Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP043538 Methylobacterium mesophilicum SR1.6/6 chromosome, complete genome 5 crisprs WYL,DEDDh,csa3,cas3,PD-DExK 3 5 2 0

Results visualization

1. NZ_CP043538
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043538_1 2277625-2277756 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043538_2 3751686-3751921 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043538_3 5045740-5045844 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043538_4 6172740-6172819 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043538_5 6326839-6326939 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP043538_2 2.1|3751710|19|NZ_CP043538|CRISPRCasFinder 3751710-3751728 19 NZ_CP043538.1 3783019-3783037 0 1.0
NZ_CP043538_2 2.1|3751710|19|NZ_CP043538|CRISPRCasFinder 3751710-3751728 19 NZ_CP043538.1 3782904-3782922 0 1.0
NZ_CP043538_2 2.2|3751753|30|NZ_CP043538|CRISPRCasFinder 3751753-3751782 30 NZ_CP043538.1 3782947-3782976 0 1.0
NZ_CP043538_2 2.5|3751754|32|NZ_CP043538|CRT 3751754-3751785 32 NZ_CP043538.1 3782948-3782979 0 1.0

1. spacer 2.1|3751710|19|NZ_CP043538|CRISPRCasFinder matches to position: 3783019-3783037, mismatch: 0, identity: 1.0

ttgaaatgaggaatcgggg	CRISPR spacer
ttgaaatgaggaatcgggg	Protospacer
*******************

2. spacer 2.1|3751710|19|NZ_CP043538|CRISPRCasFinder matches to position: 3782904-3782922, mismatch: 0, identity: 1.0

ttgaaatgaggaatcgggg	CRISPR spacer
ttgaaatgaggaatcgggg	Protospacer
*******************

3. spacer 2.2|3751753|30|NZ_CP043538|CRISPRCasFinder matches to position: 3782947-3782976, mismatch: 0, identity: 1.0

gccgtccccaccttctccacactgcctggt	CRISPR spacer
gccgtccccaccttctccacactgcctggt	Protospacer
******************************

4. spacer 2.5|3751754|32|NZ_CP043538|CRT matches to position: 3782948-3782979, mismatch: 0, identity: 1.0

ccgtccccaccttctccacactgcctggtgcc	CRISPR spacer
ccgtccccaccttctccacactgcctggtgcc	Protospacer
********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP032686 Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence 744606-744639 0 1.0
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP032691 Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence 735912-735945 0 1.0
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 473922-473955 0 1.0
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 445520-445553 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 604053-604086 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 600927-600960 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 733969-734002 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 501252-501285 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 388396-388429 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 464544-464577 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 420497-420530 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 357775-357808 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 382317-382350 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 454834-454867 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 483193-483226 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 513340-513373 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 357478-357511 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 572517-572550 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 1968-2001 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 359754-359787 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 363149-363182 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 361989-362022 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 374797-374830 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 361989-362022 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 361981-362014 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 382317-382350 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 459415-459448 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 604055-604088 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 374797-374830 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 453374-453407 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 459415-459448 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 459415-459448 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 363149-363182 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 459415-459448 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 465027-465060 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 237753-237786 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 124231-124264 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 396020-396053 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 364334-364367 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1871984-1872017 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 366998-367031 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 431329-431362 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 964575-964608 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1492651-1492684 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP050087 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence 512124-512157 1 0.971
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 627340-627373 2 0.941
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 383506-383539 2 0.941
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 409718-409751 2 0.941
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 402982-403015 2 0.941
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP020909 Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence 464874-464907 2 0.941
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 27231-27264 2 0.941
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1106231-1106264 2 0.941
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 185693-185726 2 0.941
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 557190-557223 2 0.941
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 82171-82204 2 0.941
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 342949-342982 2 0.941
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 1938310-1938343 2 0.941
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1924164-1924197 2 0.941
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 529904-529937 2 0.941
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 237-270 2 0.941
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 158474-158507 4 0.882
NZ_CP043538_2 2.3|3751807|29|NZ_CP043538|CRISPRCasFinder 3751807-3751835 29 NC_014258 Pantoea vagans C9-1 plasmid pPag3, complete sequence 107501-107529 5 0.828
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP029174 Methylobacterium sp. DM1 plasmid pLVM1, complete sequence 141634-141667 6 0.824
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NC_022044 Paracoccus aminophilus JCM 7686 plasmid pAMI6, complete sequence 127186-127219 6 0.824
NZ_CP043538_2 2.2|3751753|30|NZ_CP043538|CRISPRCasFinder 3751753-3751782 30 NZ_CP026518 Deinococcus sp. NW-56 plasmid unnamed2, complete sequence 168631-168660 7 0.767
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_LN832560 Paracoccus aminovorans isolate JCM7685 plasmid II, complete sequence 131695-131728 7 0.794
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP024423 Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence 111241-111274 7 0.794
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP020441 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence 92383-92416 7 0.794
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 69068-69101 7 0.794
NZ_CP043538_2 2.6|3751808|31|NZ_CP043538|CRT 3751808-3751838 31 NZ_CP029211 Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence 278474-278504 8 0.742
NZ_CP043538_2 2.6|3751808|31|NZ_CP043538|CRT 3751808-3751838 31 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 281250-281280 8 0.742
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_LT969519 Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1 429599-429632 8 0.765
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 72328-72361 8 0.765
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP049031 Fluviibacterium aquatile strain SC52 plasmid pSC52_3, complete sequence 131953-131986 8 0.765
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP017942 Phyllobacterium zundukense strain Tri-48 plasmid unnamed3, complete sequence 441985-442018 8 0.765
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP038259 Acinetobacter baumannii strain 39741 plasmid pEH_gr13, complete sequence 119326-119359 8 0.765
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 440107-440140 8 0.765
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP033222 Parasedimentitalea marina strain W43 plasmid pW43C, complete sequence 133956-133989 9 0.735
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 27221-27254 9 0.735
NZ_CP043538_4 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder 6172763-6172796 34 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 711668-711701 9 0.735
NZ_CP043538_2 2.5|3751754|32|NZ_CP043538|CRT 3751754-3751785 32 NC_009475 Bradyrhizobium sp. BTAi1 plasmid pBBta01, complete sequence 205015-205046 10 0.688

1. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 0, identity: 1.0

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaacgacggcgg	Protospacer
**********************************

2. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 0, identity: 1.0

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaacgacggcgg	Protospacer
**********************************

3. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 0, identity: 1.0

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaacgacggcgg	Protospacer
**********************************

4. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccgggatgaacgacggcgg	Protospacer
******************* **************

5. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattattgcgccggcatgaacgacggcgg	Protospacer
**********.***********************

6. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccgggatgaacgacggcgg	Protospacer
******************* **************

7. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

8. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattattgcgccggcatgaacgacggcgg	Protospacer
**********.***********************

9. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

10. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

11. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

12. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

13. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

14. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

15. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccgggatgaacgacggcgg	Protospacer
******************* **************

16. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattattgcgccggcatgaacgacggcgg	Protospacer
**********.***********************

17. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

18. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctactactgcgccggcatgaacgacggcgg	Protospacer
*******.**************************

19. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccgggatgaacgacggcgg	Protospacer
******************* **************

20. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

21. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

22. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

23. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

24. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

25. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

26. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

27. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

28. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattattgcgccggcatgaacgacggcgg	Protospacer
**********.***********************

29. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

30. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattattgcgccggcatgaacgacggcgg	Protospacer
**********.***********************

31. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

32. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

33. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

34. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

35. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

36. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

37. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattattgcgccggcatgaacgacggcgg	Protospacer
**********.***********************

38. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

39. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgacggcgg	Protospacer
*************************.********

40. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccgggatgaacgacggcgg	Protospacer
******************* **************

41. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccgggatgaacgacggcgg	Protospacer
******************* **************

42. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccgggatgaacgacggcgg	Protospacer
******************* **************

43. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctactactgcgccggcatgaacgacggcgg	Protospacer
*******.**************************

44. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctactactgcgccggcatgaacgacggcgg	Protospacer
*******.**************************

45. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 1, identity: 0.971

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattattgcgccggcatgaacgacggcgg	Protospacer
**********.***********************

46. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 2, identity: 0.941

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattattgcgccgggatgaacgacggcgg	Protospacer
**********.******** **************

47. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 2, identity: 0.941

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattattgcgccggcatgaacgacggtgg	Protospacer
**********.********************.**

48. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 2, identity: 0.941

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattattgcgccggcatgaacgacggtgg	Protospacer
**********.********************.**

49. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.941

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggttattactgcgccggcatgaatgacggcgg	Protospacer
****.********************.********

50. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 2, identity: 0.941

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggttattactgcgccggcatgaatgacggcgg	Protospacer
****.********************.********

51. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 2, identity: 0.941

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggttattactgcgccggcatgaatgacggcgg	Protospacer
****.********************.********

52. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 2, identity: 0.941

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgatggcgg	Protospacer
*************************.**.*****

53. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 2, identity: 0.941

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattattgcgccgggatgaacgacggcgg	Protospacer
**********.******** **************

54. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 2, identity: 0.941

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctactattgcgccggcatgaacgacggcgg	Protospacer
*******.**.***********************

55. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 2, identity: 0.941

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccggcatgaatgatggcgg	Protospacer
*************************.**.*****

56. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 2, identity: 0.941

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccgggatgaacgatggcgg	Protospacer
******************* ********.*****

57. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 2, identity: 0.941

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcgccgggatgaacgatggcgg	Protospacer
******************* ********.*****

58. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 2, identity: 0.941

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattattgcgccggcatgaacgatggcgg	Protospacer
**********.*****************.*****

59. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 2, identity: 0.941

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattattgcgccgggatgaacgacggcgg	Protospacer
**********.******** **************

60. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 2, identity: 0.941

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggttattactgcgccggcatgaatgacggcgg	Protospacer
****.********************.********

61. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 4, identity: 0.882

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattactgcggcggcatgaacgacgaggc	Protospacer
*************** **************. * 

62. spacer 2.3|3751807|29|NZ_CP043538|CRISPRCasFinder matches to NC_014258 (Pantoea vagans C9-1 plasmid pPag3, complete sequence) position: , mismatch: 5, identity: 0.828

aggctga--gtgtgcccttcgcaggcttcgg	CRISPR spacer
--tctgaccgtgttcccttcgcaggcttcgt	Protospacer
   ****  **** **************** 

63. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP029174 (Methylobacterium sp. DM1 plasmid pLVM1, complete sequence) position: , mismatch: 6, identity: 0.824

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggctattattgcgccggcatgaacaagcacgc	Protospacer
**********.***************.*  .** 

64. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NC_022044 (Paracoccus aminophilus JCM 7686 plasmid pAMI6, complete sequence) position: , mismatch: 6, identity: 0.824

tcggctattactgcgccggcatgaacgacggcgg--	CRISPR spacer
ccggctattactgcgccgggatgaac--cagcaggc	Protospacer
.****************** ******  *.**.*  

65. spacer 2.2|3751753|30|NZ_CP043538|CRISPRCasFinder matches to NZ_CP026518 (Deinococcus sp. NW-56 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

gccgtccccaccttctccacactgcctggt	CRISPR spacer
gccgtccccaccatctccaccctcaccgcc	Protospacer
************ ******* **  *.* .

66. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_LN832560 (Paracoccus aminovorans isolate JCM7685 plasmid II, complete sequence) position: , mismatch: 7, identity: 0.794

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
ccggctattactgcgccggcatgaacaagcaggc	Protospacer
.*************************.*  . * 

67. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.794

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
ccggctattactgcgccggcatgaacaagcaggc	Protospacer
.*************************.*  . * 

68. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
ccggctattactgcgccggcatgaacaagcaggc	Protospacer
.*************************.*  . * 

69. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.794

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
ccggctattactgcgccggcatgaacaagcaggc	Protospacer
.*************************.*  . * 

70. spacer 2.6|3751808|31|NZ_CP043538|CRT matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 8, identity: 0.742

ggctgagtgtgcccttcgcaggcttcggccg	CRISPR spacer
ctccgcttgtgcccttcggcggcttcggcca	Protospacer
  *.*  ***********  **********.

71. spacer 2.6|3751808|31|NZ_CP043538|CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ggctgagtgtgcccttcgcaggcttcggccg	CRISPR spacer
ttgtggatgtgcgcctcgcaggcttcggccc	Protospacer
   **..***** *.*************** 

72. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 8, identity: 0.765

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
ccggctactactgcgccggcatgaaccagaaggc	Protospacer
.******.****************** * .. * 

73. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 8, identity: 0.765

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
ccggctattactgtgccggcatgaacaagcaggc	Protospacer
.************.************.*  . * 

74. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP049031 (Fluviibacterium aquatile strain SC52 plasmid pSC52_3, complete sequence) position: , mismatch: 8, identity: 0.765

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
cgggctattattgcgccggcatgaacaaacacgc	Protospacer
. ********.***************.*  .** 

75. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP017942 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.765

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
tcggatattattgcgccggcatgaacagtgaggc	Protospacer
**** *****.***************...*. * 

76. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP038259 (Acinetobacter baumannii strain 39741 plasmid pEH_gr13, complete sequence) position: , mismatch: 8, identity: 0.765

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
ccggatattactgcgccggcatgaatcaagaagc	Protospacer
.*** ********************. * *. * 

77. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.765

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
ccggctattacgccgccggcatgaacaaggaggc	Protospacer
.**********  *************.* *. * 

78. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP033222 (Parasedimentitalea marina strain W43 plasmid pW43C, complete sequence) position: , mismatch: 9, identity: 0.735

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
ccggctattactgtgcaggcatgaaccaacaagc	Protospacer
.************.** ********* *  . * 

79. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 9, identity: 0.735

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
ccggctattactgcgcaggtatgaacaagcaggc	Protospacer
.*************** **.******.*  . * 

80. spacer 4.1|6172763|34|NZ_CP043538|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

tcggctattactgcgccggcatgaacgacggcgg	CRISPR spacer
cgggctattacgccgccggcatgaacaaggaagc	Protospacer
. *********  *************.* *. * 

81. spacer 2.5|3751754|32|NZ_CP043538|CRT matches to NC_009475 (Bradyrhizobium sp. BTAi1 plasmid pBBta01, complete sequence) position: , mismatch: 10, identity: 0.688

ccgtccccaccttctccacactgcctggtgcc	CRISPR spacer
cgccgttcaccttcgcgacactgcctggtgag	Protospacer
*  . ..******* * *************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 948597 : 958861 9 Synechococcus_phage(42.86%) NA NA
DBSCAN-SWA_2 6170325 : 6244789 75 Paracoccus_phage(23.53%) protease,transposase,capsid,tRNA,tail,portal,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage