1. spacer 2.1|1006001|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to KM514685 (Lactobacillus phage Ldl1, complete genome) position: , mismatch: 4, identity: 0.867
tcttgtttttttcaactttgtaatgatcca CRISPR spacer
tgttgcctttttcaactttgtaatgatcaa Protospacer
* ***..********************* *
2. spacer 2.1|1006001|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to CP031026 (Lactobacillus phage ViSo-2018a, partial genome) position: , mismatch: 4, identity: 0.867
tcttgtttttttcaactttgtaatgatcca CRISPR spacer
tgttgcctttttcaactttgtaatgatcaa Protospacer
* ***..********************* *
3. spacer 2.1|1006001|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to CP031026 (Lactobacillus phage ViSo-2018a, partial genome) position: , mismatch: 4, identity: 0.867
tcttgtttttttcaactttgtaatgatcca CRISPR spacer
tgttgcctttttcaactttgtaatgatcaa Protospacer
* ***..********************* *
4. spacer 2.24|1007521|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007513 (Bacillus bombysepticus plasmid pBb, complete genome) position: , mismatch: 4, identity: 0.867
taacatt-tcaaattgatatttatcaaataa CRISPR spacer
-agtattctcaaaatgatatttatcaaataa Protospacer
*..*** ***** *****************
5. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 5, identity: 0.833
tttttaaaatcaatatcagtttcacaagca-- CRISPR spacer
tttttcaaatcaatattagttt--caatcaat Protospacer
***** **********.***** *** **
6. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR214983 (Mycoplasma cynos strain NCTC10142 plasmid 10) position: , mismatch: 5, identity: 0.833
tttttaaaatcaatatcagtttcacaagca-- CRISPR spacer
tttttcaaatcaatattagttt--caatcaat Protospacer
***** **********.***** *** **
7. spacer 2.14|1006860|30|NC_021284|CRISPRCasFinder,CRT matches to MN693588 (Marine virus AFVG_25M366, complete genome) position: , mismatch: 5, identity: 0.833
caattttatcaatcatataaacagtatttt CRISPR spacer
gcagtttatcaatcagataaacaatatttt Protospacer
* *********** *******.******
8. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to MW067001 (CrAssphage sp. C0521BW15, complete genome) position: , mismatch: 5, identity: 0.833
aatctttattaaaagtattatccataatat CRISPR spacer
aaaacttattaaaagtattattcatattat Protospacer
** .****************.**** ***
9. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to MK415404 (CrAssphage FA1-2_000172F, complete genome) position: , mismatch: 5, identity: 0.833
aatctttattaaaagtattatccataatat CRISPR spacer
aaaacttattaaaagtattattcatattat Protospacer
** .****************.**** ***
10. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to MW067003 (CrAssphage sp. C0531BW4, complete genome) position: , mismatch: 5, identity: 0.833
aatctttattaaaagtattatccataatat CRISPR spacer
aaaacttattaaaagtattattcatattat Protospacer
** .****************.**** ***
11. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to MK238400 (CrAssphage ZA, complete genome) position: , mismatch: 5, identity: 0.833
aatctttattaaaagtattatccataatat CRISPR spacer
aaaacttattaaaagtattattcatattat Protospacer
** .****************.**** ***
12. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to MW067000 (CrAssphage sp. C0521BD4, complete genome) position: , mismatch: 5, identity: 0.833
aatctttattaaaagtattatccataatat CRISPR spacer
aaaacttattaaaagtattattcatattat Protospacer
** .****************.**** ***
13. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to MK415403 (CrAssphage ES_ALL_000190F, complete genome) position: , mismatch: 5, identity: 0.833
aatctttattaaaagtattatccataatat CRISPR spacer
aaaacttattaaaagtattattcatattat Protospacer
** .****************.**** ***
14. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to MK415410 (CrAssphage YS1-2_2437, complete genome) position: , mismatch: 5, identity: 0.833
aatctttattaaaagtattatccataatat CRISPR spacer
aaaacttattaaaagtattattcatattat Protospacer
** .****************.**** ***
15. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to MK069403 (UNVERIFIED: CrAssphage sp. O-152, partial genome) position: , mismatch: 5, identity: 0.833
aatctttattaaaagtattatccataatat CRISPR spacer
aaaacttattaaaagtattattcatattat Protospacer
** .****************.**** ***
16. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to BK010471 (TPA_asm: Uncultured crAssphage, complete genome) position: , mismatch: 5, identity: 0.833
aatctttattaaaagtattatccataatat CRISPR spacer
aaaacttattaaaagtattattcatattat Protospacer
** .****************.**** ***
17. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to MW067002 (CrAssphage sp. C0526BW15, complete genome) position: , mismatch: 5, identity: 0.833
aatctttattaaaagtattatccataatat CRISPR spacer
aaaacttattaaaagtattattcatattat Protospacer
** .****************.**** ***
18. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to NC_024711 (Uncultured crAssphage, complete genome) position: , mismatch: 5, identity: 0.833
aatctttattaaaagtattatccataatat CRISPR spacer
aaaacttattaaaagtattattcatattat Protospacer
** .****************.**** ***
19. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to JQ995537 (Uncultured phage crAssphage, complete genome) position: , mismatch: 5, identity: 0.833
aatctttattaaaagtattatccataatat CRISPR spacer
aaaacttattaaaagtattattcatattat Protospacer
** .****************.**** ***
20. spacer 2.24|1007521|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009921 (Bacillus megaterium NBRC 15308 = ATCC 14581 plasmid pBMV_2, complete sequence) position: , mismatch: 5, identity: 0.833
taacatt-tcaaattgatatttatcaaataa CRISPR spacer
-agtgttctcaaaatgatatttatcaaataa Protospacer
*...** ***** *****************
21. spacer 2.24|1007521|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035095 (Bacillus megaterium NBRC 15308 = ATCC 14581 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
taacatt-tcaaattgatatttatcaaataa CRISPR spacer
-agtgttctcaaaatgatatttatcaaataa Protospacer
*...** ***** *****************
22. spacer 2.24|1007521|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NC_013331 (Staphylococcus aureus plasmid SAP047A, complete sequence) position: , mismatch: 5, identity: 0.833
--taacatttcaaattgatatttatcaaataa CRISPR spacer
gccaaca--tcacattgatatctatcaaataa Protospacer
.**** *** ********.**********
23. spacer 2.24|1007521|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP030480 (Staphylococcus aureus strain ER04246.3 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
--taacatttcaaattgatatttatcaaataa CRISPR spacer
gccaaca--tcacattgatatctatcaaataa Protospacer
.**** *** ********.**********
24. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015251 (Bacillus thuringiensis Bt18247 plasmid p174778, complete sequence) position: , mismatch: 5, identity: 0.833
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaatattatttatatttgc Protospacer
.* ********** ************* *
25. spacer 1.1|288059|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MN698242 (Pelagibacter phage HTVC103P, complete genome) position: , mismatch: 6, identity: 0.8
taatttttaaactaataccaatagtcatat CRISPR spacer
atatatataaactaataccaatagtcatca Protospacer
** * *********************
26. spacer 1.1|288059|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MN698243 (Pelagibacter phage HTVC104P, complete genome) position: , mismatch: 6, identity: 0.8
taatttttaaactaataccaatagtcatat CRISPR spacer
atatatataaactaataccaatagtcatca Protospacer
** * *********************
27. spacer 1.3|288191|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR214943 (Mycoplasma orale strain NCTC10112 plasmid 4) position: , mismatch: 6, identity: 0.8
ataatttgacaatttttatcacaactacta CRISPR spacer
ataatttgataatttttatcagtataaata Protospacer
*********.*********** *. * **
28. spacer 1.5|288323|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053843 (Campylobacter corcagiensis strain LMG 27932 plasmid pCCORG, complete sequence) position: , mismatch: 6, identity: 0.8
aattgtcttttaatgtcgtttataaattct CRISPR spacer
aaattccttttaatatcgtctataaattca Protospacer
** * .********.****.*********
29. spacer 1.5|288323|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043832 (Bacillus sp. BS98 plasmid unnamed2) position: , mismatch: 6, identity: 0.8
aattg--tcttttaatgtcgtttataaattct CRISPR spacer
--ttggtatttttaatgtggtttatatattct Protospacer
*** .********* ******* *****
30. spacer 1.5|288323|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020434 (Bacillus sp. FDAARGOS_235 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.8
aattg--tcttttaatgtcgtttataaattct CRISPR spacer
--ttggtatttttaatgtggtttatatattct Protospacer
*** .********* ******* *****
31. spacer 1.5|288323|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MN855673 (Bacteriophage sp. isolate 200, complete genome) position: , mismatch: 6, identity: 0.8
aattgtcttttaatgtcgtttataaattct CRISPR spacer
aaatgtcttttaatgtcatttatttttcct Protospacer
** **************.***** *.**
32. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MN694024 (Marine virus AFVG_250M601, complete genome) position: , mismatch: 6, identity: 0.8
tttttaaaatcaatatcagtttcacaagca CRISPR spacer
gaatacaaatcaatatcagtttcaccagca Protospacer
* ******************* ****
33. spacer 1.7|288455|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MN693217 (Marine virus AFVG_25M350, complete genome) position: , mismatch: 6, identity: 0.8
caatgtagcaccatctagaacattacgccc CRISPR spacer
taaagtagcaccatctagaatattaagttc Protospacer
.** ****************.**** *..*
34. spacer 2.1|1006001|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013280 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-5-100K, complete sequence) position: , mismatch: 6, identity: 0.8
tcttgtttttttcaactttgtaatgatcca CRISPR spacer
ttatgtttttttaaactttgcaatgataaa Protospacer
*. ********* *******.****** *
35. spacer 2.1|1006001|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039726 (Bacillus thuringiensis strain BT-59 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.8
tcttgtttttttcaactttgtaatgatcca CRISPR spacer
ttatgtttttttaaactttgcaatgataaa Protospacer
*. ********* *******.****** *
36. spacer 2.1|1006001|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009350 (Bacillus thuringiensis HD1002 plasmid 4, complete sequence) position: , mismatch: 6, identity: 0.8
tcttgtttttttcaactttgtaatgatcca CRISPR spacer
ttatgtttttttaaactttgcaatgataaa Protospacer
*. ********* *******.****** *
37. spacer 2.1|1006001|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NC_018510 (Bacillus thuringiensis HD-789 plasmid pBTHD789-3, complete sequence) position: , mismatch: 6, identity: 0.8
tcttgtttttttcaactttgtaatgatcca CRISPR spacer
ttatgtttttttaaactttgcaatgataaa Protospacer
*. ********* *******.****** *
38. spacer 2.10|1006595|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP020750 (Bacillus mycoides strain Gnyt1 plasmid unnamed7, complete sequence) position: , mismatch: 6, identity: 0.8
cgattgtggcaataacaccaccaatcaata CRISPR spacer
agaaagcggcaacaacaccgccaatcaata Protospacer
** *.*****.******.**********
39. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP008851 (Acinetobacter baumannii strain AC29 plasmid pAC29b, complete sequence) position: , mismatch: 6, identity: 0.8
aatctttattaaaagtattatccataatat CRISPR spacer
caaagttattaaaagtattagtcataatat Protospacer
* *************** .********
40. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP043618 (Sulfurimonas sp. GYSZ_1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
aatctttattaaaagtattatccataatat CRISPR spacer
aacaaatactaaaagtattatcgataatat Protospacer
**. **.************* *******
41. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP043618 (Sulfurimonas sp. GYSZ_1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
aatctttattaaaagtattatccataatat CRISPR spacer
aacaaatactaaaagtattatcgataatat Protospacer
**. **.************* *******
42. spacer 2.18|1007124|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047434 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-6) position: , mismatch: 6, identity: 0.8
ttgacccttttatcttatcatacttatttt CRISPR spacer
tttataaattaatcttatcatacttatttt Protospacer
** *. ** *******************
43. spacer 2.18|1007124|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to KT001915 (Citrobacter phage Merlin, complete genome) position: , mismatch: 6, identity: 0.8
--ttgacccttttatcttatcatacttatttt CRISPR spacer
gattgg--atgttattttatcatacttatttt Protospacer
***. * ****.****************
44. spacer 2.19|1007190|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047444 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-7) position: , mismatch: 6, identity: 0.8
gtataagctactcctccttgtgaaaaacta CRISPR spacer
gaatatgctactcccccttgtgaaaatgaa Protospacer
* *** ********.*********** *
45. spacer 2.22|1007388|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MK250024 (Prevotella phage Lak-B5, complete genome) position: , mismatch: 6, identity: 0.8
taatatcatcaacatcacttggcattaaat CRISPR spacer
taactgtatcaacataatttggcattaaat Protospacer
***. .******** *.************
46. spacer 2.22|1007388|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MK250028 (Prevotella phage Lak-B9, complete genome) position: , mismatch: 6, identity: 0.8
taatatcatcaacatcacttggcattaaat CRISPR spacer
taactgtatcaacataatttggcattaaat Protospacer
***. .******** *.************
47. spacer 2.22|1007388|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MK250025 (Prevotella phage Lak-B6, complete genome) position: , mismatch: 6, identity: 0.8
taatatcatcaacatcacttggcattaaat CRISPR spacer
taactgtatcaacataatttggcattaaat Protospacer
***. .******** *.************
48. spacer 2.22|1007388|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MK250022 (Prevotella phage Lak-B3, complete genome) position: , mismatch: 6, identity: 0.8
taatatcatcaacatcacttggcattaaat CRISPR spacer
taactgtatcaacataatttggcattaaat Protospacer
***. .******** *.************
49. spacer 2.22|1007388|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MK250027 (Prevotella phage Lak-B8, complete genome) position: , mismatch: 6, identity: 0.8
taatatcatcaacatcacttggcattaaat CRISPR spacer
taactgtatcaacataatttggcattaaat Protospacer
***. .******** *.************
50. spacer 2.22|1007388|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MK250026 (Prevotella phage Lak-B7, complete genome) position: , mismatch: 6, identity: 0.8
taatatcatcaacatcacttggcattaaat CRISPR spacer
taactgtatcaacataatttggcattaaat Protospacer
***. .******** *.************
51. spacer 2.22|1007388|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MK250020 (Prevotella phage Lak-B1, complete genome) position: , mismatch: 6, identity: 0.8
taatatcatcaacatcacttggcattaaat CRISPR spacer
taactgtatcaacataatttggcattaaat Protospacer
***. .******** *.************
52. spacer 2.24|1007521|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.8
taacatttcaaattgatatttatcaaataa CRISPR spacer
tactgagtcaaattgatatttataaaataa Protospacer
** .. **************** ******
53. spacer 2.24|1007521|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035396 (Bacillus subtilis strain SRCM103697 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
taacatttcaaattgatatttatcaaataa CRISPR spacer
tgtgttttcaaaatgataattatcaaataa Protospacer
*. ******* ***** ***********
54. spacer 2.24|1007521|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053689 (Arthrobacter citreus strain NEB 577 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
taacatttcaaattgatatttatcaaataa CRISPR spacer
ttaaatttcaacttgatattgatcaaagat Protospacer
* * ******* ******** ****** *
55. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039845 (Acetobacter pasteurianus strain CICC 22518 plasmid pAP22518-1, complete sequence) position: , mismatch: 6, identity: 0.8
gaaatcttc---aacataattatttatattttc CRISPR spacer
---ctctgccgaaatataattatttatattttc Protospacer
*** * **.******************
56. spacer 2.27|1007719|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 6, identity: 0.8
taagaccattgtttgatccatatacatcaa CRISPR spacer
attgaaggttgtttgatccatatacatcaa Protospacer
** .**********************
57. spacer 1.3|288191|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MN693455 (Marine virus AFVG_25M522, complete genome) position: , mismatch: 7, identity: 0.767
ataatttgacaatttttatcacaactacta CRISPR spacer
actctttgataatttttatcacagctagtt Protospacer
*. *****.*************.*** *
58. spacer 1.4|288257|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MN693237 (Marine virus AFVG_25M495, complete genome) position: , mismatch: 7, identity: 0.767
cagttattgtatatctatctccataaaaat CRISPR spacer
cagatattgtatatgtatctccatctactc Protospacer
*** ********** ********* * .
59. spacer 1.4|288257|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MN693062 (Marine virus AFVG_25M389, complete genome) position: , mismatch: 7, identity: 0.767
cagttattgtatatctatctccataaaaat CRISPR spacer
cagatattgtatatgtatctccatctactc Protospacer
*** ********** ********* * .
60. spacer 1.4|288257|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MN694714 (Marine virus AFVG_250M691, complete genome) position: , mismatch: 7, identity: 0.767
cagttattgtatatctatctccataaaaat CRISPR spacer
tagttattgtatttctatccccatcagctt Protospacer
.*********** ******.**** *. *
61. spacer 1.4|288257|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NC_015426 (Clostridium botulinum BKT015925 plasmid p2BKT015925, complete sequence) position: , mismatch: 7, identity: 0.767
cagttattgtatatctatctccataaaaat CRISPR spacer
tgttaatgatatatttatctccataaaaat Protospacer
.. * ** .*****.***************
62. spacer 1.5|288323|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to KX119206 (Helicobacter phage UKEN32U, complete genome) position: , mismatch: 7, identity: 0.767
aattgtcttttaatgtcgtttataaattct CRISPR spacer
tcatagcttttaatgtcgtttgaaaattct Protospacer
*. ***************. *******
63. spacer 1.5|288323|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to KX119174 (Helicobacter phage UKEN31U, complete genome) position: , mismatch: 7, identity: 0.767
aattgtcttttaatgtcgtttataaattct CRISPR spacer
tcatagcttttaatgtcgtttgaaaattct Protospacer
*. ***************. *******
64. spacer 1.5|288323|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to JF734911 (Helicobacter phage phiHP33, complete genome) position: , mismatch: 7, identity: 0.767
aattgtcttttaatgtcgtttataaattct CRISPR spacer
tcatagcttttaatgtcgtttgaaaattct Protospacer
*. ***************. *******
65. spacer 1.5|288323|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to KX119198 (Helicobacter phage Pt5322G, complete genome) position: , mismatch: 7, identity: 0.767
aattgtcttttaatgtcgtttataaattct CRISPR spacer
tcatagcttttaatgtcgtttgaaaattct Protospacer
*. ***************. *******
66. spacer 1.5|288323|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to KX119190 (Helicobacter phage Pt4472G, complete genome) position: , mismatch: 7, identity: 0.767
aattgtcttttaatgtcgtttataaattct CRISPR spacer
tcatagcttttaatgtcgtttgaaaattct Protospacer
*. ***************. *******
67. spacer 1.5|288323|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to KX119199 (Helicobacter phage Pt5771G, complete genome) position: , mismatch: 7, identity: 0.767
aattgtcttttaatgtcgtttataaattct CRISPR spacer
tcatagcttttaatgtcgtttgaaaattct Protospacer
*. ***************. *******
68. spacer 1.5|288323|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to AB731695 (Helicobacter phage KHP40 DNA, complete genome) position: , mismatch: 7, identity: 0.767
aattgtcttttaatgtcgtttataaattct CRISPR spacer
tcatagcttttaatgtcgttagtaaattct Protospacer
*. ************** .********
69. spacer 1.5|288323|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042885 (Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_01, complete sequence) position: , mismatch: 7, identity: 0.767
aattgtcttttaatgtcgtttataaattct CRISPR spacer
ttttatcttttaatggcgtttataattaat Protospacer
**.********** ********* * *
70. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 7, identity: 0.767
tttttaaaatcaatatcagtttcacaagca CRISPR spacer
tttttaaaatcaaaatcattttcttgcgta Protospacer
************* **** **** .. *.*
71. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to KX017521 (Salmonella phage 118970_sal2, complete genome) position: , mismatch: 7, identity: 0.767
tttttaaaatcaatatcagtttcacaagca CRISPR spacer
atgataaaatcaatatcagttccacgacta Protospacer
* *****************.***.* .*
72. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MK085976 (Bacillus phage AP631, complete genome) position: , mismatch: 7, identity: 0.767
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaaaatcaatatcagatt-----gcagctta Protospacer
****************** ** ***
73. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MT833283 (Escherichia coli phage vB_EcoS_Ace, complete genome) position: , mismatch: 7, identity: 0.767
tttttaaaatcaatatcagtttcacaagca CRISPR spacer
atgataaaatcaatatcagttccacgacta Protospacer
* *****************.***.* .*
74. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NC_048760 (Salmonella phage Sepoy, complete genome) position: , mismatch: 7, identity: 0.767
tttttaaaatcaatatcagtttcacaagca CRISPR spacer
atgataaaatcaatatcagttccacgacta Protospacer
* *****************.***.* .*
75. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NC_031902 (Salmonella phage 100268_sal2, complete genome) position: , mismatch: 7, identity: 0.767
tttttaaaatcaatatcagtttcacaagca CRISPR spacer
atgataaaatcaatatcagttccacgacta Protospacer
* *****************.***.* .*
76. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NC_031902 (Salmonella phage 100268_sal2, complete genome) position: , mismatch: 7, identity: 0.767
tttttaaaatcaatatcagtttcacaagca CRISPR spacer
atgataaaatcaatatcagttccacgacta Protospacer
* *****************.***.* .*
77. spacer 1.8|288521|30|NC_021284|CRISPRCasFinder,CRT matches to MN693412 (Marine virus AFVG_25M431, complete genome) position: , mismatch: 7, identity: 0.767
atcaccatacatataacttccttgtttaag CRISPR spacer
atcgccattcatataacttccttaactatt Protospacer
***.**** **************. .**
78. spacer 2.2|1006067|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to CP003953 (Rhodococcus opacus PD630 plasmid 4, complete sequence) position: , mismatch: 7, identity: 0.767
caatgtgaatgctaatcgctttaatggttt CRISPR spacer
cgtctagaatgctagttgctttaatggttt Protospacer
*. . ********.*.*************
79. spacer 2.2|1006067|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to KT878766 (Staphylococcus phage P1105, complete genome) position: , mismatch: 7, identity: 0.767
caatgtgaatgctaatcgctttaa---tggttt CRISPR spacer
taatgtgaatgcgaatcggtttaaaccagg--- Protospacer
.*********** ***** ***** **
80. spacer 2.2|1006067|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NC_004740 (Staphylococcus prophage phiN315, complete genome) position: , mismatch: 7, identity: 0.767
caatgtgaatgctaatcgctttaa---tggttt CRISPR spacer
taatgtgaatgcgaatcggtttaaaccagg--- Protospacer
.*********** ***** ***** **
81. spacer 2.2|1006067|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NC_021773 (Staphylococcus phage JS01, complete genome) position: , mismatch: 7, identity: 0.767
caatgtgaatgctaatcgctttaa---tggttt CRISPR spacer
taatgtgaatgcgaatcggtttaaaccagg--- Protospacer
.*********** ***** ***** **
82. spacer 2.2|1006067|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MH401414 (Staphylococcus aureus phage SA45ruMSSAST97, complete genome) position: , mismatch: 7, identity: 0.767
caatgtgaatgctaatcgctttaa---tggttt CRISPR spacer
taatgtgaatgcgaatcggtttaaaccagg--- Protospacer
.*********** ***** ***** **
83. spacer 2.2|1006067|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MH401415 (Staphylococcus aureus phage SA537ruMSSAST97, complete genome) position: , mismatch: 7, identity: 0.767
caatgtgaatgctaatcgctttaa---tggttt CRISPR spacer
taatgtgaatgcgaatcggtttaaaccagg--- Protospacer
.*********** ***** ***** **
84. spacer 2.2|1006067|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NC_025460 (Staphylococcus phage phiSa119, complete genome) position: , mismatch: 7, identity: 0.767
caatgtgaatgctaatcgctttaa---tggttt CRISPR spacer
taatgtgaatgcgaatcggtttaaaccagg--- Protospacer
.*********** ***** ***** **
85. spacer 2.2|1006067|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NC_048635 (Staphylococcus phage P630, complete genome) position: , mismatch: 7, identity: 0.767
caatgtgaatgctaatcgctttaa---tggttt CRISPR spacer
taatgtgaatgcgaatcggtttaaaccagg--- Protospacer
.*********** ***** ***** **
86. spacer 2.2|1006067|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to AB243556 (Staphylococcus phage phiPVL108 DNA, complete genome) position: , mismatch: 7, identity: 0.767
caatgtgaatgctaatcgctttaa---tggttt CRISPR spacer
taatgtgaatgcgaatcggtttaaaccagg--- Protospacer
.*********** ***** ***** **
87. spacer 2.2|1006067|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NC_008689 (Staphylococcus phage phiPVL108, complete genome) position: , mismatch: 7, identity: 0.767
caatgtgaatgctaatcgctttaa---tggttt CRISPR spacer
taatgtgaatgcgaatcggtttaaaccagg--- Protospacer
.*********** ***** ***** **
88. spacer 2.2|1006067|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MH384260 (Staphylococcus phage SA780ruMSSAST101, complete genome) position: , mismatch: 7, identity: 0.767
caatgtgaatgctaatcgctttaa---tggttt CRISPR spacer
taatgtgaatgcgaatcggtttaaaccagg--- Protospacer
.*********** ***** ***** **
89. spacer 2.2|1006067|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NC_048658 (Staphylococcus phage SA7, complete genome) position: , mismatch: 7, identity: 0.767
caatgtgaatgctaatcgctttaa---tggttt CRISPR spacer
taatgtgaatgcgaatcggtttaaaccagg--- Protospacer
.*********** ***** ***** **
90. spacer 2.3|1006133|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 7, identity: 0.767
cagtgagtagcgatagggcaggtaacccct CRISPR spacer
cagcgtgtagcgatagggcaggtatctgtc Protospacer
***.* ****************** *. ..
91. spacer 2.4|1006199|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029726 (Proteus mirabilis strain AR_0029 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
agtcggg--gaagttaaagtattcttttgtta CRISPR spacer
--ttggaccagagttaaagtattcttttgata Protospacer
*.**. ..****************** **
92. spacer 2.8|1006463|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_AP017296 (Nostoc sp. NIES-3756 plasmid pNOS3756_1, complete sequence) position: , mismatch: 7, identity: 0.767
aatagctaacacactatcaacatatgctaa CRISPR spacer
tgcaattaacacagtatcaacaaatgctaa Protospacer
..*..******* ******** *******
93. spacer 2.9|1006529|30|NC_021284|CRISPRCasFinder,CRT matches to MK448826 (Streptococcus phage Javan645, complete genome) position: , mismatch: 7, identity: 0.767
aactttttttaagtagtccataaactcgtc CRISPR spacer
gaatttttttaagtagttcatagacttatt Protospacer
.* **************.****.***..*.
94. spacer 2.9|1006529|30|NC_021284|CRISPRCasFinder,CRT matches to MK449001 (Streptococcus phage Javan640, complete genome) position: , mismatch: 7, identity: 0.767
aactttttttaagtagtccataaactcgtc CRISPR spacer
gaatttttttaagtagttcatagacttatt Protospacer
.* **************.****.***..*.
95. spacer 2.11|1006661|30|NC_021284|CRISPRCasFinder,CRT matches to AP013460 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-U-MedDCM-OCT-S40-C18) position: , mismatch: 7, identity: 0.767
attggcattacaccatttaatctaactgta CRISPR spacer
ttctgaataacaccatttaaactaactgtt Protospacer
*. * ** *********** ********
96. spacer 2.11|1006661|30|NC_021284|CRISPRCasFinder,CRT matches to AP013457 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-U-MedDCM-OCT-S28-C20) position: , mismatch: 7, identity: 0.767
attggcattacaccatttaatctaactgta CRISPR spacer
ttctgaataacaccatttaaactaactgtt Protospacer
*. * ** *********** ********
97. spacer 2.11|1006661|30|NC_021284|CRISPRCasFinder,CRT matches to AP013409 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C105A-MedDCM-OCT-S28-C49) position: , mismatch: 7, identity: 0.767
attggcattacaccatttaatctaactgta CRISPR spacer
ttctgaataacaccatttaaactaactgtt Protospacer
*. * ** *********** ********
98. spacer 2.14|1006860|30|NC_021284|CRISPRCasFinder,CRT matches to NC_028671 (Enterococcus phage vB_EfaS_IME197, complete genome) position: , mismatch: 7, identity: 0.767
caattttatcaatcatataaacagtatttt CRISPR spacer
tttccttatcaatcagataaactgtatttt Protospacer
. ..********** ****** *******
99. spacer 2.14|1006860|30|NC_021284|CRISPRCasFinder,CRT matches to NC_009426 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL1, complete sequence) position: , mismatch: 7, identity: 0.767
caattttatcaatcatataaacagtatttt CRISPR spacer
caattttatcaattatatagacaggttggc Protospacer
*************.*****.**** * .
100. spacer 2.14|1006860|30|NC_021284|CRISPRCasFinder,CRT matches to NC_002033 (Novosphingobium aromaticivorans plasmid pNL1, complete sequence) position: , mismatch: 7, identity: 0.767
caattttatcaatcatataaacagtatttt CRISPR spacer
caattttatcaattatatagacaggttggc Protospacer
*************.*****.**** * .
101. spacer 2.14|1006860|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP033228 (Sphingobium yanoikuyae strain SJTF8 plasmid pF2, complete sequence) position: , mismatch: 7, identity: 0.767
caattttatcaatcatataaacagtatttt CRISPR spacer
caattttatcaattatatagacaggttggc Protospacer
*************.*****.**** * .
102. spacer 2.15|1006926|30|NC_021284|CRISPRCasFinder,CRT matches to JQ807249 (Environmental Halophage eHP-30, partial genome) position: , mismatch: 7, identity: 0.767
tctccataagttgtttcattcattggaatc CRISPR spacer
gcgctgtaagttgtttcattgattgtaatt Protospacer
* *..************** **** ***.
103. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to MH622943 (Myoviridae sp. isolate ctbc_4, complete genome) position: , mismatch: 7, identity: 0.767
aatctttattaaaagtattatccataatat CRISPR spacer
tacatttattaaaagtattatacatatact Protospacer
*. ***************** **** *
104. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to MK415399 (CrAssphage apr34_000142F, complete genome) position: , mismatch: 7, identity: 0.767
aatctttattaaaagtattatccataatat CRISPR spacer
atggcttattaagagtattatccataaaaa Protospacer
* .*******.************** *
105. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP007453 (Peptoclostridium acidaminophilum DSM 3953 strain al-2 plasmid EAL2_808p, complete sequence) position: , mismatch: 7, identity: 0.767
aatctttattaaaagtattatccataatat CRISPR spacer
caggttggctaaaagtattatccatagtat Protospacer
* ** ..*****************.***
106. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 7, identity: 0.767
aatctttattaaaagtattatccataatat CRISPR spacer
tctctttattattagtattatccattaatt Protospacer
********* ************ * *
107. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 7, identity: 0.767
aatctttattaaaagtattatccataatat CRISPR spacer
tctctttattattagtattatccattaatt Protospacer
********* ************ * *
108. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP031220 (Arcobacter mytili LMG 24559 plasmid pAMYT, complete sequence) position: , mismatch: 7, identity: 0.767
aatctttattaaaagtattatccataatat CRISPR spacer
aatctttaataaaagtattattttcagtaa Protospacer
******** ************.. .*.**
109. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to MT774401 (CrAssphage cr6_1, complete genome) position: , mismatch: 7, identity: 0.767
aatctttattaaaagtattatccataatat CRISPR spacer
tttgtctattaaaagtattacctataataa Protospacer
* *.**************.*.******
110. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to MH319751 (Marine virus AG-345-F15 Ga0172271_13 genomic sequence) position: , mismatch: 7, identity: 0.767
aatctttattaaaagtattatccataatat CRISPR spacer
atcctttattgatagtattatccatatcaa Protospacer
* .*******.* ************* .*
111. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to MN855617 (Myoviridae sp. isolate 527, complete genome) position: , mismatch: 7, identity: 0.767
aatctttattaaaagtattatccataatat CRISPR spacer
aatcttcattaaaagtataatccggcgttt Protospacer
******.*********** ****. .* *
112. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 7, identity: 0.767
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
acaacgcatttgaacaatcaaatgctccaa Protospacer
.. *.*******.***************
113. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MG592407 (Vibrio phage 1.023.O._10N.222.51.B4, partial genome) position: , mismatch: 7, identity: 0.767
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
tattagcatttgcataatcaaatgctcgct Protospacer
* ***.***** **************
114. spacer 2.18|1007124|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 7, identity: 0.767
ttgacccttttatcttatcatacttatttt CRISPR spacer
taacctcttttagcttatcatactcattta Protospacer
* . *.****** ***********.****
115. spacer 2.18|1007124|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 7, identity: 0.767
ttgacccttttatcttatcatacttatttt CRISPR spacer
taacctcttttagcttatcatactcattta Protospacer
* . *.****** ***********.****
116. spacer 2.18|1007124|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 7, identity: 0.767
ttgacccttttatcttatcatacttatttt CRISPR spacer
taacctcttttagcttatcatactcattta Protospacer
* . *.****** ***********.****
117. spacer 2.18|1007124|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 7, identity: 0.767
ttgacccttttatcttatcatacttatttt CRISPR spacer
taacctcttttagcttatcatactcattta Protospacer
* . *.****** ***********.****
118. spacer 2.18|1007124|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 7, identity: 0.767
ttgacccttttatcttatcatacttatttt CRISPR spacer
taacctcttttagcttatcatactcattta Protospacer
* . *.****** ***********.****
119. spacer 2.18|1007124|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 7, identity: 0.767
ttgacccttttatcttatcatacttatttt CRISPR spacer
taacctcttttagcttatcatactcattta Protospacer
* . *.****** ***********.****
120. spacer 2.19|1007190|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047430 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-2, complete sequence) position: , mismatch: 7, identity: 0.767
gtataagctactcctccttgtgaaaaacta CRISPR spacer
gaatatgctactcctccctgtgaaaatgat Protospacer
* *** ***********.********
121. spacer 2.20|1007256|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT774397 (CrAssphage cr56_1, complete genome) position: , mismatch: 7, identity: 0.767
ctaactacttgctagtatagtatgtgatgt CRISPR spacer
agatttacttggtagtatagtatatgatgc Protospacer
* .****** ***********.*****.
122. spacer 2.23|1007454|31|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to JN882286 (Cronobacter phage vB_CsaP_GAP52, complete genome) position: , mismatch: 7, identity: 0.774
--ctgttgatcctgttatatatctattgcttga CRISPR spacer
acttgct--tcctgttatatatctaatgcttct Protospacer
.**.* **************** *****
123. spacer 2.24|1007521|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 7, identity: 0.767
taacatttcaaattgatatttatcaaataa CRISPR spacer
tcaggcatcaaattgataattatcaaaaaa Protospacer
* * .. *********** ******** **
124. spacer 2.24|1007521|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018875 (Bacillus megaterium strain JX285 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
----taacatttcaaattgatatttatcaaataa CRISPR spacer
actataa----ataaattgatatttatcaaaaaa Protospacer
*** .****************** **
125. spacer 2.24|1007521|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041065 (Bacillus megaterium strain KNU-01 plasmid pKNU_01_2, complete sequence) position: , mismatch: 7, identity: 0.767
----taacatttcaaattgatatttatcaaataa CRISPR spacer
actataa----ataaattgatatttatcaaaaaa Protospacer
*** .****************** **
126. spacer 2.24|1007521|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 7, identity: 0.767
taacatttcaaattgatatttatcaaataa CRISPR spacer
tcaggcatcaaattgataattatcaaaaaa Protospacer
* * .. *********** ******** **
127. spacer 2.25|1007587|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to KX156762 (Staphylococcus phage vB_SauS_IMEP5, complete genome) position: , mismatch: 7, identity: 0.767
ccactttcaatatatggaacaacataagca CRISPR spacer
tcttattcaacatttggaacaacataagaa Protospacer
.* . *****.** ************** *
128. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026783 (Shigella dysenteriae strain 08-3380 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
129. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP054891 (Shigella flexneri strain FDAARGOS_713 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
130. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026804 (Shigella flexneri strain 89-141 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
131. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034059 (Shigella flexneri strain FDAARGOS_535 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
132. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024476 (Shigella flexneri 7b strain 94-3007 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
133. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR213456 (Shigella flexneri strain AUSMDU00008332 isolate AUSMDU00008332 plasmid 2) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
134. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026771 (Shigella flexneri Y strain 93-3063 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
135. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044157 (Shigella flexneri strain AR-0424 plasmid pAR-0424-2, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
136. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026837 (Shigella boydii strain ATCC 49812 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
137. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP019696 (Shigella sonnei strain 75/02 plasmid pInv_75_02_1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
138. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026775 (Shigella dysenteriae strain ATCC 13313 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
139. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026796 (Shigella boydii strain ATCC BAA-1247 plasmid unnamed) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
140. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045785 (Shigella dysenteriae strain CFSAN029786 plasmid p1CFSAN029786, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
141. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044154 (Shigella flexneri strain AR-0425 plasmid pAR-0425-2, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
142. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP053752 (Shigella sonnei strain 506 plasmid pMHMC-001, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
143. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034933 (Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-2, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
144. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP010830 (Shigella sonnei strain FORC_011 plasmid pFORC11.1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
145. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP037924 (Shigella flexneri 5a str. M90T plasmid pWR100, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
146. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026841 (Shigella dysenteriae strain ATCC 9753 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
147. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053469 (Fusobacterium nucleatum strain Fn12230 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aaaccaatcaacataattatttttatattc Protospacer
.** . *************** *** ***
148. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026785 (Shigella dysenteriae strain 80-547 plasmid unnamed) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
149. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027028 (Shigella dysenteriae strain E670/74 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcaac Protospacer
.* ********** ** *********. *
150. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP026844 (Shigella boydii strain NCTC 9733 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
151. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024469 (Shigella dysenteriae strain BU53M1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
152. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026767 (Shigella boydii strain 59-248 plasmid unnamed) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcaac Protospacer
.* ********** ** *********. *
153. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026787 (Shigella dysenteriae strain NCTC 9718 plasmid unnamed) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
154. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026794 (Shigella flexneri strain 74-1170 plasmid unnamed) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
155. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033511 (Shigella flexneri strain 2016AM-0877 plasmid p2016AM-0877, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
156. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026099 (Shigella flexneri strain FDAARGOS_74 plasmid unnamed) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
157. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026812 (Shigella flexneri strain 64-5500 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcaac Protospacer
.* ********** ** *********. *
158. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026833 (Shigella dysenteriae strain ATCC 49346 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
159. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026826 (Shigella dysenteriae strain ATCC 12021 plasmid unnamed) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
160. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP046677 (Escherichia coli strain 152661 plasmid p152661_pINV, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
161. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NC_017319 (Shigella flexneri 2002017 plasmid pSFxv_1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
162. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012142 (Shigella flexneri 4c strain 1205 plasmid 1205p2, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
163. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026829 (Shigella dysenteriae strain ATCC 12037 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
164. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NC_002698 (Shigella flexneri 5a virulence plasmid pWR501, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
165. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NC_007607 (Shigella dysenteriae Sd197 plasmid pSD1_197, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
166. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011417 (Escherichia coli strain CFSAN029787 plasmid pCFSAN029787_01, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
167. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP046285 (Shigella sonnei strain FDAARGOS_715 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
168. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP000039 (Shigella sonnei Ss046 plasmid pSS_046, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
169. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007038 (Shigella flexneri G1663 plasmid pG1663, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
170. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NC_022899 (Shigella dysenteriae 1617 plasmid pSLG231, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
171. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030773 (Shigella flexneri 1c strain Y394 plasmid pINV-Y394, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
172. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to HE616529 (Shigella sonnei 53G plasmid A, complete genome) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
173. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026779 (Shigella dysenteriae strain 69-3818 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
174. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP023646 (Shigella sonnei strain CFSAN030807 plasmid pCFSAN030807_1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
175. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020087 (Shigella flexneri 1a strain 0670 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
176. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050866 (Escherichia coli strain 8-3-Ti3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
177. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050863 (Escherichia coli strain 8-3-DC15 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
178. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020337 (Shigella flexneri 4c strain 1602 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
179. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NC_010660 (Shigella boydii CDC 3083-94 plasmid pBS512_211, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
180. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045942 (Shigella flexneri 2a strain AUSMDU00010535 plasmid pAUSMDU00010535_01, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
181. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NC_004851 (Shigella flexneri 2a str. 301 plasmid pCP301, complete sequence) position: , mismatch: 7, identity: 0.767
gaaatcttcaacataattatttatattttc CRISPR spacer
aatatcttcaacaaaaatatttatatcagc Protospacer
.* ********** ** *********. *
182. spacer 1.2|288125|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY270848 (Enterococcus faecalis strain 2 plasmid pGTC2, complete sequence) position: , mismatch: 8, identity: 0.733
ttcgcacattttagcgtcttcttgttcttg CRISPR spacer
atctagatttttagcgtcttcttgtgcttt Protospacer
** . ***************** ***
183. spacer 1.2|288125|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034365 (Pantoea sp. CCBC3-3-1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
ttcgcacattttagcgtcttcttgttcttg CRISPR spacer
cacctcccttttagcttcttcttgttcttt Protospacer
. * . * ******* *************
184. spacer 1.4|288257|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 8, identity: 0.733
cagttattgtatatctatctccataaaaat CRISPR spacer
gagtcattgtatatctatatccatcctcac Protospacer
***.************* ***** *.
185. spacer 1.4|288257|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MH622943 (Myoviridae sp. isolate ctbc_4, complete genome) position: , mismatch: 8, identity: 0.733
cagttattgtatatctatctccataaaaat CRISPR spacer
gttgtattgaatatctatctccaaaaagtt Protospacer
***** ************* ***. *
186. spacer 1.4|288257|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 8, identity: 0.733
cagttattgtatatctatctccataaaaat CRISPR spacer
gagtcattgtatatctatatccattctcac Protospacer
***.************* ***** *.
187. spacer 1.4|288257|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 8, identity: 0.733
cagttattgtatatctatctccataaaaat CRISPR spacer
gagtcattgtatatctatatccattctcac Protospacer
***.************* ***** *.
188. spacer 1.5|288323|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MN694799 (Marine virus AFVG_250M1004, complete genome) position: , mismatch: 8, identity: 0.733
aattgtcttttaatgtcgtttataaattct CRISPR spacer
ggaagttttttaatgtcttttataaattga Protospacer
.. **.********** **********
189. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028214 (Bacillus subtilis strain SRCM102749 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
tttttaaaatcaatatcagtttcacaagca CRISPR spacer
cccagtaaatcaatatccgtttcataagca Protospacer
... *********** ******.*****
190. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 8, identity: 0.733
tttttaaaatcaatatcagtttcacaagca CRISPR spacer
attttattatcaatatcagtttcattacac Protospacer
***** ****************. *
191. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026535 (Bacillus velezensis strain DKU_NT_04 plasmid p2_DKU_NT_04, complete sequence) position: , mismatch: 8, identity: 0.733
tttttaaaatcaatatcagtttcacaagca CRISPR spacer
cccagtaaatcaatatccgtttcataagca Protospacer
... *********** ******.*****
192. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MH937468 (Streptococcus phage CHPC879, complete genome) position: , mismatch: 8, identity: 0.733
tttttaaaatcaatatcagtttcacaagca CRISPR spacer
attttaaaatcgctatcagtttcaaagaat Protospacer
**********. *********** *..
193. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MN694046 (Marine virus AFVG_250M906, complete genome) position: , mismatch: 8, identity: 0.733
tttttaaaatcaatatcagtttcacaagca CRISPR spacer
ctggtcctatcaatatcagtttcgcaagcc Protospacer
.* * ***************.*****
194. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MN694568 (Marine virus AFVG_250M879, complete genome) position: , mismatch: 8, identity: 0.733
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
tttctaaaatcaatatcagtt-----aatacttgt Protospacer
***.***************** *..*
195. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MN693906 (Marine virus AFVG_250M905, complete genome) position: , mismatch: 8, identity: 0.733
tttttaaaatcaatatcagtttcacaagca CRISPR spacer
ctggtcctatcaatatcagtttcgcaagcc Protospacer
.* * ***************.*****
196. spacer 1.8|288521|30|NC_021284|CRISPRCasFinder,CRT matches to MG592671 (Vibrio phage 2.275.O._10N.286.54.E11, partial genome) position: , mismatch: 8, identity: 0.733
atcaccatacatataacttccttgtttaag CRISPR spacer
tccaccaaacatataacttccttattctta Protospacer
.***** ***************.**. .
197. spacer 1.8|288521|30|NC_021284|CRISPRCasFinder,CRT matches to NC_014824 (Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL01, complete sequence) position: , mismatch: 8, identity: 0.733
atcaccatacatataacttccttgtttaag CRISPR spacer
tgtcccatacaaataacctccttgtttgat Protospacer
. ******* *****.*********.*
198. spacer 2.1|1006001|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to LR877331 (Klebsiella phage vB_KpnM_311F genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.733
tcttgtttttttcaactttgtaatgatcca CRISPR spacer
aaccagatttttcaactttgttatgatcca Protospacer
... ************** ********
199. spacer 2.1|1006001|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MH729874 (Klebsiella phage KP179, complete genome) position: , mismatch: 8, identity: 0.733
tcttgtttttttcaactttgtaatgatcca CRISPR spacer
aaccagatttttcaactttgttatgatcca Protospacer
... ************** ********
200. spacer 2.1|1006001|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NC_031087 (Klebsiella phage vB_KpnM_KpV477, complete genome) position: , mismatch: 8, identity: 0.733
tcttgtttttttcaactttgtaatgatcca CRISPR spacer
aaccagatttttcaactttgttatgatcca Protospacer
... ************** ********
201. spacer 2.1|1006001|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to CP062992 (Klebsiella phage AShe-2020a, complete genome) position: , mismatch: 8, identity: 0.733
tcttgtttttttcaactttgtaatgatcca CRISPR spacer
aaccagatttttcaactttgttatgatcca Protospacer
... ************** ********
202. spacer 2.4|1006199|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009639 (Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence) position: , mismatch: 8, identity: 0.733
agtcggggaagttaaagtattcttttgtta CRISPR spacer
actgaacaaagataaagtattcttttgttt Protospacer
* * .. .*** *****************
203. spacer 2.4|1006199|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053963 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733
agtcggggaagttaaagtattcttttgtta CRISPR spacer
actgaacaaagataaagtattcttttgttt Protospacer
* * .. .*** *****************
204. spacer 2.9|1006529|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP045273 (Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence) position: , mismatch: 8, identity: 0.733
aactttttttaagtagtccataaactcgtc CRISPR spacer
ttcgtttttttagtagtccataaactatcg Protospacer
* ****** *************** .
205. spacer 2.9|1006529|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP021437 (Bacillus thuringiensis strain C15 plasmid pBMB240, complete sequence) position: , mismatch: 8, identity: 0.733
aactttttttaagtagtccataaactcgtc CRISPR spacer
aacttttttcaagtagtccataccgaagga Protospacer
*********.************ *
206. spacer 2.9|1006529|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP020429 (Streptococcus sp. FDAARGOS_192 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
aactttttttaagtagtccataaactcgtc CRISPR spacer
caattttcttaagtagtccatagactatca Protospacer
* ****.**************.*** .
207. spacer 2.11|1006661|30|NC_021284|CRISPRCasFinder,CRT matches to MT074146 (Bacteroides phage SJC03, complete genome) position: , mismatch: 8, identity: 0.733
attggcattacaccatttaatctaactgta CRISPR spacer
aatccatttacaccatttaatctaattggt Protospacer
* * ******************.**
208. spacer 2.12|1006727|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP015797 (Borrelia mayonii strain MN14-1539 plasmid cp26, complete sequence) position: , mismatch: 8, identity: 0.733
catatttcgtaagtcgttaaagcttttcat CRISPR spacer
agcttttcgtaaggagttaaagcttttgac Protospacer
.. ********* ************ *.
209. spacer 2.12|1006727|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP015781 (Borrelia mayonii strain MN14-1420 plasmid cp26, complete sequence) position: , mismatch: 8, identity: 0.733
catatttcgtaagtcgttaaagcttttcat CRISPR spacer
agcttttcgtaaggagttaaagcttttgac Protospacer
.. ********* ************ *.
210. spacer 2.13|1006793|31|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP031005 (Lactobacillus curvatus strain TMW 1.1928 plasmid p-1.1928_2, complete sequence) position: , mismatch: 8, identity: 0.742
agaaattactactttaacaaaattaagtcgt CRISPR spacer
ttccaatactactttaaaaatattaagtcga Protospacer
* *********** ** *********
211. spacer 2.14|1006860|30|NC_021284|CRISPRCasFinder,CRT matches to MN693324 (Marine virus AFVG_25M101, complete genome) position: , mismatch: 8, identity: 0.733
caattttatcaatcatataaacagtatttt CRISPR spacer
ttgccctatcaatcatataaacattttttt Protospacer
. ....***************** * ****
212. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to CP016281 (Clostridium tyrobutyricum strain W428 plasmid pW428, complete sequence) position: , mismatch: 8, identity: 0.733
aatctttattaaaagtattatccataatat CRISPR spacer
tacattttttaaaagtattattcataaata Protospacer
*. *** *************.*****
213. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP037749 (Campylobacter helveticus strain 2013D-9613 plasmid unnamed1) position: , mismatch: 8, identity: 0.733
aatctttattaaaagtattatccataatat CRISPR spacer
catctttatcaaaagtattatcatctttgt Protospacer
********.************ . *.*
214. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP029155 (Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
aatctttattaaaagtattatccataatat CRISPR spacer
gatttttattaaaagtattatcagatttaa Protospacer
.**.****************** . **
215. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP020479 (Campylobacter helveticus strain ATCC 51209 plasmid pHELV-1, complete sequence) position: , mismatch: 8, identity: 0.733
aatctttattaaaagtattatccataatat CRISPR spacer
catctttatcaaaagtattatcatctttgt Protospacer
********.************ . *.*
216. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP014171 (Clostridium tyrobutyricum strain KCTC 5387 plasmid pCTK01, complete sequence) position: , mismatch: 8, identity: 0.733
aatctttattaaaagtattatccataatat CRISPR spacer
tacattttttaaaagtattattcataaata Protospacer
*. *** *************.*****
217. spacer 2.18|1007124|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043858 (Arcobacter cibarius strain H743 plasmid pACIB, complete sequence) position: , mismatch: 8, identity: 0.733
ttgacccttttatcttatcatacttatttt CRISPR spacer
ttactttatttaacttatcatacttatttg Protospacer
**. ... **** ****************
218. spacer 2.21|1007322|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 8, identity: 0.733
ccctaatgaagctattattatggatggatt CRISPR spacer
gcgccatgtagctattattatggatggtaa Protospacer
* . *** ******************
219. spacer 2.21|1007322|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MN694735 (Marine virus AFVG_250M680, complete genome) position: , mismatch: 8, identity: 0.733
ccctaatgaagctattattatggatggatt CRISPR spacer
agataatgaagatattattattgatgaggt Protospacer
******** ********* ****.. *
220. spacer 2.21|1007322|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MN693929 (Marine virus AFVG_250M681, complete genome) position: , mismatch: 8, identity: 0.733
ccctaatgaagctattattatggatggatt CRISPR spacer
agataatgaagatattattattgatgaggt Protospacer
******** ********* ****.. *
221. spacer 2.25|1007587|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040341 (Bacillus cereus strain DLOU-Tangshan plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
ccactttcaatatatggaacaacataagca CRISPR spacer
tcactttcaatatatgtaacaaacttttta Protospacer
.*************** ***** * .*
222. spacer 2.25|1007587|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MH572521 (Microviridae sp. isolate SD_HF_44, complete genome) position: , mismatch: 8, identity: 0.733
ccactttcaatatatggaacaacataagca CRISPR spacer
ttactttcaatatatggaaaaaaatcctga Protospacer
..***************** ** ** *
223. spacer 2.25|1007587|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053290 (Bacillus cereus strain WPySW2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
ccactttcaatatatggaacaacataagca CRISPR spacer
tcactttcaatatatgtaacaaacttttta Protospacer
.*************** ***** * .*
224. spacer 2.25|1007587|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042928 (Bacillus cereus strain G1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
ccactttcaatatatggaacaacataagca CRISPR spacer
tcactttcaatatatgtaacaaacttttta Protospacer
.*************** ***** * .*
225. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
226. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034040 (Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
227. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
228. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
229. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
230. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
231. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
232. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
233. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
234. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
235. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
236. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
237. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
238. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
239. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
240. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
241. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
242. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
243. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
244. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
245. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
246. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
247. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
248. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
249. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
250. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
251. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
252. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
253. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
254. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
255. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
256. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
257. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
258. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
259. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
260. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
261. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
262. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
263. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
264. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
265. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
266. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
267. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
268. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
269. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
270. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
271. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
272. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
273. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
274. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
275. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
276. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
277. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
278. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
279. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
280. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
281. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
282. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
283. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
284. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
285. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
286. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
287. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
288. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
289. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
290. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
291. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
292. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
293. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
294. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
295. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
296. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
297. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
298. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
299. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
300. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
301. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
302. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
303. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
304. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
305. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
306. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
307. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010910 (Candidatus Pantoea carbekii strain US plasmid pBMSBPS3, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
ctttttttaaacttaattatttatattttg Protospacer
*.** *** ****************
308. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
309. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
310. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
311. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
atgctgtggaacatcattatttatattttc Protospacer
. . * * ***** ***************
312. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to KT372714 (Bacillus phage vB_BtS_BMBtp16, complete genome) position: , mismatch: 8, identity: 0.733
gaaatcttcaacataattatttatattttc CRISPR spacer
acagaatccaacataattaattatattttt Protospacer
. *. *.*********** *********.
313. spacer 1.2|288125|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to AP013521 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G21, isolate: uvMED-CGR-U-MedDCM-OCT-S42-C60) position: , mismatch: 9, identity: 0.7
ttcgcacattttagcgtcttcttgttcttg CRISPR spacer
cttaactttttcagcgtcttcttgttcttt Protospacer
.*.. . ***.*****************
314. spacer 1.5|288323|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MG592456 (Vibrio phage 1.081.O._10N.286.52.C2, partial genome) position: , mismatch: 9, identity: 0.7
aattgtcttttaatgtcgtttataaattct CRISPR spacer
gtgttcaatttaatgtcgttgataaattcg Protospacer
. * . ************ ********
315. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024325 (Borrelia miyamotoi strain Yekat-6 plasmid pYkt6-6) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgctctt Protospacer
****** ************** *..
316. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024392 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp70, complete sequence) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
317. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024392 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp70, complete sequence) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
318. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024209 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-2) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgctctt Protospacer
****** ************** *..
319. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024211 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-4) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
320. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024338 (Borrelia miyamotoi strain Yekat-1 plasmid pYkt1-3) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
321. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040828 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-cp30-2, complete sequence) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgctctt Protospacer
****** ************** *..
322. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024357 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-3, complete sequence) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgctctt Protospacer
****** ************** *..
323. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024358 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-4, complete sequence) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgctctt Protospacer
****** ************** *..
324. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024373 (Borrelia miyamotoi strain Izh-14 plasmid pIzh14-1) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
325. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024373 (Borrelia miyamotoi strain Izh-14 plasmid pIzh14-1) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
326. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024378 (Borrelia miyamotoi strain Izh-14 plasmid pIzh14-3, complete sequence) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
327. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024381 (Borrelia miyamotoi strain Izh-14 plasmid pIzh14-6) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
328. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024382 (Borrelia miyamotoi strain Izh-14 plasmid pIzh14-7) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
329. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024318 (Borrelia miyamotoi strain Yekat-6 plasmid pYkt6-1) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
330. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024318 (Borrelia miyamotoi strain Yekat-6 plasmid pYkt6-1) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
331. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024321 (Borrelia miyamotoi strain Yekat-6 plasmid pYkt6-2) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
332. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024395 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-cp30-1, complete sequence) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
333. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024207 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-1) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
334. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024207 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-1) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
335. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024217 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-9) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgctctt Protospacer
****** ************** *..
336. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024335 (Borrelia miyamotoi strain Yekat-1 plasmid pYkt1-1) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
337. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024335 (Borrelia miyamotoi strain Yekat-1 plasmid pYkt1-1) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
338. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024353 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-1) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
339. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024353 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-1) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca----- CRISPR spacer
gttttaatatcaatatcagttt-----gtgccctt Protospacer
****** ************** *..
340. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to KY554766 (Lactococcus phage AM6, complete genome) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca CRISPR spacer
atttcaaaatcaatatcagttacaactttt Protospacer
***.**************** ** .
341. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MN855866 (Bacteriophage sp. isolate 292, complete genome) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca CRISPR spacer
atttcaaaatcaatatcagttacaactttt Protospacer
***.**************** ** .
342. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MN528768 (Lactococcus phage P596, complete genome) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca CRISPR spacer
atttcaaaatcaatatcagttacaactttt Protospacer
***.**************** ** .
343. spacer 1.6|288389|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to FJ429185 (Lactococcus phage P087, complete genome) position: , mismatch: 9, identity: 0.7
tttttaaaatcaatatcagtttcacaagca CRISPR spacer
atttcaaaatcaatatcagttacaactttt Protospacer
***.**************** ** .
344. spacer 2.1|1006001|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MN101226 (Klebsiella phage KPN2 HKu-2019, complete genome) position: , mismatch: 9, identity: 0.7
tcttgtttttttcaactttgtaatgatcca CRISPR spacer
aaccagatttttcaactttgttatgaccca Protospacer
... ************** ****.***
345. spacer 2.1|1006001|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MH333064 (Klebsiella phage Mineola, complete genome) position: , mismatch: 9, identity: 0.7
tcttgtttttttcaactttgtaatgatcca CRISPR spacer
aaccagatttttcaactttgttatgaccca Protospacer
... ************** ****.***
346. spacer 2.1|1006001|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MN434095 (Klebsiella pneumoniae phage JIPh_Kp122, complete genome) position: , mismatch: 9, identity: 0.7
tcttgtttttttcaactttgtaatgatcca CRISPR spacer
aaccagatttttcaactttgttatgaccca Protospacer
... ************** ****.***
347. spacer 2.1|1006001|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to KY000080 (Klebsiella phage KPV15, complete genome) position: , mismatch: 9, identity: 0.7
tcttgtttttttcaactttgtaatgatcca CRISPR spacer
aaccagatttttcaactttgttatgaccca Protospacer
... ************** ****.***
348. spacer 2.1|1006001|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MG751100 (Klebsiella phage KP1, complete genome) position: , mismatch: 9, identity: 0.7
tcttgtttttttcaactttgtaatgatcca CRISPR spacer
aaccagatttttcaactttgttatgaccca Protospacer
... ************** ****.***
349. spacer 2.1|1006001|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NC_028686 (Klebsiella phage JD18, complete genome) position: , mismatch: 9, identity: 0.7
tcttgtttttttcaactttgtaatgatcca CRISPR spacer
aaccagatttttcaactttgttatgaccca Protospacer
... ************** ****.***
350. spacer 2.1|1006001|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to MK421971 (Klebsiella phage vB_KpnM_GF, partial genome) position: , mismatch: 9, identity: 0.7
tcttgtttttttcaactttgtaatgatcca CRISPR spacer
aaccagatttttcaactttgttatgaccca Protospacer
... ************** ****.***
351. spacer 2.7|1006397|30|NC_021284|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054603 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.7
agtgtgtgctaataagttgcaatagattaa CRISPR spacer
gaatagccttaataagttgcaacagattaa Protospacer
.. *. .*************.*******
352. spacer 2.15|1006926|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP028329 (Lactobacillus sp. D1501 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.7
tctccataagttgtttcattcattggaatc CRISPR spacer
ggtgggatagttgttccattcattggaatt Protospacer
* . *******.*************.
353. spacer 2.15|1006926|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP035172 (Lactobacillus plantarum strain SRCM103418 plasmid unnamed4) position: , mismatch: 9, identity: 0.7
tctccataagttgtttcattcattggaatc CRISPR spacer
ggtgggatagttgttccattcattggaatt Protospacer
* . *******.*************.
354. spacer 2.15|1006926|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP023774 (Lactobacillus plantarum strain PC520 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.7
tctccataagttgtttcattcattggaatc CRISPR spacer
ggtgggatagttgttccattcattggaatt Protospacer
* . *******.*************.
355. spacer 2.15|1006926|30|NC_021284|CRISPRCasFinder,CRT matches to NC_014558 (Lactobacillus plantarum subsp. plantarum ST-III plasmid pST-III, complete sequence) position: , mismatch: 9, identity: 0.7
tctccataagttgtttcattcattggaatc CRISPR spacer
ggtgggatagttgttccattcattggaatt Protospacer
* . *******.*************.
356. spacer 2.15|1006926|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP035558 (Lactobacillus plantarum strain SRCM103297 plasmid unnamed2) position: , mismatch: 9, identity: 0.7
tctccataagttgtttcattcattggaatc CRISPR spacer
ggtgggatagttgttccattcattggaatt Protospacer
* . *******.*************.
357. spacer 2.15|1006926|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP035558 (Lactobacillus plantarum strain SRCM103297 plasmid unnamed2) position: , mismatch: 9, identity: 0.7
tctccataagttgtttcattcattggaatc CRISPR spacer
ggtgggatagttgttccattcattggaatt Protospacer
* . *******.*************.
358. spacer 2.15|1006926|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP017067 (Lactobacillus plantarum strain LP3 plasmid pLB301, complete sequence) position: , mismatch: 9, identity: 0.7
tctccataagttgtttcattcattggaatc CRISPR spacer
ggtgggatagttgttccattcattggaatt Protospacer
* . *******.*************.
359. spacer 2.15|1006926|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP035175 (Lactobacillus plantarum strain SRCM103426 plasmid unnamed1) position: , mismatch: 9, identity: 0.7
tctccataagttgtttcattcattggaatc CRISPR spacer
ggtgggatagttgttccattcattggaatt Protospacer
* . *******.*************.
360. spacer 2.15|1006926|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP035175 (Lactobacillus plantarum strain SRCM103426 plasmid unnamed1) position: , mismatch: 9, identity: 0.7
tctccataagttgtttcattcattggaatc CRISPR spacer
ggtgggatagttgttccattcattggaatt Protospacer
* . *******.*************.
361. spacer 2.15|1006926|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP035175 (Lactobacillus plantarum strain SRCM103426 plasmid unnamed1) position: , mismatch: 9, identity: 0.7
tctccataagttgtttcattcattggaatc CRISPR spacer
ggtgggatagttgttccattcattggaatt Protospacer
* . *******.*************.
362. spacer 2.15|1006926|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP035133 (Lactobacillus plantarum strain SRCM103311 plasmid unnamed2) position: , mismatch: 9, identity: 0.7
tctccataagttgtttcattcattggaatc CRISPR spacer
ggtgggatagttgttccattcattggaatt Protospacer
* . *******.*************.
363. spacer 2.15|1006926|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP025591 (Lactobacillus plantarum strain K259 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
tctccataagttgtttcattcattggaatc CRISPR spacer
ggtgggatagttgttccattcattggaatt Protospacer
* . *******.*************.
364. spacer 2.15|1006926|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP035116 (Lactobacillus plantarum strain SRCM103295 plasmid unnamed3) position: , mismatch: 9, identity: 0.7
tctccataagttgtttcattcattggaatc CRISPR spacer
ggtgggatagttgttccattcattggaatt Protospacer
* . *******.*************.
365. spacer 2.15|1006926|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP030245 (Lactobacillus plantarum strain Y44 plasmid pY44-1, complete sequence) position: , mismatch: 9, identity: 0.7
tctccataagttgtttcattcattggaatc CRISPR spacer
ggtgggatagttgttccattcattggaatt Protospacer
* . *******.*************.
366. spacer 2.15|1006926|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP035568 (Lactobacillus plantarum strain SRCM103300 plasmid unnamed2) position: , mismatch: 9, identity: 0.7
tctccataagttgtttcattcattggaatc CRISPR spacer
ggtgggatagttgttccattcattggaatt Protospacer
* . *******.*************.
367. spacer 2.15|1006926|30|NC_021284|CRISPRCasFinder,CRT matches to NZ_CP048023 (Lactobacillus plantarum strain CACC 558 plasmid p1CACC558, complete sequence) position: , mismatch: 9, identity: 0.7
tctccataagttgtttcattcattggaatc CRISPR spacer
ggtgggatagttgttccattcattggaatt Protospacer
* . *******.*************.
368. spacer 2.16|1006992|30|NC_021284|CRISPRCasFinder,CRT matches to MN693896 (Marine virus AFVG_250M448, complete genome) position: , mismatch: 9, identity: 0.7
aatctttattaaaagtattatccataatat CRISPR spacer
tttctttattaaaaatattatcccgttttg Protospacer
************.******** *
369. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497078 (Flavobacterium phage vB_Fsp_elemo10-3D, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
370. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497108 (Flavobacterium phage vB_Fsp_elemo4-9A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
371. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497121 (Flavobacterium phage vB_Fsp_elemo8-1D, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
372. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497101 (Flavobacterium phage vB_Fsp_elemo2-5B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
373. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497069 (Flavobacterium phage vB_Fsp_elemo15-9B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
374. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497123 (Flavobacterium phage vB_Fsp_elemo8-9A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
375. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497079 (Flavobacterium phage vB_Fsp_elemo10-9A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
376. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497094 (Flavobacterium phage vB_Fsp_elemo14-9A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
377. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497076 (Flavobacterium phage vB_Fsp_elemo1-9B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
378. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497115 (Flavobacterium phage vB_Fsp_elemo7-3B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
379. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497082 (Flavobacterium phage vB_Fsp_elemo11-9B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
380. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497088 (Flavobacterium phage vB_Fsp_elemo13-1E, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
381. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497085 (Flavobacterium phage vB_Fsp_elemo12-3A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
382. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497095 (Flavobacterium phage vB_Fsp_elemo14-9B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
383. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497110 (Flavobacterium phage vB_Fsp_elemo5-9A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
384. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497096 (Flavobacterium phage vB_Fsp_elemo15-3B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
385. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497114 (Flavobacterium phage vB_Fsp_elemo7-3A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
386. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497120 (Flavobacterium phage vB_Fsp_elemo8-1B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
387. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497087 (Flavobacterium phage vB_Fsp_elemo13-1B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
388. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497117 (Flavobacterium phage vB_Fsp_elemo7-9B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
389. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497119 (Flavobacterium phage vB_Fsp_elemo8-1A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
390. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497112 (Flavobacterium phage vB_Fsp_elemo6-5A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
391. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497099 (Flavobacterium phage vB_Fsp_elemo15-9C, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
392. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497097 (Flavobacterium phage vB_Fsp_elemo15-3D, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
393. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497089 (Flavobacterium phage vB_Fsp_elemo13-3B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
394. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497070 (Flavobacterium phage vB_Fsp_elemo2-5C, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
395. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497017 (Flavobacterium phage vB_Fsp_elemo7-9A, complete genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
396. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497109 (Flavobacterium phage vB_Fsp_elemo5-3D, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
397. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497104 (Flavobacterium phage vB_Fsp_elemo2-9A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
398. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497125 (Flavobacterium phage vB_Fsp_elemo9-1A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
399. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497118 (Flavobacterium phage vB_Fsp_elemo7-9C, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
400. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497072 (Flavobacterium phage vB_Fsp_elemo6-9C, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
401. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497077 (Flavobacterium phage vB_Fsp_elemo1-9C, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
402. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497068 (Flavobacterium phage vB_Fsp_elemo14-3B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
403. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497105 (Flavobacterium phage vB_Fsp_elemo3-5A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
404. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497107 (Flavobacterium phage vB_Fsp_elemo3-9B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
405. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497091 (Flavobacterium phage vB_Fsp_elemo13-5B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
406. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497113 (Flavobacterium phage vB_Fsp_elemo6-9A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
407. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497116 (Flavobacterium phage vB_Fsp_elemo7-5A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
408. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497065 (Flavobacterium phage vB_Fsp_elemo13-1A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
409. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497122 (Flavobacterium phage vB_Fsp_elemo8-3A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
410. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497106 (Flavobacterium phage vB_Fsp_elemo3-9A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
411. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497102 (Flavobacterium phage vB_Fsp_elemo2-5F, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
412. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497074 (Flavobacterium phage vB_Fsp_elemo1-5B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
413. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497092 (Flavobacterium phage vB_Fsp_elemo13-9B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
414. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497098 (Flavobacterium phage vB_Fsp_elemo15-9A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
415. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497081 (Flavobacterium phage vB_Fsp_elemo11-5C, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
416. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497103 (Flavobacterium phage vB_Fsp_elemo2-5G, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
417. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497124 (Flavobacterium phage vB_Fsp_elemo8-9B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
418. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497093 (Flavobacterium phage vB_Fsp_elemo14-3D, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
419. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497083 (Flavobacterium phage vB_Fsp_elemo11-9C, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
420. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497084 (Flavobacterium phage vB_Fsp_elemo12-1B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
421. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497086 (Flavobacterium phage vB_Fsp_elemo12-9A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
422. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497067 (Flavobacterium phage vB_Fsp_elemo14-1A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
423. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497066 (Flavobacterium phage vB_Fsp_elemo13-1C, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
424. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497100 (Flavobacterium phage vB_Fsp_elemo2-5A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
425. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497071 (Flavobacterium phage vB_Fsp_elemo6-3D, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
426. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497080 (Flavobacterium phage vB_Fsp_elemo10-9C, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
427. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497111 (Flavobacterium phage vB_Fsp_elemo5-9B, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
428. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497075 (Flavobacterium phage vB_Fsp_elemo1-9A, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
429. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497073 (Flavobacterium phage vB_Fsp_elemo8-9C, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
430. spacer 2.17|1007058|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MT497090 (Flavobacterium phage vB_Fsp_elemo13-3D, partial genome) position: , mismatch: 9, identity: 0.7
ttgtagtatttgaataatcaaatgctccaa CRISPR spacer
agagtgtatttgaatcatcaaatgctgtta Protospacer
. ********** ********** . *
431. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044485 (Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence) position: , mismatch: 9, identity: 0.7
gaaatcttcaacataattatttatattttc CRISPR spacer
tcgttcttcaatataattatttatataaaa Protospacer
. *******.**************
432. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051870 (Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_1, complete sequence) position: , mismatch: 9, identity: 0.7
gaaatcttcaacataattatttatattttc CRISPR spacer
tcgttcttcaatataattatttatataaaa Protospacer
. *******.**************
433. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038024 (Acinetobacter radioresistens strain DD78 plasmid pAR2, complete sequence) position: , mismatch: 9, identity: 0.7
gaaatcttcaacataattatttatattttc CRISPR spacer
tcgttcttcaatataattatttatataaaa Protospacer
. *******.**************
434. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to MK978162 (Acinetobacter lwoffii strain M2a plasmid pAVAci14, complete sequence) position: , mismatch: 9, identity: 0.7
gaaatcttcaacataattatttatattttc CRISPR spacer
tcgttcttcaatataattatttatataaaa Protospacer
. *******.**************
435. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NC_019218 (Uncultured bacterium HHV35 plasmid pHHV35, complete sequence) position: , mismatch: 9, identity: 0.7
gaaatcttcaacataattatttatattttc CRISPR spacer
tcgttcttcaatataattatttatataaaa Protospacer
. *******.**************
436. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041290 (Acinetobacter indicus strain 94-2 plasmid p94-2-tetX3, complete sequence) position: , mismatch: 9, identity: 0.7
gaaatcttcaacataattatttatattttc CRISPR spacer
tcgttcttcaatataattatttatataaaa Protospacer
. *******.**************
437. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025893 (Escherichia coli strain 503025 plasmid p503025_105, complete sequence) position: , mismatch: 9, identity: 0.7
gaaatcttcaacataattatttatattttc CRISPR spacer
ccctctttcaaaataattatttacattttg Protospacer
..***** ***********.*****
438. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025866 (Escherichia coli strain 504211 plasmid p504211_78, complete sequence) position: , mismatch: 9, identity: 0.7
gaaatcttcaacataattatttatattttc CRISPR spacer
ccctctttcaaaataattatttacattttg Protospacer
..***** ***********.*****
439. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006002 (Escherichia coli B7A plasmid pEB4, complete sequence) position: , mismatch: 9, identity: 0.7
gaaatcttcaacataattatttatattttc CRISPR spacer
ccctctttcaaaataattatttacattttg Protospacer
..***** ***********.*****
440. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025884 (Escherichia coli strain 503440 plasmid p503440_78, complete sequence) position: , mismatch: 17, identity: 0.433
gaaatcttcaacataattatttatattttc------ CRISPR spacer
------caaaatgtaaataattattttgaaagaggg Protospacer
. **..*** ** **** **
441. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025872 (Escherichia coli strain 503829 plasmid p503829_77, complete sequence) position: , mismatch: 17, identity: 0.433
gaaatcttcaacataattatttatattttc------ CRISPR spacer
------caaaatgtaaataattattttgaaagaggg Protospacer
. **..*** ** **** **
442. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025914 (Escherichia coli strain 203740 plasmid p203740_80, complete sequence) position: , mismatch: 17, identity: 0.433
gaaatcttcaacataattatttatattttc------ CRISPR spacer
------caaaatgtaaataattattttgaaagaggg Protospacer
. **..*** ** **** **
443. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024231 (Escherichia coli O25:NM strain 2014EL-1343-2 plasmid unnamed3, complete sequence) position: , mismatch: 17, identity: 0.433
gaaatcttcaacataattatttatattttc------ CRISPR spacer
------caaaatgtaaataattattttgaaagaggg Protospacer
. **..*** ** **** **
444. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to CP025899 (Escherichia coli strain 500465 plasmid p500465_77, complete sequence) position: , mismatch: 17, identity: 0.433
gaaatcttcaacataattatttatattttc------ CRISPR spacer
------caaaatgtaaataattattttgaaagaggg Protospacer
. **..*** ** **** **
445. spacer 2.26|1007653|30|NC_021284|CRISPRCasFinder,CRT,PILER-CR matches to LN908839 (Escherichia coli plasmid pCss_E1189) position: , mismatch: 17, identity: 0.433
gaaatcttcaacataattatttatattttc------ CRISPR spacer
------caaaatgtaaataattattttgaaagaggg Protospacer
. **..*** ** **** **
