Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP015234 Epibacterium mobile F1926 plasmid unnamed4, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP015230 Epibacterium mobile F1926 chromosome, complete genome 2 crisprs cas3,WYL,csa3,DEDDh 0 2 4 0
NZ_CP015232 Epibacterium mobile F1926 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP015233 Epibacterium mobile F1926 plasmid unnamed3, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP015231 Epibacterium mobile F1926 plasmid unnamed1, complete sequence 0 crisprs csa3,RT,DEDDh 0 0 2 0

Results visualization

1. NZ_CP015234
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 45640 : 55485 9 Paramecium_bursaria_Chlorella_virus(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP015230
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015230_1 650569-650646 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015230_2 2271042-2271124 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015230_1 1.1|650594|28|NZ_CP015230|CRISPRCasFinder 650594-650621 28 NZ_CP010408 Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence 120293-120320 5 0.821
NZ_CP015230_2 2.1|2271071|25|NZ_CP015230|CRISPRCasFinder 2271071-2271095 25 MT162467 Synechococcus phage S-H34, complete genome 147048-147072 5 0.8
NZ_CP015230_1 1.1|650594|28|NZ_CP015230|CRISPRCasFinder 650594-650621 28 NZ_CP021405 Celeribacter manganoxidans strain DY25 plasmid pDY25-A, complete sequence 76119-76146 6 0.786
NZ_CP015230_1 1.1|650594|28|NZ_CP015230|CRISPRCasFinder 650594-650621 28 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 965364-965391 7 0.75
NZ_CP015230_1 1.1|650594|28|NZ_CP015230|CRISPRCasFinder 650594-650621 28 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 1122762-1122789 7 0.75
NZ_CP015230_1 1.1|650594|28|NZ_CP015230|CRISPRCasFinder 650594-650621 28 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 81860-81887 7 0.75
NZ_CP015230_1 1.1|650594|28|NZ_CP015230|CRISPRCasFinder 650594-650621 28 NZ_CP017943 Phyllobacterium zundukense strain Tri-48 plasmid unnamed2, complete sequence 505608-505635 8 0.714
NZ_CP015230_1 1.1|650594|28|NZ_CP015230|CRISPRCasFinder 650594-650621 28 NZ_CP015008 Aminobacter aminovorans strain KCTC 2477 plasmid pAA03, complete sequence 39725-39752 8 0.714
NZ_CP015230_1 1.1|650594|28|NZ_CP015230|CRISPRCasFinder 650594-650621 28 AP021851 Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome 8988-9015 8 0.714

1. spacer 1.1|650594|28|NZ_CP015230|CRISPRCasFinder matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 5, identity: 0.821

ggggcgggccgcgccgctcgcagggaaa	CRISPR spacer
tgtgcgggccgcgccgctcgcaggggcc	Protospacer
 * **********************.  

2. spacer 2.1|2271071|25|NZ_CP015230|CRISPRCasFinder matches to MT162467 (Synechococcus phage S-H34, complete genome) position: , mismatch: 5, identity: 0.8

acccttcagattgttgaccgcacca	CRISPR spacer
gaagttcagattgttgaacgcacca	Protospacer
.   ************* *******

3. spacer 1.1|650594|28|NZ_CP015230|CRISPRCasFinder matches to NZ_CP021405 (Celeribacter manganoxidans strain DY25 plasmid pDY25-A, complete sequence) position: , mismatch: 6, identity: 0.786

ggggcgggccgcgccgctcgcagggaaa	CRISPR spacer
gtggcgggcagcgccgcgcgcagggccg	Protospacer
* ******* ******* *******  .

4. spacer 1.1|650594|28|NZ_CP015230|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 7, identity: 0.75

ggggcgggccgcgccgctcgcagggaaa	CRISPR spacer
gcggcgggctgcgccgctcgcagcagct	Protospacer
* *******.************* ..  

5. spacer 1.1|650594|28|NZ_CP015230|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.75

ggggcgggccgcgccgctcgcagggaaa	CRISPR spacer
caggcggggcgcgccggtcgcagggccc	Protospacer
 .****** ******* ********   

6. spacer 1.1|650594|28|NZ_CP015230|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.75

ggggcgggccgcgccgctcgcagggaaa	CRISPR spacer
gcggcgggctgcgccgctcgcagcagct	Protospacer
* *******.************* ..  

7. spacer 1.1|650594|28|NZ_CP015230|CRISPRCasFinder matches to NZ_CP017943 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.714

ggggcgggccgcgccgctcgcagggaaa	CRISPR spacer
aacgcgcgccgcgccgctcgcaggcctg	Protospacer
.. *** *****************   .

8. spacer 1.1|650594|28|NZ_CP015230|CRISPRCasFinder matches to NZ_CP015008 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA03, complete sequence) position: , mismatch: 8, identity: 0.714

ggggcgggccgcgccgctcgcagggaaa	CRISPR spacer
aacgcgcgccgcgccgctcgcaggcctg	Protospacer
.. *** *****************   .

9. spacer 1.1|650594|28|NZ_CP015230|CRISPRCasFinder matches to AP021851 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome) position: , mismatch: 8, identity: 0.714

ggggcgggccgcgccgctcgcagggaaa	CRISPR spacer
cgggcgggcctcgccgctcgcaccctgg	Protospacer
 ********* ***********    ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 806888 : 839539 40 Thiobacimonas_phage(59.26%) head,integrase attL 805387:805407|attR 845666:845686
DBSCAN-SWA_2 1651092 : 1686108 35 Paracoccus_phage(21.43%) capsid,protease,head,tail,portal,tRNA NA
DBSCAN-SWA_3 2964908 : 3079090 120 Rhodobacter_phage(15.62%) transposase,capsid,protease,head,tail,portal,integrase,tRNA,terminase attL 2996513:2996530|attR 3080563:3080580
DBSCAN-SWA_4 3248438 : 3257803 8 Cedratvirus(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP015231
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2580 : 27194 25 Methylophilaceae_phage(28.57%) terminase,head,tail,portal,capsid,protease NA
DBSCAN-SWA_2 793274 : 844399 48 Rhodobacter_phage(15.0%) terminase,portal,holin,transposase,protease,integrase attL 801816:801864|attR 840983:841031
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage