Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_020516 Azoarcus sp. KH32C, complete genome 1 crisprs csa3,WYL,cas3,DEDDh,RT,DinG 0 4 1 0
NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 0 crisprs csa3,DEDDh,RT 0 0 0 0

Results visualization

1. NC_020516
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020516_1 3817351-3817888 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_020516_1 1.6|3817694|35|NC_020516|CRT 3817694-3817728 35 NC_023283 Streptomyces sp. FR1 plasmid pFRL3, complete sequence 395995-396029 7 0.8
NC_020516_1 1.6|3817694|35|NC_020516|CRT 3817694-3817728 35 NZ_CP045303 Azotobacter salinestris strain KACC 13899 plasmid unnamed1, complete sequence 271250-271284 7 0.8
NC_020516_1 1.3|3817532|35|NC_020516|CRT 3817532-3817566 35 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 614829-614863 8 0.771
NC_020516_1 1.4|3817586|35|NC_020516|CRT 3817586-3817620 35 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 214776-214810 10 0.714
NC_020516_1 1.5|3817640|35|NC_020516|CRT 3817640-3817674 35 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 298869-298903 10 0.714
NC_020516_1 1.5|3817640|35|NC_020516|CRT 3817640-3817674 35 NZ_CP021373 Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence 377466-377500 11 0.686

1. spacer 1.6|3817694|35|NC_020516|CRT matches to NC_023283 (Streptomyces sp. FR1 plasmid pFRL3, complete sequence) position: , mismatch: 7, identity: 0.8

cgatcatgaccgcaggcggcgacgacctgatcgac	CRISPR spacer
ctctcctcgccgcagacggcgccgacctgatcgac	Protospacer
*  ** * .******.***** *************

2. spacer 1.6|3817694|35|NC_020516|CRT matches to NZ_CP045303 (Azotobacter salinestris strain KACC 13899 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.8

-cgatcatgaccgcaggcggcgacgacctgatcgac	CRISPR spacer
gcctgcatgg-cgctggcggcgacgacctgctcgac	Protospacer
 *   ****. *** *************** *****

3. spacer 1.3|3817532|35|NC_020516|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 8, identity: 0.771

agctcagcggcggcgcaggtgacgacgacatcgac	CRISPR spacer
cgctcagcggcggcgccggtgacgacacgctcaat	Protospacer
 *************** *********.   **.*.

4. spacer 1.4|3817586|35|NC_020516|CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.714

acatcagcaccggggacggcctgaacatcgtcctg	CRISPR spacer
gcgggggcaccggggccggcctgaccatcgtgaag	Protospacer
.*.  .********* ******** ******   *

5. spacer 1.5|3817640|35|NC_020516|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.714

aggtcctcggcggcaacgacgccgacaacattagc	CRISPR spacer
gcctcctcggcggcaacggcgccggcaagacgacg	Protospacer
.  ***************.*****.*** *. *  

6. spacer 1.5|3817640|35|NC_020516|CRT matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 11, identity: 0.686

aggtcctcggcggcaacgacgccgacaacattagc	CRISPR spacer
tcgtcctcggcggcaaggtcgccgacaagggacag	Protospacer
  ************** * ********* .   . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3578980 : 3587882 9 uncultured_virus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage