1. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
2. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
3. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcgggccggcggca Protospacer
**********.***********
4. spacer 9.15|1573075|22|NC_021054|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
5. spacer 9.15|1573075|22|NC_021054|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
6. spacer 9.15|1573075|22|NC_021054|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
7. spacer 9.15|1573075|22|NC_021054|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
8. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 2, identity: 0.917
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcgggacagcatggcgttg Protospacer
******* *.**************
9. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 2, identity: 0.917
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcgggacagcatggcgttg Protospacer
******* *.**************
10. spacer 3.6|335689|24|NC_021054|CRT matches to NC_028947 (Mycobacterium phage Kratio, complete genome) position: , mismatch: 2, identity: 0.917
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgccaaacggcatggcgttg Protospacer
********.***.***********
11. spacer 3.8|335785|24|NC_021054|CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 2, identity: 0.917
atgagcccgccggcgccgccgttg CRISPR spacer
aagagcacgccggcgccgccgttg Protospacer
* **** *****************
12. spacer 3.8|335785|24|NC_021054|CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.917
atgagcccgccggcgccgccgttg CRISPR spacer
atgaggacgccggcgccgccgttg Protospacer
***** *****************
13. spacer 9.2|1572148|22|NC_021054|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
14. spacer 9.2|1572148|22|NC_021054|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
15. spacer 9.2|1572148|22|NC_021054|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
16. spacer 9.2|1572148|22|NC_021054|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
17. spacer 9.2|1572148|22|NC_021054|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
18. spacer 9.3|1572202|22|NC_021054|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909
ggtaccgtcctcgccggcggtg CRISPR spacer
ggcaccgtcctcgccggcggtt Protospacer
**.******************
19. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
20. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
21. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
22. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
23. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
24. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
25. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
26. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
27. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
28. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgggg Protospacer
******************** .
29. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
accgccgatcaggccggcggca Protospacer
..********************
30. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ctcggcgatcaggccggcggca Protospacer
*** *****************
31. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
32. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
33. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
34. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
35. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcg Protospacer
***************** ***.
36. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ggcgccgatcaggccggcggcc Protospacer
* *******************
37. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggcctgcggcg Protospacer
*************** *****.
38. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
39. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgccg Protospacer
******************* *.
40. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgagcaggccggcggcc Protospacer
******** ************
41. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
42. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
43. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
44. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
45. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_023695 (Mycobacterium phage Violet, complete genome) position: , mismatch: 2, identity: 0.923
accggcggcaaaggcggcatgggcgg CRISPR spacer
accggcggcaaaggcggcaacggcgg Protospacer
******************* *****
46. spacer 2.11|334199|27|NC_021054|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.889
ccgccgttggcgaacagtccgccgttg CRISPR spacer
tcgccgttggcgatcagtccgccgtcg Protospacer
.************ ***********.*
47. spacer 2.11|334199|27|NC_021054|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 3, identity: 0.889
ccgccgttggcgaacagtccgccgttg CRISPR spacer
tcgccgttggcgatcagtccgccgtcg Protospacer
.************ ***********.*
48. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
49. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP026559 (Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p2_tig3, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgctgaacagcatgccgttg Protospacer
******.********** *****
50. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
51. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
52. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP019872 (Pseudomonas syringae pv. tomato strain B13-200 plasmid pB13-200A, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgctgaacagcatgccgttg Protospacer
******.********** *****
53. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
54. spacer 3.6|335689|24|NC_021054|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
55. spacer 3.6|335689|24|NC_021054|CRT matches to NC_017385 (Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgccgagcagcatggcgctg Protospacer
*********.**********.**
56. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
57. spacer 3.6|335689|24|NC_021054|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
58. spacer 3.6|335689|24|NC_021054|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacaggatggcgtcg Protospacer
************* *******.*
59. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcagaacagcatggcgcag Protospacer
******* *************. *
60. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP012910 (Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgccgagcagcatggcgctg Protospacer
*********.**********.**
61. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
62. spacer 3.6|335689|24|NC_021054|CRT matches to CP054316 (Escherichia coli strain SCU-483 plasmid pSCU-483-1) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcagaacagcatggcggtt Protospacer
******* ************* *
63. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
64. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
65. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
66. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_LR723679 (Arsenite-oxidising bacterium NT-25 plasmid 3) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagcatgccgtcg Protospacer
***************** ***.*
67. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
68. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcggtgaacagcatggcgttc Protospacer
****** .***************
69. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
70. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP029986 (Sphingomonas sp. FARSPH plasmid p01, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcagcgccgaacagcatggcgtcg Protospacer
*.*******************.*
71. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
72. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
73. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
74. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
75. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
76. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
77. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
78. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
79. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
80. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
81. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgccgatcagcatggcggcg Protospacer
********** ********** .*
82. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
83. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
84. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
85. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
86. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
87. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP031228 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pPla107-2) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgctgaacagcatgccgttg Protospacer
******.********** *****
88. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
89. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
90. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
91. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
92. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
93. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacaggatggcgtcg Protospacer
************* *******.*
94. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
95. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacaggatggcgtcg Protospacer
************* *******.*
96. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
97. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
98. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP044960 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.3, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcagaacagcatggcggtt Protospacer
******* ************* *
99. spacer 3.6|335689|24|NC_021054|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
100. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
101. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
102. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
103. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
104. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052880 (Escherichia coli strain C21 plasmid pC21-3, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcagaacagcatggcggtt Protospacer
******* ************* *
105. spacer 3.6|335689|24|NC_021054|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgccggacagcatggcgagg Protospacer
*********.*********** *
106. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP044333 (Methylocystis parvus strain BRCS2 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgccgaacaggatggcgatg Protospacer
************* ****** **
107. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
108. spacer 3.6|335689|24|NC_021054|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
109. spacer 3.6|335689|24|NC_021054|CRT matches to NC_014626 (Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgccgagcagcatggcgctg Protospacer
*********.**********.**
110. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
111. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP019215 (Escherichia coli strain WCHEC050613 plasmid pI_050613, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcagaacagcatggcggtt Protospacer
******* ************* *
112. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
113. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
114. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
115. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
116. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
117. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
118. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
119. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
120. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
121. spacer 3.6|335689|24|NC_021054|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
122. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
123. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
124. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
125. spacer 3.6|335689|24|NC_021054|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
126. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
127. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_LN890525 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcagaacagcatggcggtt Protospacer
******* ************* *
128. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
129. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
130. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
131. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
132. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
133. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
134. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_LT963412 (Pseudomonas syringae isolate CFBP3840 plasmid PP3, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgctgaacagcatgccgttg Protospacer
******.********** *****
135. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
136. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
137. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
138. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
139. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
140. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
141. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
142. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
143. spacer 3.6|335689|24|NC_021054|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcggcgaacagcatggcgatc Protospacer
****** ************** *
144. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
145. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
146. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
147. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
148. spacer 3.6|335689|24|NC_021054|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
149. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
150. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
151. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
152. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
153. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
154. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
155. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
156. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
157. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
158. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP047261 (Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326F, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgctgaacagcatgccgttg Protospacer
******.********** *****
159. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
160. spacer 3.8|335785|24|NC_021054|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ttgagccagccggcgccgccgttc Protospacer
****** ***************
161. spacer 3.8|335785|24|NC_021054|CRT matches to MN010758 (Gordonia phage Dardanus, complete genome) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtgaacccgccggcgccgccgttc Protospacer
.***.******************
162. spacer 3.8|335785|24|NC_021054|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
163. spacer 3.8|335785|24|NC_021054|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
164. spacer 3.8|335785|24|NC_021054|CRT matches to NZ_CP044330 (Methylocystis rosea strain BRCS1 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgacgccgccggcgccgccgttg Protospacer
*** ******************
165. spacer 3.8|335785|24|NC_021054|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
atcagcccgccggcgccgccgaag Protospacer
** ****************** *
166. spacer 3.8|335785|24|NC_021054|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
167. spacer 3.8|335785|24|NC_021054|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
168. spacer 3.8|335785|24|NC_021054|CRT matches to MT740732 (Ralstonia phage Darius, complete genome) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgagcccgccggcgccgccatag Protospacer
*******************.* *
169. spacer 3.8|335785|24|NC_021054|CRT matches to MH638294 (Ralstonia phage GP4, complete genome) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgagcccgccggcgccgccatag Protospacer
*******************.* *
170. spacer 3.8|335785|24|NC_021054|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
171. spacer 3.8|335785|24|NC_021054|CRT matches to NZ_CP025550 (Mycobacterium paragordonae strain 49061 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
atgagcccgccagcgccgccgcgg Protospacer
***********.*********. *
172. spacer 3.8|335785|24|NC_021054|CRT matches to NZ_CP034088 (Methylocystis rosea strain GW6 plasmid pGW6_2, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgacgccgccggcgccgccgttg Protospacer
*** ******************
173. spacer 3.8|335785|24|NC_021054|CRT matches to MT740740 (Ralstonia phage Gervaise, complete genome) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgagcccgccggcgccgccatag Protospacer
*******************.* *
174. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgcgg Protospacer
******************* .
175. spacer 9.4|1572256|22|NC_021054|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
ttcgccgatcaggccggcggtg Protospacer
*******************..
176. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
ctcgccgaacacgcggaagccgtct Protospacer
**.*********** *********
177. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
attgtcgaacacgcggaagccgtcg Protospacer
***.********* **********
178. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
179. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
180. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
181. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
catgcggaacacgccgaatccgtcg Protospacer
* *** ************ ******
182. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgatcacgccgtagccgttg Protospacer
******** ******* ******.*
183. spacer 9.15|1573075|22|NC_021054|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864
caatccggcggcgccgccggca CRISPR spacer
gaatccggcggcgccgccgggc Protospacer
*******************
184. spacer 10.5|2088306|24|NC_021054|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
185. spacer 10.5|2088306|24|NC_021054|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
186. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
ctcggcggcaaaggcggcattggcgg Protospacer
.****************** *****
187. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
cccggcggcaaaggcgcaatgggcgg Protospacer
*************** ********
188. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
atcggcggcaagggcggcatggccgg Protospacer
*.*********.********** ***
189. spacer 17.18|3949446|26|NC_021054|CRT matches to MN585973 (Mycobacterium phage StAnnes, complete genome) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
aacggcggcaacggcggcaagggcgg Protospacer
* ********* ******* ******
190. spacer 17.18|3949446|26|NC_021054|CRT matches to MG944221 (Mycobacterium phage Scowl, complete genome) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
aacggcggcaacggcggcaagggcgg Protospacer
* ********* ******* ******
191. spacer 17.18|3949446|26|NC_021054|CRT matches to KT309034 (Mycobacterium phage Dante, complete genome) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
aacggcggcaacggcggcaagggcgg Protospacer
* ********* ******* ******
192. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_021538 (Mycobacterium phage Job42, complete genome) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
aacggcggcaacggcggcaagggcgg Protospacer
* ********* ******* ******
193. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_026584 (Mycobacterium phage Minerva, complete genome) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
aacggcggcaacggcggcaagggcgg Protospacer
* ********* ******* ******
194. spacer 17.18|3949446|26|NC_021054|CRT matches to KJ409696 (Mycobacterium phage Lamina13, complete genome) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
aacggcggcaacggcggcaggggcgg Protospacer
* ********* ******* ******
195. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_028784 (Mycobacterium phage Tasp14, complete genome) position: , mismatch: 3, identity: 0.885
accggcggcaaaggcggcatgggcgg CRISPR spacer
aacggcggcaacggcggcaggggcgg Protospacer
* ********* ******* ******
196. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
197. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
198. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
199. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
200. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgccgaacagcatcgcgaac Protospacer
***************** ***
201. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
202. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
203. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
204. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
205. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
206. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
207. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
208. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
209. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
210. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
211. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
212. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
213. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
214. spacer 3.6|335689|24|NC_021054|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
215. spacer 3.8|335785|24|NC_021054|CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.833
atgagcccgccggcgccgccgttg CRISPR spacer
tcgagcccgccggcgccgccattc Protospacer
.******************.**
216. spacer 3.8|335785|24|NC_021054|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
atgagcccgccggcgccgccgttg CRISPR spacer
tccagcccgccggcgccggcgttg Protospacer
. *************** *****
217. spacer 5.1|366480|27|NC_021054|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
218. spacer 5.1|366480|27|NC_021054|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
219. spacer 5.7|366876|27|NC_021054|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
220. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
221. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
222. spacer 6.2|631303|30|NC_021054|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.867
accacgccggtgaccacgccg-ccaacgacg CRISPR spacer
accacgccggtggccacgccgaccagcggc- Protospacer
************.******** ***.**.*
223. spacer 9.1|1572088|28|NC_021054|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
224. spacer 9.1|1572088|28|NC_021054|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
225. spacer 9.1|1572088|28|NC_021054|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
226. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
tccgccgaacgcgccgaagccgtcg Protospacer
...*******.**************
227. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
228. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
229. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
230. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
231. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
232. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacacgccgatgccctgc Protospacer
***************** *** *
233. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
aatgccgaattcgccgaagccgtcg Protospacer
*******. **************
234. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cccgtagaacacgccgaagccgtcg Protospacer
*..*. *******************
235. spacer 9.14|1573018|25|NC_021054|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgccaccgacccccccttgc CRISPR spacer
ttttccgacaccgacccccccttga Protospacer
.** *** ****************
236. spacer 10.5|2088306|24|NC_021054|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
237. spacer 10.5|2088306|24|NC_021054|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
238. spacer 10.5|2088306|24|NC_021054|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
239. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP013224 (Salmonella enterica subsp. enterica serovar Anatum strain GT-38 plasmid PDM04, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
240. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KX470734 (Escherichia coli strain Ecoli14-55 plasmid pEC55-NDM4, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
241. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KY296103 (Enterobacter cloacae strain 13E169 plasmid pHN84NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
242. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KY978629 (Cronobacter sakazakii strain 505108 plasmid p505108-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
243. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MF072961 (Citrobacter freundii strain P10159 plasmid pP10159-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
244. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MF042356 (Enterobacter cloacae strain 20ES plasmid pNDM_20ES, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
245. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MF042359 (Serratia marcescens strain 7209 plasmid pNDM_7209, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
246. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KU726616 (Salmonella enterica subsp. enterica serovar Stanley strain LS001 plasmid pHS36-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
247. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KU314941 (Klebsiella pneumoniae isolate KP04 plasmid pKP04NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
248. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KX094555 (Escherichia coli strain ZHDC33 plasmid pZHDC33, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
249. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP009413 (Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
250. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KR059864 (Klebsiella pneumoniae strain KP-YQ13450 plasmid pYQ12450, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
251. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KP987216 (Citrobacter freundii strain 112298 plasmid p112298-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
252. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP022126 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752AC2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
253. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
254. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
255. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
256. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP028588 (Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
257. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP041930 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
258. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP048296 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
259. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP028560 (Acinetobacter sp. WCHA45 plasmid pNDM1_010045, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
260. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_018994 (Escherichia coli plasmid pNDM-1_Dok01, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
261. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
262. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_019153 (Klebsiella pneumoniae plasmid pNDM-KN, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
263. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_019162 (Klebsiella pneumoniae strain CRE380 plasmid pNDM-HN380, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
264. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP032878 (Escherichia coli strain WCHEC000837 plasmid pNDM4_000837, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
265. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP018817 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
266. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ctcggccgcaaaggcggcattggcgg Protospacer
.**** ************* *****
267. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ctcggccgcaaaggcggcattggcgg Protospacer
.**** ************* *****
268. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggccggaaaggcggcatgggcgg Protospacer
* *** * *****************
269. spacer 17.18|3949446|26|NC_021054|CRT matches to CP049311 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N53023 plasmid pN53023, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
270. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
271. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP048828 (Acinetobacter baumannii strain ABF9692 plasmid pABF9692, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
272. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP021206 (Escherichia coli strain Z1002 plasmid p1002-NDM1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
273. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP050416 (Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
274. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP032284 (Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
275. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_020811 (Klebsiella pneumoniae strain KPN5047 plasmid pKPN5047, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
276. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP030191 (Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
277. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP050426 (Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
278. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_023914 (Enterobacter cloacae strain CRE727 plasmid pNDM-HF727, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
279. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP044035 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
280. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP029118 (Escherichia coli strain AR435 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
281. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_019123 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH1148_107, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
282. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
283. spacer 17.18|3949446|26|NC_021054|CRT matches to MN178638 (Kluyvera cryocrescens strain SCW13 plasmid pNDM1_SCW13, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
284. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP038280 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
285. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
286. spacer 17.18|3949446|26|NC_021054|CRT matches to CP050158 (Enterobacter cloacae plasmid Carbapenemase(NDM-1)_IncX3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
287. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
288. spacer 17.18|3949446|26|NC_021054|CRT matches to CP050161 (Escherichia coli plasmid Carbapenemase(NDM-1)_IncX3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
289. spacer 17.18|3949446|26|NC_021054|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
290. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_021501 (Klebsiella michiganensis E718 plasmid pKOX_NDM1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
291. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP017672 (Providencia rettgeri strain RB151 plasmid pRB151-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
292. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP023914 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
293. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP029386 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pNDM6_040074, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
294. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcaaaagcggcctgggcgg Protospacer
. **********.***** *******
295. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP022226 (Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
296. spacer 17.18|3949446|26|NC_021054|CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
297. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
298. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtcggcggcaatggcggcgtgggcgg Protospacer
..********* ******.*******
299. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_020552 (Citrobacter freundii plasmid pYE315203, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
300. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP040598 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15_NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
301. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP014297 (Klebsiella pneumoniae strain KP38731 plasmid unnamed13 sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
302. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
accggcggcaatggcggcattggcct Protospacer
*********** ******** ***
303. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP020056 (Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
304. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP031884 (Klebsiella pneumoniae strain WCHKP095845 plasmid pNDM1_095845, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
305. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
306. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
307. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP031297 (Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
308. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP041229 (Acinetobacter haemolyticus strain AN54 plasmid pAhaeAN54e, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
309. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_LT985293 (Escherichia coli strain 4410-1 plasmid RCS79_p, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
310. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_LT985268 (Escherichia coli strain 699 plasmid RCS58_p, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
311. spacer 17.18|3949446|26|NC_021054|CRT matches to MN604267 (Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
312. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MK372385 (Morganella morganii strain ABC140 plasmid pABC140-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
313. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MK372381 (Klebsiella pneumoniae strain ABC52 plasmid pABC52-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
314. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP053899 (Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
315. spacer 17.18|3949446|26|NC_021054|CRT matches to MN657249 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
316. spacer 17.18|3949446|26|NC_021054|CRT matches to MN657250 (Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
317. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MH909333 (Klebsiella pneumoniae strain 7-SP plasmid p7SP-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
318. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MH909346 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
319. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MH909335 (Klebsiella pneumoniae strain 11-SP plasmid p11SP-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
320. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MH234505 (Escherichia coli strain CRE3694 plasmid pNDM-HK3694, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
321. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MH917282 (Klebsiella pneumoniae strain A457 plasmid pA457-NDA, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
322. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MH349095 (Escherichia coli strain 948 plasmid pMTC948, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
323. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MK372386 (Klebsiella pneumoniae strain BC700 plasmid pBC700-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
324. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MK372380 (Enterobacter cloacae strain ABC40 plasmid pABC40-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
325. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MK372382 (Escherichia coli strain ABC54 plasmid pABC54-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
326. spacer 17.18|3949446|26|NC_021054|CRT matches to MN657241 (Enterobacteriaceae bacterium strain 20-16 plasmid pCF104a-T3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
327. spacer 17.18|3949446|26|NC_021054|CRT matches to MN657242 (Enterobacteriaceae bacterium strain 128-16 plasmid pEC405a-T3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
328. spacer 17.18|3949446|26|NC_021054|CRT matches to MN657243 (Enterobacteriaceae bacterium strain 24-16 plasmid pEC744-T5, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
329. spacer 17.18|3949446|26|NC_021054|CRT matches to MN657244 (Enterobacteriaceae bacterium strain 690-16 plasmid pEC6332-T3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
330. spacer 17.18|3949446|26|NC_021054|CRT matches to MN657247 (Enterobacteriaceae bacterium strain 460-16 plasmid pECl-T3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
331. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
332. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MH457126 (Vibrio alginolyticus strain Vb1394 plasmid pC1394, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
333. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MH105052 (Escherichia coli strain EC600 plasmid pSL131T_IncX3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
334. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP044464 (Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
335. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MF042350 (Klebsiella pneumoniae strain 18ES plasmid pNDM_18ES, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
336. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MF042354 (Klebsiella pneumoniae strain 6TM plasmid pNDM_6TM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
337. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MF042353 (Klebsiella pneumoniae strain 1TM plasmid pNDM_1TM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
338. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MF042351 (Serratia marcescens strain 12TM plasmid pNDM_12TM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
339. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MF042358 (Enterobacter cloacae strain 22ES plasmid pNDM_22ES, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
340. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MF415608 (Enterobacter cloacae strain hhy03 plasmid pNDM-BJ03, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
341. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MF042352 (Serratia marcescens strain 4TM plasmid pNDM_4TM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
342. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MF042357 (Serratia marcescens strain 9580 plasmid pNDM_9580, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
343. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MG252893 (Raoultella ornithinolytica strain pRor-30818cz plasmid Ror-30818cz, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
344. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP041048 (Citrobacter sp. CF971 plasmid pBM527-2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
345. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KX832927 (Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
346. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KX786648 (Enterobacter cloacae strain B557 plasmid pB557-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
347. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KY399975 (Enterobacter cloacae strain EClY2403 plasmid pNDM1_EClY2403, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
348. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KY399974 (Enterobacter cloacae strain EClY2402 plasmid pNDM1_EClY2402, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
349. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP053895 (Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
350. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_AP023051 (Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
351. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP034756 (Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
352. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
353. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KU302802 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
354. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KU302801 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
355. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KJ588779 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US-2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
356. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KR351290 (Klebsiella pneumoniae subsp. pneumoniae strain K351 plasmid pK351, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
357. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KJ802405 (Providencia stuartii isolate GN576 plasmid pNDM-PstGN576, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
358. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KJ812998 (Enterobacter cloacae isolate GN574 plasmid pNDM-Ec1GN574, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
359. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KP900016 (Leclercia adecarboxylata strain P10164 plasmid pP10164-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
360. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KP765744 (Enterobacter cloacae strain ECN49 plasmid pNDM-ECN49, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
361. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KP868647 (Enterobacter cloacae strain WCHECl-14653 plasmid pNDM1_EC14653, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
362. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KJ802404 (Escherichia coli isolate GN568 plasmid pNDM-EcoGN568, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
363. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KT965092 (Acinetobacter towneri strain G165 plasmid pNDM-GJ01, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
364. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KT965093 (Acinetobacter towneri strain G295 plasmid pNDM-GJ02, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
365. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
366. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_023322 (Acinetobacter bereziniae strain CHI-40-1 plasmid pNDM-40-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
367. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP029731 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
368. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP053737 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
369. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KC887916 (Escherichia coli strain ARL10/167 isolate EC4 plasmid pEC4-NDM-6, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
370. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_KC887917 (Enterobacter cloacae isolate ECL3 plasmid pECL3-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
371. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP020524 (Escherichia coli strain 190 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
372. spacer 17.18|3949446|26|NC_021054|CRT matches to MT077883 (Escherichia coli plasmid p23, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
373. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
374. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP010370 (Acinetobacter nosocomialis strain 6411 plasmid p6411-9.012kb, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
375. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP013221 (Salmonella enterica subsp. enterica serovar Anatum strain GT-01 plasmid PDM02, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
376. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP024285 (Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
377. spacer 17.18|3949446|26|NC_021054|CRT matches to MN061454 (Enterobacter cloacae strain EC-14-60 plasmid pECL-14-60-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
378. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP032278 (Acinetobacter sp. WCHAc010034 plasmid pNDM1_010034, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
379. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP045561 (Acinetobacter nosocomialis strain AC1530 plasmid pAC1530, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
380. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_019045 (Escherichia coli strain N10-2337 plasmid pNDM102337, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
381. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_025130 (Raoultella planticola strain RJA274 plasmid NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
382. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_019158 (Klebsiella pneumoniae plasmid pNDM10469, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
383. spacer 17.18|3949446|26|NC_021054|CRT matches to MN310375 (Klebsiella quasipneumoniae strain QD1501 plasmid pQD1501-Ct1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
384. spacer 17.18|3949446|26|NC_021054|CRT matches to MN310377 (Klebsiella pneumoniae strain 12085 plasmid p12085-Ct1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
385. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
386. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
387. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP037965 (Klebsiella pneumoniae strain SCKP020135 plasmid pNDM1_020135, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
388. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_025184 (Klebsiella pneumoniae strain RJF866 plasmid pRJF866, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
389. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcagaggcggcaagggcgg Protospacer
. ********.******** ******
390. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
391. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP021962 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000008, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
392. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP022350 (Klebsiella michiganensis strain K516 plasmid pK516_NDM1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
393. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP046274 (Enterobacter hormaechei strain E70 plasmid pE70-NDM1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
394. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP039811 (Klebsiella pneumoniae strain C2660 plasmid pC2660-4-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
395. spacer 17.18|3949446|26|NC_021054|CRT matches to CP049307 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N58631 plasmid p58631, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
396. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ctcggccgcaaaggcggcattggcgg Protospacer
.**** ************* *****
397. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_025000 (Acinetobacter lwoffii strain Iz4b plasmid pNDM-Iz4b, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
398. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_024959 (Acinetobacter calcoaceticus strain NDM-WS2 plasmid pNDM-WS2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
399. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_009140 (Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
400. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP012168 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-239.973kb, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
401. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP021536 (Escherichia coli strain AR_0119 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
402. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP010399 (Acinetobacter baumannii strain 6200 plasmid p6200-47.274kb, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
403. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP035935 (Acinetobacter cumulans strain WCHAc060092 plasmid pNDM1_060092, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
404. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP006661 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
405. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcaaaggcggcaagagcgg Protospacer
. ***************** *.****
406. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_012690 (Escherichia coli plasmid peH4H, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
407. spacer 17.18|3949446|26|NC_021054|CRT matches to CP050164 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
408. spacer 17.18|3949446|26|NC_021054|CRT matches to MK933278 (Enterobacter hormaechei strain SCNJ07 plasmid pNDM-SCNJ07, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
409. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
410. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcaaacgcggcctgggcgg Protospacer
. ********** ***** *******
411. spacer 17.18|3949446|26|NC_021054|CRT matches to CP048298 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
412. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_019066 (Escherichia coli plasmid pAPEC1990_61, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
413. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_019069 (Escherichia coli plasmid pNDM10505, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
414. spacer 17.18|3949446|26|NC_021054|CRT matches to AMXH01000087 (Acinetobacter pittii strain XM1570 plasmid pXM1, complete sequence, whole genome shotgun sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
415. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_JQ739158 (Acinetobacter lwoffii strain ABZ78 plasmid pABZ78, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
416. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP043383 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
417. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_019985 (Acinetobacter baumannii ZW85-1 plasmid pAbNDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
418. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
419. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP018366 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
420. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP023187 (Klebsiella michiganensis strain K518 plasmid pK518_NDM1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
421. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_021813 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_01, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
422. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP028786 (Klebsiella pneumoniae strain SCKP020049 plasmid pNDM1_020049, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
423. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP021936 (Escherichia coli strain AR_0055 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
424. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
425. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
426. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP041938 (Klebsiella pneumoniae strain KP14003 plasmid pNDM-KP14003, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
427. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_022589 (Providencia rettgeri strain 09ACRGNY2001 plasmid pPrY2001, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
428. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_012692 (Escherichia coli plasmid pAR060302, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
429. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP015835 (Escherichia coli strain MS6198 plasmid pMS6198A, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
430. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
431. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP014478 (Acinetobacter pittii strain AP_882 plasmid pNDM-AP_882, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
432. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_023908 (Klebsiella pneumoniae strain KP1 plasmid pKP1-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
433. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
434. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_019268 (Acinetobacter lwoffii plasmid pNDM-BJ01, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
435. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_019281 (Acinetobacter lwoffii plasmid pNDM-BJ02, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
436. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_025116 (Acinetobacter sp. M131 plasmid pM131_NDM1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
437. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP040884 (Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
438. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP026015 (Klebsiella variicola strain 13450 plasmid p13450-3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
439. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_AP018143 (Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
440. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ctcggccgcaaaggcggcattggcgg Protospacer
.**** ************* *****
441. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP048797 (Providencia vermicola strain P8538 plasmid p8538-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
442. spacer 17.18|3949446|26|NC_021054|CRT matches to MN937240 (Enterobacter cloacae strain BSI034 plasmid pBSI034-NDM1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
443. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP037904 (Escherichia coli strain LHM10-1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
444. spacer 17.18|3949446|26|NC_021054|CRT matches to MN603981 (Klebsiella aerogenes strain 1564 plasmid p1564, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
445. spacer 17.18|3949446|26|NC_021054|CRT matches to MN604268 (Escherichia coli strain J53 plasmid pJ53_SAL-19-0623_NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
446. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_LN833432 (Acinetobacter baumannii isolate CHI-32 plasmid pNDM-32, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
447. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MK123268 (Serratia marcescens strain M17468 plasmid pSMA17468, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
448. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP053897 (Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
449. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP032132 (Acinetobacter chinensis strain WCHAc010005 plasmid pNDM1_010005, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
450. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MH995508 (Enterobacter cloacae strain ECL17464 plasmid pECL17464, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
451. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MH995506 (Citrobacter freundii strain CFR17394 plasmid pCFR17394, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
452. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MH917283 (Klebsiella pneumoniae strain A575 plasmid pA575-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
453. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MH909345 (Klebsiella pneumoniae strain N201205880 plasmid p205880-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
454. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MH105050 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncA/C-IncX3, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
455. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MH909343 (Klebsiella pneumoniae strain 1012018 plasmid p12018-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
456. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MH909347 (Klebsiella pneumoniae strain 362713 plasmid p362713-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
457. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MH263652 (Providencia rettgeri strain QD51 plasmid pNDM-QD51, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
458. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MH917281 (Klebsiella pneumoniae strain 14504 plasmid p14504-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
459. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MK101346 (Citrobacter freundii strain CRE3 plasmid pCRE7-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
460. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MK757441 (Alcaligenes faecalis strain AN70 plasmid pAN70-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
461. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP020090 (Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
462. spacer 17.18|3949446|26|NC_021054|CRT matches to MN657245 (Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
463. spacer 17.18|3949446|26|NC_021054|CRT matches to MN657246 (Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
464. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MF344560 (Enterobacter hormaechei strain 128379 plasmid p128379-NDM, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
465. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MG462729 (Escherichia coli strain AMA1742 plasmid pAMA1742, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
466. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP035537 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-2, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
467. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
468. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
469. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
470. spacer 17.18|3949446|26|NC_021054|CRT matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggcggcaagggcggcaagggcgg Protospacer
* ********.******* ******
471. spacer 17.18|3949446|26|NC_021054|CRT matches to MK994522 (Methanobacterium virus PhiF1, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcaaaggcggcaagggagg Protospacer
. ***************** *** **
472. spacer 17.18|3949446|26|NC_021054|CRT matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggcggcaagggcggcaagggcgg Protospacer
* ********.******* ******
473. spacer 17.18|3949446|26|NC_021054|CRT matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggcggcaagggcggcaagggcgg Protospacer
* ********.******* ******
474. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggcggcaagggcggcaagggcgg Protospacer
* ********.******* ******
475. spacer 17.18|3949446|26|NC_021054|CRT matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggcggcaagggcggcaagggcgg Protospacer
* ********.******* ******
476. spacer 17.18|3949446|26|NC_021054|CRT matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggcggcaagggcggcaagggcgg Protospacer
* ********.******* ******
477. spacer 17.18|3949446|26|NC_021054|CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
atgggcggcatgggcggcatgggcgg Protospacer
*. ******* .**************
478. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggccggaaaggcggcatgggcgg Protospacer
* *** * *****************
479. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
aagggcggcaagggcggcatcggcgg Protospacer
* ********.******** *****
480. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
cctggcggcatgggcggcatgggcgg Protospacer
*.******* .**************
481. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggccggaaaggcggcatgggcgg Protospacer
* *** * *****************
482. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
atgggcggcatgggcggcatgggcgg Protospacer
*. ******* .**************
483. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
aagggcggcaatggcggcatcggcgg Protospacer
* ******** ******** *****
484. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
tcaggcggcaaaggcggcagcggcgg Protospacer
* **************** *****
485. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
gcgggcggcacagccggcatgggcgg Protospacer
.* ******* ** ************
486. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
ccgggcggcatgggcggcatgggcgg Protospacer
* ******* .**************
487. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
tcaggcggcaaaggcggcagcggcgg Protospacer
* **************** *****
488. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
tcaggcggcaaaggcggcagcggcgg Protospacer
* **************** *****
489. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
cctggcggcatgggcggcatgggcgg Protospacer
*.******* .**************
490. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
gcgggcggcaacggcggcaggggcgg Protospacer
.* ******** ******* ******
491. spacer 17.18|3949446|26|NC_021054|CRT matches to JN698993 (Mycobacterium phage Firecracker, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
atgggcggcaagggcggcaagggcgg Protospacer
*. ********.******* ******
492. spacer 17.18|3949446|26|NC_021054|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
atgggcggcatgggcggcatgggcgg Protospacer
*. ******* .**************
493. spacer 17.18|3949446|26|NC_021054|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
atgggcggcatgggcggcatgggcgg Protospacer
*. ******* .**************
494. spacer 17.18|3949446|26|NC_021054|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.846
accggcggcaaaggcggcatgggcgg CRISPR spacer
atgggcggcatgggcggcatgggcgg Protospacer
*. ******* .**************
495. spacer 2.2|333718|27|NC_021054|CRT matches to MN103533 (Mycobacterium phage Weirdo19, complete genome) position: , mismatch: 5, identity: 0.815
ccggcgcctagagcgttggcaccgctg CRISPR spacer
ctcgggcctagagcgttggcaccgtgg Protospacer
*. * *******************. *
496. spacer 2.11|334199|27|NC_021054|CRT matches to MK415400 (Phage apr34_1784, complete genome) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
ccgccgttggcgaccagtccgcaatca Protospacer
************* ******** .*..
497. spacer 2.11|334199|27|NC_021054|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
gggtcgtcggagaacagtccgccgttg Protospacer
*.***.** ****************
498. spacer 2.11|334199|27|NC_021054|CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
gtggcgttgtcgaacagaccgccgttg Protospacer
.* ***** ******* *********
499. spacer 2.12|334244|30|NC_021054|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccgggtcaccgccagcggggccagga Protospacer
********* ************ ***. *.
500. spacer 2.12|334244|30|NC_021054|CRT matches to KM389325 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccgatccagacaccgccagcggcgccgagg Protospacer
***..* .******************* **
501. spacer 2.12|334244|30|NC_021054|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcg-ccgtgg CRISPR spacer
ccggccgggacaccgcccccggcgagcgcg- Protospacer
***************** ***** **.*
502. spacer 2.12|334244|30|NC_021054|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
503. spacer 2.12|334244|30|NC_021054|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
504. spacer 2.12|334244|30|NC_021054|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
505. spacer 3.6|335689|24|NC_021054|CRT matches to NZ_CP030829 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence) position: , mismatch: 5, identity: 0.792
ccggcgccgaacagcatggcgttg CRISPR spacer
atggcgccgaacagcatggcgcga Protospacer
.*******************. .
506. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 5, identity: 0.848
-ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gtcggcg-tgccgatgacgccggccgggccggat Protospacer
.***** .**** ************ *******
507. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 5, identity: 0.848
-ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gtcggcg-tgccgatgacgccggccgggccggat Protospacer
.***** .**** ************ *******
508. spacer 5.1|366480|27|NC_021054|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
509. spacer 5.1|366480|27|NC_021054|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
510. spacer 5.7|366876|27|NC_021054|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
511. spacer 5.7|366876|27|NC_021054|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
512. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
513. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
514. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
515. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
516. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
517. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
518. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
519. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
520. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
521. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
522. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
523. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
524. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
525. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
526. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
527. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
528. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
529. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
530. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
531. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
532. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
533. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
534. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
535. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
536. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
537. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
538. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
539. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
540. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
541. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
542. spacer 9.1|1572088|28|NC_021054|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gctgccgtgggtgccatcgttgccgagt Protospacer
*.***** *****************. .
543. spacer 9.1|1572088|28|NC_021054|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
544. spacer 9.1|1572088|28|NC_021054|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
545. spacer 9.1|1572088|28|NC_021054|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gttgccgcgggtgccctcgttgcggacg Protospacer
******* ******* ******* *.*
546. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gccgccgaacacgccgaagccgttt Protospacer
..********************.
547. spacer 9.5|1572310|25|NC_021054|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaacacgccgacgccgcgc Protospacer
**************** ****.
548. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
549. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
550. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
551. spacer 9.13|1572952|34|NC_021054|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853
gtcgccgtgcagccagccaccaccgcca-ccggcg CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc- Protospacer
*************.********* *** ** **
552. spacer 14.20|3122981|28|NC_021054|CRISPRCasFinder,CRT,PILER-CR matches to KR053201 (Gordonia phage GTE8, complete genome) position: , mismatch: 5, identity: 0.821
tagaaggcgatgtggtgctggatttcga CRISPR spacer
ctgtcggcgatgtggtcctggatttcga Protospacer
. * *********** ***********
553. spacer 15.7|3740803|31|NC_021054|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.839
aacgccc-acttcaccgccgttgccgccgtca CRISPR spacer
-acacccgacttcaccgccgctgccgccgaga Protospacer
**.*** ************.******** *
554. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 5, identity: 0.844
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
agcagcgccaccggcggggccggcggcgactc Protospacer
*. .*** *****************.******
555. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP054842 (Acidovorax sp. 16-35-5 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.857
agcagcggtgccggcggcaccaacggctccggcgg- CRISPR spacer
cgcatcggtgccggcggcaccatcggc-acggcggc Protospacer
*** ***************** **** ******
556. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggccaaggcggcatcggcgc Protospacer
. ******* ********** ****
557. spacer 17.18|3949446|26|NC_021054|CRT matches to CP047389 (Agrobacterium sp. CGMCC 11546 plasmid pA) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
accggcggcaaaggcggcatccacct Protospacer
******************** .*
558. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gacggcggcgaaggcggcacgggcgc Protospacer
. *******.*********.*****
559. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_007713 (Sodalis glossinidius str. 'morsitans' plasmid pSG1, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
cccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
560. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_014840 (Pantoea sp. At-9b plasmid pPAT9B03, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
atcgtcggcaaaggcggcatggggcc Protospacer
*.** ******************
561. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP032313 (Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcaaaggtggcatcggcga Protospacer
. ************.***** ****.
562. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gccggcggcaatgtcggcatgggcac Protospacer
.********** * **********.
563. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_LN854558 (Sodalis glossinidius str. 'morsitans' isolate B4 plasmid pSG1, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
cccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
564. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gccggcggcaaaggcggcatctgtgt Protospacer
.******************* *.*
565. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
atcgtcggcaaaggcggcatggggcc Protospacer
*.** ******************
566. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcgacggcggcatgggcgt Protospacer
. *******.* *************
567. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_007182 (Sodalis glossinidius pSG1 plasmid from Glossina austeni) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
cccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
568. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_007183 (Sodalis glossinidius pSG1 plasmid from Glossina palpalis palpalis) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
cccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
569. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
accggcggcaacggcggcatcgggca Protospacer
*********** ******** ** .
570. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_AP022338 (Mameliella alba strain KU6B plasmid pKUB257, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
acaggcggcaagggcggcatgggtca Protospacer
** ********.***********. .
571. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
tccggcggcaccggcggcatgggcaa Protospacer
********* ************..
572. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_042098 (Erwinia phage vB_EamM_Desertfox, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
tccggcggcaaaggcgtcatggatga Protospacer
*************** *****..*.
573. spacer 17.18|3949446|26|NC_021054|CRT matches to MG655267 (Erwinia phage vB_EamM_Bosolaphorus, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
tccggcggcaaaggcgtcatggatga Protospacer
*************** *****..*.
574. spacer 17.18|3949446|26|NC_021054|CRT matches to MG655269 (Erwinia phage vB_EamM_MadMel, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
tccggcggcaaaggcgtcatggatga Protospacer
*************** *****..*.
575. spacer 17.18|3949446|26|NC_021054|CRT matches to KF806589 (Erwinia phage Ea35-70, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
tccggcggcaaaggcgtcatggatga Protospacer
*************** *****..*.
576. spacer 17.18|3949446|26|NC_021054|CRT matches to KU886223 (Erwinia phage vB_EamM_Simmy50, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
tccggcggcaaaggcgtcatggatga Protospacer
*************** *****..*.
577. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
accggcggcaacggcggcatcgggca Protospacer
*********** ******** ** .
578. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
579. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtgggcggcacaggcggcacgggcgg Protospacer
.. ******* ********.******
580. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
accggcggcaacggcggcatcgggca Protospacer
*********** ******** ** .
581. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gccggcggcaagggcggcacgggcct Protospacer
.**********.*******.****
582. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggcggcggcaaaggcggcgagggcga Protospacer
. ****************. *****.
583. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
accggcggcaacggcggcatcgggca Protospacer
*********** ******** ** .
584. spacer 17.18|3949446|26|NC_021054|CRT matches to AY129335 (Mycobacterium virus Corndog, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
585. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_004685 (Mycobacterium phage Corndog, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
586. spacer 17.18|3949446|26|NC_021054|CRT matches to MG099943 (Mycobacterium phage Familton, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
587. spacer 17.18|3949446|26|NC_021054|CRT matches to MN585964 (Mycobacterium phage Blessica, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
588. spacer 17.18|3949446|26|NC_021054|CRT matches to KJ829260 (Mycobacterium phage YungJamal, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
589. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_022057 (Mycobacterium phage Catdawg, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
590. spacer 17.18|3949446|26|NC_021054|CRT matches to MN428052 (Mycobacterium phage Smooch, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
gtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
591. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 5, identity: 0.808
accggcggcaaaggcggcatgggcgg CRISPR spacer
ggtggcggcgcaggcggcatgggcgg Protospacer
. .******. ***************
592. spacer 2.12|334244|30|NC_021054|CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 6, identity: 0.8
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccgggacaccggcatcggcgaaggcg Protospacer
*************** ** ***** * *
593. spacer 2.12|334244|30|NC_021054|CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 6, identity: 0.8
ccggccgggacaccgccagcggcgccgtgg---- CRISPR spacer
ccagccgggagaccgccagcggc----tggctct Protospacer
**.******* ************ ***
594. spacer 2.12|334244|30|NC_021054|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 6, identity: 0.8
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
agatggcc--gacaccaccagcggcgccgtgc Protospacer
.**** ******.**************
595. spacer 3.7|335734|30|NC_021054|CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 6, identity: 0.8
ccgatcccactgctggcgaccccgccagcg CRISPR spacer
ccggcgccactgctggcgtccacgccagcc Protospacer
***.. ************ ** *******
596. spacer 3.7|335734|30|NC_021054|CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 6, identity: 0.8
ccgatcccactgctggcgaccccgccagcg CRISPR spacer
ccggcgccactgctggcgtccacgccagcc Protospacer
***.. ************ ** *******
597. spacer 3.7|335734|30|NC_021054|CRT matches to KC292025 (Halovirus HHTV-1, complete genome) position: , mismatch: 6, identity: 0.8
ccgatcccactgctggcgaccccgccagcg-- CRISPR spacer
tcgatcccactgctggccaccctg--aacggc Protospacer
.**************** ****.* *.**
598. spacer 3.9|335830|33|NC_021054|CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 6, identity: 0.818
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gcgatgccgccgttgccgccggccccgccgggt Protospacer
**..********** ******** ******.*
599. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.818
ccggcgccgccgttgacgccggccgcg--ccggat CRISPR spacer
tccgcgccgccgtcgacgcccgccgcgacccgg-- Protospacer
.* **********.****** ****** ****
600. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 6, identity: 0.818
-ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gcaggcg-tgccgttgacgccggtcgcgcaggaa Protospacer
* **** .**************.***** ***
601. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 6, identity: 0.818
-ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gcaggcg-tgccgttgacgccggtcgcgcaggaa Protospacer
* **** .**************.***** ***
602. spacer 5.1|366480|27|NC_021054|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
603. spacer 5.6|366810|33|NC_021054|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
604. spacer 5.7|366876|27|NC_021054|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
605. spacer 5.9|367026|27|NC_021054|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
606. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
607. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
608. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
609. spacer 5.10|367086|27|NC_021054|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
610. spacer 6.2|631303|30|NC_021054|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gcgccgccggtgactacgccgccagcgaca Protospacer
.* **********.*********.****.
611. spacer 6.2|631303|30|NC_021054|CRT matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
612. spacer 6.2|631303|30|NC_021054|CRT matches to NC_041891 (Propionibacterium phage B22, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
613. spacer 6.2|631303|30|NC_021054|CRT matches to NC_041894 (Propionibacterium phage E6, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
614. spacer 6.2|631303|30|NC_021054|CRT matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
615. spacer 6.2|631303|30|NC_021054|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tccacgccggtgaccacgccgaccaccttg Protospacer
******************** * ** .*
616. spacer 6.2|631303|30|NC_021054|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
aagaggccggcgagcacgccgccaacgaag Protospacer
* * *****.** ************** *
617. spacer 6.2|631303|30|NC_021054|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
618. spacer 6.2|631303|30|NC_021054|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
619. spacer 6.2|631303|30|NC_021054|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
620. spacer 6.2|631303|30|NC_021054|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
621. spacer 6.2|631303|30|NC_021054|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
622. spacer 6.2|631303|30|NC_021054|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
623. spacer 6.2|631303|30|NC_021054|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
624. spacer 6.2|631303|30|NC_021054|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
625. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
626. spacer 9.1|1572088|28|NC_021054|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
627. spacer 9.1|1572088|28|NC_021054|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
628. spacer 9.1|1572088|28|NC_021054|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccggcggtgccatcggtgccgagg Protospacer
* ****** ********** *****.
629. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
630. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
631. spacer 9.13|1572952|34|NC_021054|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824
--gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca Protospacer
****.* ***** ******************.
632. spacer 14.10|3122248|27|NC_021054|CRISPRCasFinder,CRT matches to NZ_CP017103 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872a, complete sequence) position: , mismatch: 6, identity: 0.778
acgttggaagcgtttcgagcgtacgga CRISPR spacer
tcgttggaaacgtttcgagcgtcttgg Protospacer
********.************ . *.
633. spacer 15.7|3740803|31|NC_021054|CRT matches to NC_009478 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence) position: , mismatch: 6, identity: 0.806
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgaccacttcaccgccgtcgccgccggcg Protospacer
. ** ***************.******* *.
634. spacer 17.5|3948319|32|NC_021054|CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 6, identity: 0.812
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aagcgcggcaccggcgggaccggcggcgtgtc Protospacer
**. **************.******.** **
635. spacer 17.18|3949446|26|NC_021054|CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 6, identity: 0.769
accggcggcaaaggcggcatgggcgg CRISPR spacer
cttctcggcaaaggcggcatgggcga Protospacer
.. ********************.
636. spacer 17.18|3949446|26|NC_021054|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.769
accggcggcaaaggcggcatgggcgg CRISPR spacer
accggcggcaaaggcggcaacctctt Protospacer
******************* *
637. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP013528 (Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence) position: , mismatch: 6, identity: 0.769
accggcggcaaaggcggcatgggcgg CRISPR spacer
gccggcggcaagggcggcatggcgtc Protospacer
.**********.**********
638. spacer 17.18|3949446|26|NC_021054|CRT matches to NZ_CP013581 (Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence) position: , mismatch: 6, identity: 0.769
accggcggcaaaggcggcatgggcgg CRISPR spacer
gccggcggcaagggcggcatggcgtc Protospacer
.**********.**********
639. spacer 2.12|334244|30|NC_021054|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccggcagcggcgcgaaca Protospacer
******.******** ********* . .
640. spacer 2.12|334244|30|NC_021054|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ttggcccggtcaccgccagcggcgccgcca Protospacer
..**** ** *****************. .
641. spacer 2.12|334244|30|NC_021054|CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
cgggccggaacaccgccagcggcgtgaggc Protospacer
* ******.***************. . *
642. spacer 2.12|334244|30|NC_021054|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcgcctatgactccgccagcggcgccgtgc Protospacer
.** *.. *** *****************
643. spacer 2.12|334244|30|NC_021054|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacaccga Protospacer
******.*************.**.* .*.
644. spacer 2.12|334244|30|NC_021054|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
645. spacer 2.12|334244|30|NC_021054|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
646. spacer 2.12|334244|30|NC_021054|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
647. spacer 2.12|334244|30|NC_021054|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
acggccgggtcatcgccagcggcgaaccgg Protospacer
******** **.*********** .**
648. spacer 2.12|334244|30|NC_021054|CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
accgcatcgaccccgccagcggcgccgtga Protospacer
* ** *** *****************.
649. spacer 2.12|334244|30|NC_021054|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
650. spacer 2.12|334244|30|NC_021054|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
651. spacer 2.12|334244|30|NC_021054|CRT matches to NC_021279 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
652. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.788
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
cgggcgccgccgatgacgccggccgcgtggagc Protospacer
* ********** **************. *...
653. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttgacgccgccgttgccgccgcccgcgccgctt Protospacer
..*.*********** ***** ******** *
654. spacer 3.9|335830|33|NC_021054|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.788
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttgacgccgccgttgccgccgcccgcgccgctt Protospacer
..*.*********** ***** ******** *
655. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 7, identity: 0.788
ccggc--gccgccgttgacgccggccgcgccggat CRISPR spacer
--ggttggccgccgctgccgccggccgcgccgcct Protospacer
**. *******.** ************** *
656. spacer 5.4|366675|27|NC_021054|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
657. spacer 6.2|631303|30|NC_021054|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
taggcgccggtgaccccgccgccgacgatg Protospacer
.*********** *******.****.*
658. spacer 6.2|631303|30|NC_021054|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tgcgtggcggtgaccacgccgccaatggcg Protospacer
*..* ******************.*.**
659. spacer 6.2|631303|30|NC_021054|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atagcgccggtcaccgcgccgccaacgata Protospacer
*. .******* ***.************..
660. spacer 6.2|631303|30|NC_021054|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
661. spacer 6.2|631303|30|NC_021054|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
662. spacer 6.2|631303|30|NC_021054|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
663. spacer 6.2|631303|30|NC_021054|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
664. spacer 6.2|631303|30|NC_021054|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ccggcgccggtgaccgcgccgccaaggcag Protospacer
* .***********.********* * *
665. spacer 6.2|631303|30|NC_021054|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggcccgccgatggccacgccgccaacggca Protospacer
. * *****.**.**************.*.
666. spacer 6.2|631303|30|NC_021054|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gtcgaggcggtgaccacgccgccgccgacg Protospacer
..*. * ****************. *****
667. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
668. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
669. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
670. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
671. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
672. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
673. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
674. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
675. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
676. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
677. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
678. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
679. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
680. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
681. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
682. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
683. spacer 9.1|1572088|28|NC_021054|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75
gttgccgggggtgccatcgttgccggcc CRISPR spacer
agcacccggggtgccgtcgttgccggcg Protospacer
. ..** ********.***********
684. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc Protospacer
. * **** *********.**********
685. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg Protospacer
**. ***.************ ******. *.
686. spacer 10.3|2088216|30|NC_021054|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
687. spacer 10.3|2088216|30|NC_021054|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
688. spacer 10.3|2088216|30|NC_021054|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
689. spacer 14.20|3122981|28|NC_021054|CRISPRCasFinder,CRT,PILER-CR matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 7, identity: 0.75
tagaaggcgatgtggtgctggatttcga CRISPR spacer
gcggcttcgatgtggtgctcgatttcga Protospacer
*. ************ ********
690. spacer 14.20|3122981|28|NC_021054|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.75
tagaaggcgatgtggtgctggatttcga CRISPR spacer
cgctgggcgatgtgccgctggatttcga Protospacer
.. .********* .************
691. spacer 15.7|3740803|31|NC_021054|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
692. spacer 15.7|3740803|31|NC_021054|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
693. spacer 15.7|3740803|31|NC_021054|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atccgccatttcaccgccgttgccgacgccg Protospacer
* * ***.**************** **.*.
694. spacer 17.3|3948175|35|NC_021054|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
aacggcggggccggcggtagcggcggcgcaggcgc Protospacer
*.************************ ** ..* .
695. spacer 17.3|3948175|35|NC_021054|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
agcggcggggacggcggcagcggcggcgggctctt Protospacer
********** ******.******** * ***
696. spacer 17.3|3948175|35|NC_021054|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
697. spacer 17.3|3948175|35|NC_021054|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
698. spacer 17.3|3948175|35|NC_021054|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
699. spacer 17.3|3948175|35|NC_021054|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
700. spacer 17.3|3948175|35|NC_021054|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
701. spacer 17.3|3948175|35|NC_021054|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
702. spacer 17.3|3948175|35|NC_021054|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
703. spacer 17.3|3948175|35|NC_021054|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
704. spacer 17.3|3948175|35|NC_021054|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
705. spacer 17.3|3948175|35|NC_021054|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcggggccaactt-- CRISPR spacer
ggcggcgcggccggcggcagcggc--ggccaacccgg Protospacer
.****** *********.****** *******..
706. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 7, identity: 0.781
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagtcggcaccggcggggacggaacctcctc Protospacer
**** ************** *** . * ***
707. spacer 17.5|3948319|32|NC_021054|CRT matches to CP006582 (Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence) position: , mismatch: 7, identity: 0.781
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagacggcgccggcggggccgggatcggcgc Protospacer
****.****.************* . **.* *
708. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 7, identity: 0.8
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
cgctgatgcgccggcgacaccaaaggctccggcgg Protospacer
** * *.*******.****** ***********
709. spacer 17.17|3949374|35|NC_021054|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
aacggcggggccggcggtagcggcggcgcaggcgc Protospacer
*.************************ ** ..* .
710. spacer 17.17|3949374|35|NC_021054|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
agcggcggggacggcggcagcggcggcgggctctt Protospacer
********** ******.******** * ***
711. spacer 17.17|3949374|35|NC_021054|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
712. spacer 17.17|3949374|35|NC_021054|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
713. spacer 17.17|3949374|35|NC_021054|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
714. spacer 17.17|3949374|35|NC_021054|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
715. spacer 17.17|3949374|35|NC_021054|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
716. spacer 17.17|3949374|35|NC_021054|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
717. spacer 17.17|3949374|35|NC_021054|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
718. spacer 17.17|3949374|35|NC_021054|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
719. spacer 17.17|3949374|35|NC_021054|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******** *.*************** **.*.*
720. spacer 17.17|3949374|35|NC_021054|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 7, identity: 0.8
agcggcggggccggcggtagcggcggggccaactt-- CRISPR spacer
ggcggcgcggccggcggcagcggc--ggccaacccgg Protospacer
.****** *********.****** *******..
721. spacer 2.3|333763|31|NC_021054|CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 8, identity: 0.742
ccggcggagccgatgtagcaagccgccgttc CRISPR spacer
aggccggagccgatgtagccagcccccaccc Protospacer
* *************** **** **...*
722. spacer 2.12|334244|30|NC_021054|CRT matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcaccctggacaccgcctgcggcgccggac Protospacer
.*. ** ********** ********* .
723. spacer 2.12|334244|30|NC_021054|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccggcagcggcacgaaca Protospacer
******.******** *******.* . .
724. spacer 2.12|334244|30|NC_021054|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcgcggtcgacaccgccagcggcgacgtga Protospacer
.** **************** ****.
725. spacer 2.12|334244|30|NC_021054|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcg----gcgccgtgg CRISPR spacer
agggccgggacaccgcccgcggccagcgct---- Protospacer
*************** *** ****.
726. spacer 3.9|335830|33|NC_021054|CRT matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccgtcgccgccgttgccgccggccgcgatcacc Protospacer
*** *********** *********** . . .
727. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta Protospacer
********* ***** ******** * **
728. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
caggcgccgccgtcgacgccggccgccatcgcc Protospacer
* ***********.************ . * .
729. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta Protospacer
********* ***** ******** * **
730. spacer 3.9|335830|33|NC_021054|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta Protospacer
********* ***** ******** * **
731. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
caggcgccgccgtcgacgccggccgccatcgcc Protospacer
* ***********.************ . * .
732. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
caggcgccgtcgttgacgccggacgcgttgccg Protospacer
* *******.************ ****..*
733. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
acgaagccgccgttgccgccggccgcaccgccg Protospacer
**. ********** **********.***
734. spacer 3.9|335830|33|NC_021054|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ggggagccgccgttgccgccggccgccgccgac Protospacer
** ********** ********** * **.
735. spacer 3.9|335830|33|NC_021054|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccacccccgccgttggcgccgcccgcgccgccg Protospacer
**. * *********.***** ********
736. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
acgaagccgccgtcgccgccggccgcgccgccg Protospacer
**. ********.* **************
737. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
tgatcgccgccgtcgacgccgcccgcgccatat Protospacer
. . *********.******* *******. **
738. spacer 3.9|335830|33|NC_021054|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccactgccggcgttgacgccgcccgcgccgccc Protospacer
**. .**** *********** ******** .
739. spacer 3.9|335830|33|NC_021054|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccactgccggcgttgacgccgcccgcgccgccc Protospacer
**. .**** *********** ******** .
740. spacer 3.9|335830|33|NC_021054|CRT matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcaccgccgttgccgccggccgtataggcc Protospacer
*****.********* *********... ** .
741. spacer 3.9|335830|33|NC_021054|CRT matches to MK524485 (Mycobacterium phage MissDaisy, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ctcgcgccgccggtgacgcgggccgcgctgccg Protospacer
*. ********* ****** ********.*
742. spacer 3.9|335830|33|NC_021054|CRT matches to MH926058 (Mycobacterium phage Reptar3000, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ctcgcgccgccggtgacgcgggccgcgctgccg Protospacer
*. ********* ****** ********.*
743. spacer 3.9|335830|33|NC_021054|CRT matches to MK524488 (Mycobacterium phage Patt, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ctcgcgccgccggtgacgcgggccgcgctgccg Protospacer
*. ********* ****** ********.*
744. spacer 3.9|335830|33|NC_021054|CRT matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcaccgccgttgccgccggccgtataggcc Protospacer
*****.********* *********... ** .
745. spacer 3.9|335830|33|NC_021054|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccactgccggcgttgacgccgcccgcgccgccc Protospacer
**. .**** *********** ******** .
746. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat---- CRISPR spacer
ccggcgccgccgttggcgccgac----ccgaactaca Protospacer
***************.*****.* ***.*.
747. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gcggagccgccgttgccgccggccgaacctcgt Protospacer
*** ********** ********* .** .*
748. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta Protospacer
********* ***** ******** * **
749. spacer 3.9|335830|33|NC_021054|CRT matches to MH271296 (Gordonia phage Emperor, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
cccttgtcgcctttggcgccggccgcgccggtg Protospacer
** .*.**** ***.***************
750. spacer 5.6|366810|33|NC_021054|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
751. spacer 5.6|366810|33|NC_021054|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
752. spacer 5.6|366810|33|NC_021054|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
753. spacer 5.6|366810|33|NC_021054|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
754. spacer 5.6|366810|33|NC_021054|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
755. spacer 6.2|631303|30|NC_021054|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cagacctcggtgaccacgccggcaacgatc Protospacer
** .************** ******.
756. spacer 6.2|631303|30|NC_021054|CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggttggccggtgaccactccgccagcgatg Protospacer
. . ************ ******.***.*
757. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc Protospacer
. ********.******.*********
758. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
759. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
760. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
761. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
762. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
763. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
764. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc Protospacer
. **************** *.***** *
765. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
766. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgc--gccttgcccgccgttgccgccggca CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg Protospacer
..** ********** *********** .
767. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
attgccgccctggccgccgttgccgccgatc Protospacer
* * ****.** ***************..
768. spacer 10.3|2088216|30|NC_021054|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
769. spacer 10.3|2088216|30|NC_021054|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
770. spacer 14.7|3122110|29|NC_021054|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724
tccgcgaaattcactgcgcgttattcaag CRISPR spacer
gacgcgaaatacactgcgctttattttca Protospacer
******** ******** *****. .
771. spacer 14.20|3122981|28|NC_021054|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 8, identity: 0.714
tagaaggcgatgtggtgctggatttcga CRISPR spacer
cgcctatcgatgtggtgccggatttcga Protospacer
.. . ***********.*********
772. spacer 15.7|3740803|31|NC_021054|CRT matches to CP033373 (Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ttagcccacttcacggccgttgccgacgcgg Protospacer
*********** ********** **. .
773. spacer 15.7|3740803|31|NC_021054|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
774. spacer 15.7|3740803|31|NC_021054|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
775. spacer 15.7|3740803|31|NC_021054|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
776. spacer 15.7|3740803|31|NC_021054|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
777. spacer 15.7|3740803|31|NC_021054|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
778. spacer 15.7|3740803|31|NC_021054|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
779. spacer 15.7|3740803|31|NC_021054|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
780. spacer 15.7|3740803|31|NC_021054|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
781. spacer 15.7|3740803|31|NC_021054|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
782. spacer 15.7|3740803|31|NC_021054|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct Protospacer
.*. *. ***********.**********
783. spacer 15.7|3740803|31|NC_021054|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
784. spacer 15.7|3740803|31|NC_021054|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
785. spacer 15.7|3740803|31|NC_021054|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
786. spacer 15.7|3740803|31|NC_021054|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca Protospacer
** . .****.*******.**********
787. spacer 15.7|3740803|31|NC_021054|CRT matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atcgcccacttcaccggcgtttccgaccctt Protospacer
* ************** **** *** * ..
788. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaaggcggccccggcggtgccggcgataccga Protospacer
.******** ******* ********.. *
789. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggcggcggcgccggcggggccggcggcgggac Protospacer
.. ******.***************.**. *
790. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggtgacggcaccggcggtgccggcggcgatgc Protospacer
.. *.************ *******.***. *
791. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcg-gcaccggcggggccggcgacgactc CRISPR spacer
-ctgccgcgcaccgggggggacggcgacgacgg Protospacer
* ** ******* **** **********
792. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gtacccggcaccgccgaggccggcgacgagtt Protospacer
. * ******** **.************ *.
793. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
atcggcggcgccggtggggccggcgaagcggc Protospacer
* ******.****.*********** * *
794. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagtcggcaccggcggggacggaacgtcctc Protospacer
**** ************** *** . ***
795. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagacggcgccggcggggccgggatcaccac Protospacer
****.****.************* . *. * *
796. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagacggcgccggcggggccgggatcaccac Protospacer
****.****.************* . *. * *
797. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gagcgccgcgccggcggggccggcgaccgctt Protospacer
.*. ** **.***************** .**.
798. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagtcggcaccggcggggacggaacgtcctc Protospacer
**** ************** *** . ***
799. spacer 17.5|3948319|32|NC_021054|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gtcgacgacaccggcgaggccggcgacgccgc Protospacer
. *.**.********.*********** * *
800. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagtcggcaccggcggggacgggacatcctc Protospacer
**** ************** *** . ***
801. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gagcgccgcaacggcggggccggcgaccgctt Protospacer
.*. ** *** **************** .**.
802. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
atcgtcgggaccggcggggcgggcgacggcga Protospacer
* * *** *********** *******.*
803. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaagtcggcaccggcggggacgggacatcctc Protospacer
**** ************** *** . ***
804. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gagcgccgcaacggcggggccggcgaccgctt Protospacer
.*. ** *** **************** .**.
805. spacer 17.5|3948319|32|NC_021054|CRT matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 8, identity: 0.75
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gacgtcggcaccggcggcgccggcggcggcaa Protospacer
.* * ************ *******.**.*
806. spacer 17.9|3948628|34|NC_021054|CRT matches to NZ_CP022195 (Yangia pacifica strain YSBP01 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.765
--ctggcatcagcttcagcaacggcagcaacggcgg CRISPR spacer
tcctgtcg--ggcttcagcatcgccagcaacggcgc Protospacer
*** *. .********* ** ***********
807. spacer 17.9|3948628|34|NC_021054|CRT matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 8, identity: 0.765
ctggcatcag-cttcagcaacggcagcaacggcgg CRISPR spacer
-cgccgcccgccttcagcaacggcagcagcagcgg Protospacer
.* *..* * *****************.*.****
808. spacer 2.3|333763|31|NC_021054|CRT matches to NZ_CP042167 (Burkholderia contaminans strain ZCC plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
ccggcggagccgatgtagcaagccgccgttc CRISPR spacer
agcccggacccgatgtagcaggccgcccctg Protospacer
**** ***********.****** .*
809. spacer 2.3|333763|31|NC_021054|CRT matches to NZ_CP028810 (Burkholderia contaminans strain SK875 plasmid p875, complete sequence) position: , mismatch: 9, identity: 0.71
ccggcggagccgatgtagcaagccgccgttc CRISPR spacer
agcccggacccgatgtagcaggccgcccctg Protospacer
**** ***********.****** .*
810. spacer 2.3|333763|31|NC_021054|CRT matches to NZ_CP046610 (Burkholderia contaminans strain XL73 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
ccggcggagccgatgtagcaagccgccgttc CRISPR spacer
agcccggacccgatgtagcaggccgcccctg Protospacer
**** ***********.****** .*
811. spacer 2.3|333763|31|NC_021054|CRT matches to NZ_CP045421 (Maribius sp. THAF1 plasmid pTHAF1_a, complete sequence) position: , mismatch: 9, identity: 0.71
ccggcggagccgatgtagcaagccgccgttc CRISPR spacer
gagttggtgccgatgttgcaagccgccgggt Protospacer
* .** ******** *********** .
812. spacer 3.9|335830|33|NC_021054|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
agcgcgccgccgatgacgccggccacggtggcg Protospacer
********* ***********.** .**
813. spacer 3.9|335830|33|NC_021054|CRT matches to NC_010399 (Clavibacter michiganensis subsp. sepedonicus plasmid pCS1, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gctccgccgccgcagacgccggccgcgccatgc Protospacer
* ********. ***************. ..
814. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
agcgcgccgccgatgacgccggccacggtggcg Protospacer
********* ***********.** .**
815. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
agcgcgccgccgatgacgccggccacggtggcg Protospacer
********* ***********.** .**
816. spacer 3.9|335830|33|NC_021054|CRT matches to MN369761 (Mycobacterium phage Malthus, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
817. spacer 3.9|335830|33|NC_021054|CRT matches to MK224497 (Mycobacterium phage Henu3, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
818. spacer 3.9|335830|33|NC_021054|CRT matches to KJ944841 (Mycobacterium phage Cheetobro, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
819. spacer 3.9|335830|33|NC_021054|CRT matches to AP018469 (Mycobacterium phage Y10 DNA, complete genome, note: sample1) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
820. spacer 3.9|335830|33|NC_021054|CRT matches to KY087992 (Mycobacterium phage Mitti, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
821. spacer 3.9|335830|33|NC_021054|CRT matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcaccgccgttgccgccggccgtatagacc Protospacer
*****.********* *********... *. .
822. spacer 3.9|335830|33|NC_021054|CRT matches to MF140402 (Mycobacterium phage Chancellor, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
823. spacer 3.9|335830|33|NC_021054|CRT matches to AP018470 (Mycobacterium phage Y2 DNA, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
824. spacer 3.9|335830|33|NC_021054|CRT matches to KT361920 (Mycobacterium phage Slarp, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
825. spacer 3.9|335830|33|NC_021054|CRT matches to MT310882 (Mycobacterium phage JF1, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
826. spacer 3.9|335830|33|NC_021054|CRT matches to AP018471 (Mycobacterium phage Y10 DNA, complete genome, note: sample2) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
827. spacer 3.9|335830|33|NC_021054|CRT matches to KX621007 (Mycobacterium phage Taquito, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
828. spacer 3.9|335830|33|NC_021054|CRT matches to MH051258 (Mycobacterium phage SamScheppers, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
829. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP036221 (Mycobacterium avium subsp. hominissuis strain mc2 2500 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg Protospacer
**. ****** ********** ******.
830. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP040251 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid unnamed1) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg Protospacer
**. ****** ********** ******.
831. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP040252 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid unnamed2) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg Protospacer
**. ****** ********** ******.
832. spacer 3.9|335830|33|NC_021054|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
agggcgccgccgctgccgccggccgcctccggg Protospacer
**********.** ********** .* *.
833. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP029334 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109b, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg Protospacer
**. ****** ********** ******.
834. spacer 3.9|335830|33|NC_021054|CRT matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccactaccggcgttgacgccgcccgcgccgccc Protospacer
**. ..*** *********** ******** .
835. spacer 3.9|335830|33|NC_021054|CRT matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccactaccggcgttgacgccgcccgcgccgccc Protospacer
**. ..*** *********** ******** .
836. spacer 3.9|335830|33|NC_021054|CRT matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
aggacgccgccggagacgccggccgcgcggtcc Protospacer
*.******** ************** * .
837. spacer 3.9|335830|33|NC_021054|CRT matches to JX163858 (Caulobacter phage phiCbK, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccactaccggcgttgacgccgcccgcgccgccc Protospacer
**. ..*** *********** ******** .
838. spacer 5.6|366810|33|NC_021054|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
839. spacer 5.6|366810|33|NC_021054|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
840. spacer 5.6|366810|33|NC_021054|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
841. spacer 5.6|366810|33|NC_021054|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
842. spacer 6.2|631303|30|NC_021054|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cccacgccggtcaccacgccgctgcccggc Protospacer
********** **********.. * .
843. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
844. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
845. spacer 7.1|692003|31|NC_021054|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
846. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg Protospacer
.... ****.***************** .*.
847. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
tggcccgccttgccctccattgccgccggac Protospacer
. . ********** **.**********
848. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
atccttgccttgaccgccgttgccgccgctg Protospacer
* .. .****** *************** ..
849. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accccagccctgcccgccgttgccgccgctc Protospacer
* .. ***.****************** .
850. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc Protospacer
. ******** ********* **** .*
851. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accggcaccttgcccgccattgccgccatgt Protospacer
* . **.***********.********.
852. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc Protospacer
. *******.******* *******.*
853. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
agcgtggccttggccgccgttgccggcggtc Protospacer
*.. ****** ************ ***.
854. spacer 15.5|3740662|34|NC_021054|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg Protospacer
.** .********.**** ***********.
855. spacer 15.5|3740662|34|NC_021054|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg Protospacer
*. . *. *****.***** *************.
856. spacer 17.3|3948175|35|NC_021054|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 9, identity: 0.743
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gccggcggggccggcgggaccggcggggccggggg Protospacer
. *************** * **********..
857. spacer 17.3|3948175|35|NC_021054|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
agcggcggggacggcggcagcggcgtgcagcgctg Protospacer
********** ******.******* * .**
858. spacer 17.3|3948175|35|NC_021054|CRT matches to NC_028791 (Mycobacterium phage MOOREtheMARYer, complete genome) position: , mismatch: 9, identity: 0.743
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ggcggcggcgccggcggtaacggcggcgtgggcat Protospacer
.******* **********.****** *. ..* *
859. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggccgcggcaccggcggggccgccgccgatca Protospacer
.. ****************** ** ***..
860. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
861. spacer 17.5|3948319|32|NC_021054|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
862. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
acgcgcggcaccggctggtccggcgacgcgcg Protospacer
* . *********** ** ********* .
863. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
864. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
865. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
866. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaaggcggcaccggcggtgacggcggaaccgg Protospacer
.**************** * *****. . *
867. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaaggcggcaccggcggtgacggcggaaccgg Protospacer
.**************** * *****. . *
868. spacer 17.5|3948319|32|NC_021054|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcaggcggcgccggcgaggccggcgaggggca Protospacer
. *******.******.********* *. .
869. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
870. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
871. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
872. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
873. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
874. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
atgaccggcaccggcagggctggcgacgagca Protospacer
* .. **********.****.******** .
875. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
atgaccggcaccggcagggctggcgacgagca Protospacer
* .. **********.****.******** .
876. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
877. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggggaccgccccggcgggaccggcgacgacga Protospacer
...*.* ** ********.***********
878. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cacgtcggccccgtcggggccggcgacgcgga Protospacer
* * **** *** **************
879. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP023524 (Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
atcggcggcaccagcggtgccggcgaggcgcg Protospacer
* *********.**** ******** * .
880. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP040761 (Paracoccus sp. 2251 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgac---gactc CRISPR spacer
gcgcgcggcaccggcgaggccgtcgacctgga--- Protospacer
. . ************.***** **** **
881. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gctgcgggcaccggcgcggccggcgccgaatt Protospacer
. * ********** ******** *** *.
882. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP017564 (Paraburkholderia sprentiae WSM5005 plasmid pl3WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggcggcggaaccggcgcggccggcgaagccgg Protospacer
.. ***** ******* ********* * *
883. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
atcggcggcaccagcggtgccggcgaggcgcg Protospacer
* *********.**** ******** * .
884. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
accggcggcaccggcggtggcggcgaggcact Protospacer
* ************** * ****** * ..
885. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gttgcgggcaccggcgcggccggcgccgaatt Protospacer
. * ********** ******** *** *.
886. spacer 17.5|3948319|32|NC_021054|CRT matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 9, identity: 0.719
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gacgtcggcaccggcggcgccggcggcgcgaa Protospacer
.* * ************ *******.**
887. spacer 17.9|3948628|34|NC_021054|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ctggcatcagcttcagcaacggcagcaacggcgg CRISPR spacer
ccccaatcagcttcagcaacggcagcaccgcacc Protospacer
*. ********************** **
888. spacer 17.9|3948628|34|NC_021054|CRT matches to MK310141 (Mycobacterium phage Fenn, complete genome) position: , mismatch: 9, identity: 0.735
ctggcatcagcttcagcaacggcagcaacggcgg CRISPR spacer
acgacctcagcatcagcagcggcagcaacggaac Protospacer
.*.* ***** ******.************ .
889. spacer 17.9|3948628|34|NC_021054|CRT matches to MK524523 (Mycobacterium phage Naira, complete genome) position: , mismatch: 9, identity: 0.735
ctggcatcagcttcagcaacggcagcaacggcgg CRISPR spacer
acgacctcagcatcagcagcggcagcaacggaac Protospacer
.*.* ***** ******.************ .
890. spacer 17.9|3948628|34|NC_021054|CRT matches to NZ_LR134463 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence) position: , mismatch: 9, identity: 0.735
ctggcatcagcttcagcaacggcagcaacggcgg CRISPR spacer
ccgtcggcagcttcagccgcggcagcaacggaca Protospacer
*.* *. ********** .************ .
891. spacer 17.11|3948783|35|NC_021054|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.743
gccggcggtagcggcggggccaacttcaacggcgg CRISPR spacer
gccggcggtatcggcgggcccaactggctcgacct Protospacer
********** ******* ****** **.*
892. spacer 17.11|3948783|35|NC_021054|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.743
gccggcggtagcggcggggccaacttcaacggcgg CRISPR spacer
gccggcggtatcggcgggcccaactggctcgacct Protospacer
********** ******* ****** **.*
893. spacer 17.17|3949374|35|NC_021054|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 9, identity: 0.743
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gccggcggggccggcgggaccggcggggccggggg Protospacer
. *************** * **********..
894. spacer 17.17|3949374|35|NC_021054|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
agcggcggggacggcggcagcggcgtgcagcgctg Protospacer
********** ******.******* * .**
895. spacer 17.17|3949374|35|NC_021054|CRT matches to NC_028791 (Mycobacterium phage MOOREtheMARYer, complete genome) position: , mismatch: 9, identity: 0.743
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ggcggcggcgccggcggtaacggcggcgtgggcat Protospacer
.******* **********.****** *. ..* *
896. spacer 3.4|335591|35|NC_021054|CRT matches to MK460246 (Mycobacterium phage Nibb, complete genome) position: , mismatch: 10, identity: 0.714
gcggcgccgaagaacgatccggcgttaccgccgcc CRISPR spacer
gccgcgcagaagaacgatccggcgtgggcgatctg Protospacer
** **** ***************** . ** . .
897. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
tgctcgccgccgatgacgccggccgtgcgcagt Protospacer
. ******** ************.** ..*
898. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP018080 (Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
agggcgccgccgatgacggcggccgcggtcagg Protospacer
********** ***** ******** . ..
899. spacer 3.9|335830|33|NC_021054|CRT matches to MH371116 (Mycobacterium phage DMoney, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
900. spacer 3.9|335830|33|NC_021054|CRT matches to MH045569 (Mycobacterium phage Schiebel, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
901. spacer 3.9|335830|33|NC_021054|CRT matches to MH371119 (Mycobacterium phage OctaviousRex, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
902. spacer 3.9|335830|33|NC_021054|CRT matches to MF919497 (Mycobacterium phage Chance64, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
903. spacer 3.9|335830|33|NC_021054|CRT matches to MH001456 (Mycobacterium phage CLED96, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
904. spacer 3.9|335830|33|NC_021054|CRT matches to GQ303261 (Mycobacterium phage Hope, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
905. spacer 3.9|335830|33|NC_021054|CRT matches to MG099946 (Mycobacterium phage LouisV14, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
906. spacer 3.9|335830|33|NC_021054|CRT matches to KC787112 (Mycobacterium phage Clark, partial genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
907. spacer 3.9|335830|33|NC_021054|CRT matches to MH779513 (Mycobacterium phage Olga, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
908. spacer 3.9|335830|33|NC_021054|CRT matches to MK919475 (Mycobacterium phage Camri, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
909. spacer 3.9|335830|33|NC_021054|CRT matches to MK310146 (Mycobacterium phage Crespo, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
910. spacer 3.9|335830|33|NC_021054|CRT matches to MK524493 (Mycobacterium phage Darionha, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
911. spacer 3.9|335830|33|NC_021054|CRT matches to MH779505 (Mycobacterium phage Grizzly, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
912. spacer 3.9|335830|33|NC_021054|CRT matches to EU568876 (Mycobacterium phage BPs, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
913. spacer 3.9|335830|33|NC_021054|CRT matches to KC787107 (Mycobacterium phage Bo4, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
914. spacer 3.9|335830|33|NC_021054|CRT matches to MF668268 (Mycobacterium phage Aroostook, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
915. spacer 3.9|335830|33|NC_021054|CRT matches to MK524494 (Mycobacterium phage Rabbs, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
916. spacer 3.9|335830|33|NC_021054|CRT matches to KX588251 (Mycobacterium phage Jane, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
917. spacer 3.9|335830|33|NC_021054|CRT matches to KC787103 (Mycobacterium phage Chy2, partial genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
918. spacer 3.9|335830|33|NC_021054|CRT matches to MH001455 (Mycobacterium phage Remy19, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
919. spacer 3.9|335830|33|NC_021054|CRT matches to KT355472 (Mycobacterium phage Cedasite, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
920. spacer 3.9|335830|33|NC_021054|CRT matches to KX664455 (Mycobacterium phage Zombie, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
921. spacer 3.9|335830|33|NC_021054|CRT matches to MH077584 (Mycobacterium phage Phish, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
922. spacer 3.9|335830|33|NC_021054|CRT matches to KC787108 (Mycobacterium phage DNAIII, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
923. spacer 3.9|335830|33|NC_021054|CRT matches to MN444875 (Mycobacterium phage Jonghyun, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
924. spacer 3.9|335830|33|NC_021054|CRT matches to MK433279 (Mycobacterium phage Kareem, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
925. spacer 3.9|335830|33|NC_021054|CRT matches to KJ725374 (Mycobacterium phage Guo1, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
926. spacer 3.9|335830|33|NC_021054|CRT matches to NC_031102 (Mycobacterium phage Sneeze, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
927. spacer 3.9|335830|33|NC_021054|CRT matches to MT818422 (Mycobacterium phage Periodt, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
928. spacer 3.9|335830|33|NC_021054|CRT matches to MK305884 (Mycobacterium phage BQuat, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
929. spacer 3.9|335830|33|NC_021054|CRT matches to MF668272 (Mycobacterium phage Gideon, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
930. spacer 3.9|335830|33|NC_021054|CRT matches to KC787111 (Mycobacterium phage Sedge, partial genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
931. spacer 3.9|335830|33|NC_021054|CRT matches to KC787104 (Mycobacterium phage Chy3, partial genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
932. spacer 3.9|335830|33|NC_021054|CRT matches to NC_012788 (Mycobacterium phage Angel, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
933. spacer 3.9|335830|33|NC_021054|CRT matches to KX443326 (Mycobacterium phage BruceB, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
934. spacer 3.9|335830|33|NC_021054|CRT matches to MK433277 (Mycobacterium phage Renaissance, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
935. spacer 3.9|335830|33|NC_021054|CRT matches to MH590605 (Mycobacterium phage Cherrybomb426, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
936. spacer 3.9|335830|33|NC_021054|CRT matches to MH779509 (Mycobacterium phage Kasen3, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
937. spacer 3.9|335830|33|NC_021054|CRT matches to JN699002 (Mycobacterium phage Avrafan, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
938. spacer 3.9|335830|33|NC_021054|CRT matches to MH779507 (Mycobacterium phage Hotshotbaby7, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
939. spacer 3.9|335830|33|NC_021054|CRT matches to KT355474 (Mycobacterium phage Frosty24, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
940. spacer 3.9|335830|33|NC_021054|CRT matches to KC787109 (Mycobacterium phage Legendre, partial genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
941. spacer 3.9|335830|33|NC_021054|CRT matches to JN412593 (Mycobacterium phage Liefie, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
942. spacer 3.9|335830|33|NC_021054|CRT matches to MH479920 (Mycobacterium phage Mowgli, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
943. spacer 3.9|335830|33|NC_021054|CRT matches to KM923970 (Mycobacterium phage Gomashi, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
944. spacer 3.9|335830|33|NC_021054|CRT matches to MH450127 (Mycobacterium phage Plagueis, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
945. spacer 3.9|335830|33|NC_021054|CRT matches to KT347314 (Mycobacterium phage Phreak, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
946. spacer 3.9|335830|33|NC_021054|CRT matches to KT365399 (Mycobacterium phage Annihilator, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
947. spacer 3.9|335830|33|NC_021054|CRT matches to KC787110 (Mycobacterium phage Leo, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
948. spacer 5.6|366810|33|NC_021054|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
949. spacer 5.6|366810|33|NC_021054|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
950. spacer 5.6|366810|33|NC_021054|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
951. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
952. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg Protospacer
.. ****** *******.******** .
953. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggccagaacttccccgctgttgccgccggca Protospacer
..... . *** *****.*************
954. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
955. spacer 9.10|1572703|31|NC_021054|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc Protospacer
... ****** ************ ***.
956. spacer 9.13|1572952|34|NC_021054|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706
gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca Protospacer
. .. .*******.***************.**.
957. spacer 13.9|3119507|35|NC_021054|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
958. spacer 15.5|3740662|34|NC_021054|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc Protospacer
. * ***** **************** **
959. spacer 15.5|3740662|34|NC_021054|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
960. spacer 15.5|3740662|34|NC_021054|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
961. spacer 15.5|3740662|34|NC_021054|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
962. spacer 17.3|3948175|35|NC_021054|CRT matches to MN908687 (Gordonia phage Skog, complete genome) position: , mismatch: 10, identity: 0.714
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ggcggcgggtccggcggtaacggcggtttcttcac Protospacer
.******** *********.****** .* * .
963. spacer 17.3|3948175|35|NC_021054|CRT matches to NC_019917 (Burkholderia phage BcepMigl, complete genome) position: , mismatch: 10, identity: 0.714
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
atcggcgcggccggcggtaccggcgggaagtatgg Protospacer
* ***** *********** *******. *.
964. spacer 17.5|3948319|32|NC_021054|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gtcatccgcagcggcggggccggcgaggaccg Protospacer
. . * *** *************** ***.
965. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cccggccgcaccggcggtgccggcgaccgagg Protospacer
*** ********** ********* .
966. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggttcccgcacccgcggggcccgcgacgaccg Protospacer
.. * ***** ******** ********.
967. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
tggtccggccccggcggggccggagacgggtt Protospacer
.. **** ************* ****. *.
968. spacer 17.5|3948319|32|NC_021054|CRT matches to NC_008381 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gctgcgggcaccggcgcggccggcgccgaact Protospacer
. * ********** ******** *** ..
969. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaggcggcaccggcgcgtccggccagcgtga Protospacer
*************** * ***** * ..
970. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
agtacgggcaccggcggggcgggcgccgaaag Protospacer
*. . ************** **** ***
971. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP054026 (Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gccgcgggcaccggcgcggccggcgccgaact Protospacer
. * ********** ******** *** ..
972. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gctgcgggcaccggcgcggccggcgccgaact Protospacer
. * ********** ******** *** ..
973. spacer 17.5|3948319|32|NC_021054|CRT matches to MK279887 (Mycobacterium phage Timmi, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
974. spacer 17.5|3948319|32|NC_021054|CRT matches to KX683293 (Mycobacterium phage Daffy, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
975. spacer 17.5|3948319|32|NC_021054|CRT matches to JN006063 (Mycobacterium phage Serendipity, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
976. spacer 17.5|3948319|32|NC_021054|CRT matches to MH576970 (Mycobacterium phage DonSanchon, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
977. spacer 17.5|3948319|32|NC_021054|CRT matches to MK279881 (Mycobacterium phage Solosis, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
978. spacer 17.5|3948319|32|NC_021054|CRT matches to JN638753 (Mycobacterium phage Morgushi, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
979. spacer 17.5|3948319|32|NC_021054|CRT matches to JF704103 (Mycobacterium phage Vortex, complete sequence) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
980. spacer 17.5|3948319|32|NC_021054|CRT matches to MK112536 (Mycobacterium phage Cannibal, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
981. spacer 17.5|3948319|32|NC_021054|CRT matches to JN699010 (Mycobacterium phage TallGrassMM, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
982. spacer 17.5|3948319|32|NC_021054|CRT matches to MT952849 (Mycobacterium phage Windsor, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
983. spacer 17.5|3948319|32|NC_021054|CRT matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
984. spacer 17.5|3948319|32|NC_021054|CRT matches to MH450122 (Mycobacterium phage KingTut, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
985. spacer 17.5|3948319|32|NC_021054|CRT matches to MK112544 (Mycobacterium phage Keitherie, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
986. spacer 17.5|3948319|32|NC_021054|CRT matches to MT310867 (Mycobacterium phage Chaelin, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
987. spacer 17.5|3948319|32|NC_021054|CRT matches to MH590594 (Mycobacterium phage PinheadLarry, complete genome) position: , mismatch: 10, identity: 0.688
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
988. spacer 17.8|3948556|35|NC_021054|CRT matches to MH142220 (UNVERIFIED: Acidithiobacillus phage AcaML1 strain BC13 genomic sequence) position: , mismatch: 10, identity: 0.714
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
ttcctgggtgccggcggcagctacggctccgccac Protospacer
* ************* * ********* *.
989. spacer 17.8|3948556|35|NC_021054|CRT matches to MH142219 (UNVERIFIED: Acidithiobacillus phage AcaML1 strain F genomic sequence) position: , mismatch: 10, identity: 0.714
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
ttcctgggtgccggcggcagctacggctccgccac Protospacer
* ************* * ********* *.
990. spacer 17.8|3948556|35|NC_021054|CRT matches to JX507079 (Acidithiobacillus phage AcaML1, complete genome) position: , mismatch: 10, identity: 0.714
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
ttcctgggtgccggcggcagctacggctccgccac Protospacer
* ************* * ********* *.
991. spacer 17.9|3948628|34|NC_021054|CRT matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 10, identity: 0.706
ctggcatcagcttcagcaacggcagcaacggcgg CRISPR spacer
caccgcccgccttcagcaacggcagcagcagcgg Protospacer
* .*. *****************.*.****
992. spacer 17.17|3949374|35|NC_021054|CRT matches to MN908687 (Gordonia phage Skog, complete genome) position: , mismatch: 10, identity: 0.714
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ggcggcgggtccggcggtaacggcggtttcttcac Protospacer
.******** *********.****** .* * .
993. spacer 17.17|3949374|35|NC_021054|CRT matches to NC_019917 (Burkholderia phage BcepMigl, complete genome) position: , mismatch: 10, identity: 0.714
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
atcggcgcggccggcggtaccggcgggaagtatgg Protospacer
* ***** *********** *******. *.
994. spacer 3.4|335591|35|NC_021054|CRT matches to MT310860 (Mycobacterium phage Chris, complete genome) position: , mismatch: 11, identity: 0.686
gcggcgccgaagaacgatccggcgttaccgccgcc CRISPR spacer
gccgcgcagaagaacgatccggcgtgggggatctg Protospacer
** **** ***************** . * . .
995. spacer 3.9|335830|33|NC_021054|CRT matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 11, identity: 0.667
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gacaggccgccgtcgacgccggccgcaccccgc Protospacer
. ********.************.** ..
996. spacer 15.5|3740662|34|NC_021054|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc Protospacer
...*. **.********.************
997. spacer 17.3|3948175|35|NC_021054|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 11, identity: 0.686
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gctggcggggccggcggtagcggtggcgcgtcacc Protospacer
. .********************.** ** ..
998. spacer 17.3|3948175|35|NC_021054|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 11, identity: 0.686
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gctggcggggccggcggtagcggtggcgcgtcacc Protospacer
. .********************.** ** ..
999. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 11, identity: 0.656
aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggcttcggcaccggcgggccgggcgacgcgct Protospacer
.. ************* * ******* ..
1000. spacer 17.5|3948319|32|NC_021054|CRT matches to NZ_CP022194 (Yangia pacifica strain YSBP01 plasmid unnamed4, complete sequence) position: , mismatch: 11, identity: 0.656
-----aaaggcggcaccggcggggccggcgacgactc CRISPR spacer
agttcaaggccggcaccgccggggccgccttc----- Protospacer
**.* ******** ******** * *
1001. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1002. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1003. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1004. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1005. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1006. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1007. spacer 17.8|3948556|35|NC_021054|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1008. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1009. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1010. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1011. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1012. spacer 17.8|3948556|35|NC_021054|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1013. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1014. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1015. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1016. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1017. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1018. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1019. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1020. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1021. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1022. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1023. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1024. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1025. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1026. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1027. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1028. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1029. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1030. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1031. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1032. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1033. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1034. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1035. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1036. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1037. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1038. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1039. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1040. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1041. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1042. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1043. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1044. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1045. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1046. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1047. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1048. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1049. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1050. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1051. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1052. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1053. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1054. spacer 17.8|3948556|35|NC_021054|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1055. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1056. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1057. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1058. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1059. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacatt Protospacer
. *****.***********.*******. *.
1060. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1061. spacer 17.8|3948556|35|NC_021054|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.686
agcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gtcagcgatgccggcggcatcaacggccacacgtt Protospacer
. *****.***********.*******. *.
1062. spacer 17.9|3948628|34|NC_021054|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 11, identity: 0.676
ctggcatcagcttcagcaacggcagcaacggcgg CRISPR spacer
acaaccgggtcttcaacaacggcatcaacggcgg Protospacer
...* . *****.******** *********
1063. spacer 17.17|3949374|35|NC_021054|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 11, identity: 0.686
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gctggcggggccggcggtagcggtggcgcgtcacc Protospacer
. .********************.** ** ..
1064. spacer 17.17|3949374|35|NC_021054|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 11, identity: 0.686
agcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gctggcggggccggcggtagcggtggcgcgtcacc Protospacer
. .********************.** ** ..
1065. spacer 3.9|335830|33|NC_021054|CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 12, identity: 0.636
--ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
acagcgcgccgccggcgtccacggcggcgccgt-- Protospacer
********* .* * **** ******