgatcatctcgtccgtgttcaccgc	CRISPR spacer
cccttctcgatcatctcctccctgtgcctgtt	Protospacer
 .*************** *** *** * .  .

857. spacer 4.3|53131|32|NC_020894|CRISPRCasFinder matches to MN813693 (Mycobacterium phage Imvubu, complete genome) position: , mismatch: 10, identity: 0.688

ccagggaccgcgtcgtcagcggccacaccccg	CRISPR spacer
gaattgaccgcgttgccagcggccacacgggc	Protospacer
  *  ********.*.************    

858. spacer 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012899 (Burkholderia sp. CCGE1001 plasmid pCCGE1001a, complete sequence) position: , mismatch: 10, identity: 0.688

ccgctcagctcgcaccgccgggcggcgcggac	CRISPR spacer
ggcagcagctcgccccgccggccggcgcagcg	Protospacer
     ******** ******* ******.*  

859. spacer 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_018696 (Paraburkholderia phenoliruptrix BR3459a plasmid pSYMBR3459, complete sequence) position: , mismatch: 10, identity: 0.688

ccgctcagctcgcaccgccgggcggcgcggac	CRISPR spacer
ggcagcagctcgccccgccggccggcgcagcg	Protospacer
     ******** ******* ******.*  

860. spacer 6.1|55226|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.688

ccgctcagctcgcaccgccgggcggcgcggac	CRISPR spacer
tgccaaagcccgcgccgccgggcggcgcgagg	Protospacer
.  *  ***.***.***************.. 

861. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 10, identity: 0.688

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
tacgtcctcgtcggcgtccggcaggacgggga	Protospacer
.*  ** ************* ******.  . 

862. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to NC_018023 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.02, complete sequence) position: , mismatch: 10, identity: 0.688

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
gagttcatcgtcggcctcggccagcgccgtct	Protospacer
 ************** ** ***** .*  . .

863. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 10, identity: 0.688

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
gcgcggctcgtcggggtccgccaggagatcga	Protospacer
  *.   ******* *********** ***. 

864. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP016821 (Rhodococcus sp. p52 plasmid pDF01, complete sequence) position: , mismatch: 10, identity: 0.688

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
gacctcatcgtcggcgcccgccgggacccggt	Protospacer
 * .************.*****.**** . ..

865. spacer 6.7|55592|32|NC_020894|CRISPRCasFinder,CRT matches to KT287080 (Enterobacter phage phiEap-2, complete genome) position: , mismatch: 10, identity: 0.688

cagttcatcgtcggcgtccgccaggacatcac	CRISPR spacer
tgagttctcgtcggcgttcgccagggcatctt	Protospacer
... *. **********.*******.**** .

866. spacer 6.8|55653|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_LR723674 (Rhizobium flavum strain YW14 plasmid 5) position: , mismatch: 10, identity: 0.688

gacaccctcggctacaaccagttcgccaccaa	CRISPR spacer
ctcaccttcggctacgaccagttcgaccttgg	Protospacer
  ****.********.********* * ....

867. spacer 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 10, identity: 0.688

tccggtcgtgcacgactgcgccgactgcggac	CRISPR spacer
caggctcgtgcgcgaccgcgccgactgctcga	Protospacer
.  * ******.****.***********  . 

868. spacer 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 10, identity: 0.688

tccggtcgtgcacgactgcgccgactgcggac	CRISPR spacer
caggctcgtgcgcgaccgcgccgactgctcga	Protospacer
.  * ******.****.***********  . 

869. spacer 7.8|56425|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP033024 (Agrobacterium fabrum strain 1D132 plasmid pAt1D132a, complete sequence) position: , mismatch: 10, identity: 0.688

cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
tccgctgggaccgcaacctcggcgccaagact	Protospacer
. ********** ** ********* .   *.

870. spacer 7.17|56426|32|NC_020894|PILER-CR matches to NZ_CP033024 (Agrobacterium fabrum strain 1D132 plasmid pAt1D132a, complete sequence) position: , mismatch: 10, identity: 0.688

cacgctgggacctcaccctcggcgcggcctcc	CRISPR spacer
tccgctgggaccgcaacctcggcgccaagact	Protospacer
. ********** ** ********* .   *.

871. spacer 8.3|57198|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

atcgagaatcatttcgtcgtcgaccccgcgaa	CRISPR spacer
ttcgagaatcacgtcgtcgtcgacgtacaggc	Protospacer
 **********. *********** .   *. 

872. spacer 8.5|57321|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to KY676784 (Streptomyces phage ToastyFinz, complete genome) position: , mismatch: 10, identity: 0.688

aggttcccgtactggcggagcggcaggccgaa	CRISPR spacer
gtacggccgaacaggcggagcggcaggccgcg	Protospacer
. ..  *** ** ***************** .

873. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015090 (Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence) position: , mismatch: 10, identity: 0.688

tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
ccggcgcaggccgccgccccggcgcgcgaacc	Protospacer
. . ************** ** ******  ..

874. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_015952 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence) position: , mismatch: 10, identity: 0.688

tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
cggttcacggccgccgccatggcgcgcgcctc	Protospacer
.*...   ***********.* *********.

875. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_011667 (Thauera sp. MZ1T plasmid pTha01, complete sequence) position: , mismatch: 10, identity: 0.688

tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
ggcttttcggccgccgcgacgtcgagcgcctg	Protospacer
 * .. . ********* ****** ****** 

876. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
ggcaggcacgccgccaccacgtcgcgcgggga	Protospacer
 *   *** ******.************    

877. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.688

tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
gcgtggaaggccgccgccgcgtcgggcgccgc	Protospacer
  .. * ***********.***** ***** .

878. spacer 9.7|58276|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 10, identity: 0.688

gcgactcgggccgccatcgaacgtgccgaggc	CRISPR spacer
gatcagggggccgccctcgaacgcgccgagcg	Protospacer
*      ******** *******.******  

879. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

880. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021027 (Rhizobium sp. TAL182 plasmid pRetTAL182c, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

881. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013633 (Rhizobium sp. N324 plasmid pRspN324c, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

882. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

883. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

884. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

885. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

886. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013561 (Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

887. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

888. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013550 (Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

889. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013530 (Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

890. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013535 (Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

891. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013540 (Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

892. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

893. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

894. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

895. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013583 (Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

896. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

897. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

898. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

899. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP021125 (Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

900. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

901. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013514 (Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

902. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

903. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

904. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

905. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

906. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP013604 (Rhizobium sp. N731 plasmid pRspN731c, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

907. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP017243 (Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

908. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tggccgacgatggccggccgccgggcgatcct	Protospacer
 ..   .********** ************  

909. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
accagcacgatggccggacggcgggcgaggat	Protospacer
.  .**.************* *******  . 

910. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
caccgcgcggtggccgggcgccgggcggagtt	Protospacer
 *  *****.*******.*********.    

911. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
gcgctggccatggccgggcgccgggcgatgat	Protospacer
* .   ** ********.*********** . 

912. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to NC_021780 (Salmonella phage FSL SP-088, complete genome) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tgctgcgcgatggcacgacgccgggcgtacac	Protospacer
 .  **********  ***********  *. 

913. spacer 9.8|58337|32|NC_020894|CRISPRCasFinder,CRT matches to KC139515 (Salmonella phage FSL SP-124, complete genome) position: , mismatch: 10, identity: 0.688

gaaggcgcgatggccggacgccgggcgatcga	CRISPR spacer
tgctgcgcgatggcacgacgccgggcgtacac	Protospacer
 .  **********  ***********  *. 

914. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to MK373789 (Escherichia phage vB_EcoS_PTXU06, complete genome) position: , mismatch: 10, identity: 0.688

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
aagcccgcgatcaggccgaacgtgcgaacgcg	Protospacer
  *** .****************** ...  *

915. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 10, identity: 0.688

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
ctctcggggtcgccgccgaccggcgatccgag	Protospacer
 .    *******************  ***  

916. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
gacaagcggtcgcggccgaccggcgcatcgat	Protospacer
*  ..  ****** *************.** .

917. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
gacaagcggtcgcggccgaccggcgcatcgat	Protospacer
*  ..  ****** *************.** .

918. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
gacaagcggtcgcggccgaccggcgcatcgat	Protospacer
*  ..  ****** *************.** .

919. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
gacaagcggtcgcggccgaccggcgcatcgat	Protospacer
*  ..  ****** *************.** .

920. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 10, identity: 0.688

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
cagggtgggtcgcagccgcccggcggctcaaa	Protospacer
  *********** **** ******  .*.  

921. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
gacaagcggtcgcggccgaccggcgcatcgat	Protospacer
*  ..  ****** *************.** .

922. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 10, identity: 0.688

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
acctcgtactcgccgccgccctgcgcaccgcc	Protospacer
.*     . ********* ** **********

923. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP038031 (Rhodococcus ruber strain R1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
gactcaaactcgccgccgtccgccgcaccgcc	Protospacer
*     .. ********* *** *********

924. spacer 9.11|58520|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP015090 (Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence) position: , mismatch: 10, identity: 0.688

gactctgggaccacgatggtggtcaacgtcct	CRISPR spacer
ccggtcgagaccacgatggaggtcaacgcccg	Protospacer
    ..*.*********** ********.** 

925. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 10, identity: 0.688

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
gaccgtcatccagggcacgccggccgcggcgg	Protospacer
 *.. . ******.************* ** .

926. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 10, identity: 0.688

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
gatctcgatccagagcacgcctgctttgacgt	Protospacer
 **.***************** **. . .*  

927. spacer 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

atcacccccgtgccgaacacgccgacgtcggt	CRISPR spacer
agttccccggtgccgatcacgccgacgaactg	Protospacer
* . **** ******* **********     

928. spacer 9.14|58703|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP049813 (Monaibacterium sp. ALG8 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

atcacccccgtgccgaacacgccgacgtcggt	CRISPR spacer
ccgattaccgtgccggacacgccgacatcgac	Protospacer
 . *.. ********.**********.***..

929. spacer 1.9|40777|32|NC_020894|CRT,PILER-CR matches to NC_000867 (Pseudoalteromonas phage PM2, complete genome) position: , mismatch: 11, identity: 0.656

cttcttggcggccttgttgatgcgcttcttgt	CRISPR spacer
accgaccacggcctagttgatgcgcttgttga	Protospacer
 ..  . .****** ************ *** 

930. spacer 1.9|40777|32|NC_020894|CRT,PILER-CR matches to M26134 (Bacteriophage PM2 structural protein gene containing purine/pyrimidine rich regions and anti-Z-DNA-IgG binding regions, complete cds) position: , mismatch: 11, identity: 0.656

cttcttggcggccttgttgatgcgcttcttgt	CRISPR spacer
accgaccacggcctagttgatgcgcttgttga	Protospacer
 ..  . .****** ************ *** 

931. spacer 1.9|40777|32|NC_020894|CRT,PILER-CR matches to NC_042121 (Pseudoalteromonas phage Cr39582, complete genome) position: , mismatch: 11, identity: 0.656

cttcttggcggccttgttgatgcgcttcttgt	CRISPR spacer
accgaccacggcctagttgatgcgcttgttga	Protospacer
 ..  . .****** ************ *** 

932. spacer 1.9|40777|32|NC_020894|CRT,PILER-CR matches to AF155037 (Alteromonas phage PM2, complete genome) position: , mismatch: 11, identity: 0.656

cttcttggcggccttgttgatgcgcttcttgt	CRISPR spacer
accgaccacggcctagttgatgcgcttgttga	Protospacer
 ..  . .****** ************ *** 

933. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_011003 (Burkholderia cenocepacia J2315 plasmid pBCJ2315, complete sequence) position: , mismatch: 11, identity: 0.656

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
ctctgcaggcgaccgcgcagcagatcaatcga	Protospacer
. .********** ****** *****.     

934. spacer 2.3|50875|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011506 (Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence) position: , mismatch: 11, identity: 0.656

tgttgcaggcgacggcgcaggagatcgtggct	CRISPR spacer
ctctgcaggcgaccgcgcagcagatcaatcga	Protospacer
. .********** ****** *****.     

935. spacer 2.4|50936|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 11, identity: 0.656

gtcacacaggtgatcaggaccgtcttcctcgc	CRISPR spacer
aagctgaaggtgatcaagaccgacttcctcaa	Protospacer
.   .. *********.***** *******. 

936. spacer 2.7|51119|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to NC_012521 (Rhodococcus opacus B4 plasmid pROB02, complete sequence) position: , mismatch: 11, identity: 0.656

cagctcggcgcgcaggaacggtccgggctgcg	CRISPR spacer
tgcatcggcaggcaggaacggtccgggtgttt	Protospacer
..  *****. ****************.  . 

937. spacer 2.14|51546|32|NC_020894|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 11, identity: 0.656

ccttgaccttgtcgaccttcatctcgaacagg	CRISPR spacer
aaactgccgtgtcggccttcatctcgaacgtc	Protospacer
   . .** *****.**************.  

938. spacer 3.7|52182|32|NC_020894|CRISPRCasFinder matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 11, identity: 0.656

caggcggcgcgcaccgtcgccgacacccacga	CRISPR spacer
caggcggcgcgcaccgtggcggaactgagtag	Protospacer
***************** ** **  .  ....

939. spacer 3.14|51872|37|NC_020894|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 11, identity: 0.703

atccctgcgggaggccatccgccgcgctgtctgtgag	CRISPR spacer
ctccctgcaggaggccatccggcgcgccacgacggaa	Protospacer
 *******.************ *****...    **.

940. spacer 3.16|51994|37|NC_020894|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.703

atccccccgccgcgctcgccctggccactctgggcat	CRISPR spacer
ccgtggccgccgcgctcgccctggccccgctggccga	Protospacer
 . .  ******************** * **** *. 

941. spacer 7.1|55999|32|NC_020894|CRISPRCasFinder,CRT matches to NC_015409 (Verrucosispora maris AB-18-032 plasmid pVMKU, complete sequence) position: , mismatch: 11, identity: 0.656

ctcgacgggttcgccgagaaggtgctacaccc	CRISPR spacer
gacgacgggttcgccgagcagttgcggacggt	Protospacer
  **************** ** *** .    .

942. spacer 7.5|56243|32|NC_020894|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022193 (Yangia pacifica strain YSBP01 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.656

tccggtcgtgcacgactgcgccgactgcggac	CRISPR spacer
cgatctcgtgctcgactgcgccgacagctacg	Protospacer
.    ****** ************* ** .  

943. spacer 9.3|58033|32|NC_020894|PILER-CR,CRISPRCasFinder,CRT matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 11, identity: 0.656

tgaccgcaggccgccgccacgtcgcgcgcctt	CRISPR spacer
atgccgcaggccgccgcctcggcgcggaaggc	Protospacer
  .*************** ** **** .   .

944. spacer 9.9|58398|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 11, identity: 0.656

ccgccgacgatcaggccgaacgtgccggtcag	CRISPR spacer
gaagcgacgatcagctcgaacgtgccgacgcc	Protospacer
  . ********** .***********..   

945. spacer 9.10|58459|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 11, identity: 0.656

gcgggtgggtcgccgccgaccggcgcaccgcc	CRISPR spacer
agcacccggtcggcgccgcccggcgcaccggg	Protospacer
.  . . ***** ***** ***********  

946. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 11, identity: 0.656

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
gccgacgatccagcgcacaccggccgcccgtg	Protospacer
  .  ******** ****.*********  ..

947. spacer 9.12|58581|32|NC_020894|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 11, identity: 0.656

catttcgatccagagcacgccggccgccgcca	CRISPR spacer
gccgacgatccagcgcacaccggccgcccgtg	Protospacer
  .  ******** ****.*********  ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage