Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_021528 Lactobacillus plantarum 16 plasmid Lp16I, complete sequence 0 crisprs NA 0 0 0 0
NC_021514 Lactobacillus plantarum 16, complete sequence 3 crisprs csa3,DinG,cas3,DEDDh 1 2 6 0
NC_021525 Lactobacillus plantarum 16 plasmid Lp16B, complete sequence 0 crisprs NA 0 0 0 0
NC_021520 Lactobacillus plantarum 16 plasmid Lp16L, complete sequence 0 crisprs NA 0 0 0 0
NC_021518 Lactobacillus plantarum 16 plasmid Lp16F, complete sequence 0 crisprs NA 0 0 3 0
NC_021519 Lactobacillus plantarum 16 plasmid Lp16H, complete sequence 0 crisprs NA 0 0 1 0
NC_021526 Lactobacillus plantarum 16 plasmid Lp16D, complete sequence 0 crisprs NA 0 0 0 0
NC_021515 Lactobacillus plantarum 16 plasmid Lp16A, complete sequence 0 crisprs RT 0 0 0 0
NC_021516 Lactobacillus plantarum 16 plasmid Lp16C, complete sequence 0 crisprs NA 0 0 0 0
NC_021527 Lactobacillus plantarum 16 plasmid Lp16G, complete sequence 0 crisprs NA 0 0 0 0
NC_021517 Lactobacillus plantarum 16 plasmid Lp16E, complete sequence 0 crisprs NA 0 0 4 0

Results visualization

1. NC_021519
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 29 : 59238 58 Bacillus_phage(25.0%) transposase,protease,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_021514
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021514_1 355014-355475 Orphan NA
12 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021514_2 2610434-2610519 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021514_3 2643496-2643626 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_021514_1 1.1|355032|18|NC_021514|CRT 355032-355049 18 NC_021514.1 2825366-2825383 2 0.889

1. spacer 1.1|355032|18|NC_021514|CRT matches to position: 2825366-2825383, mismatch: 2, identity: 0.889

gccgctaagaaacataag	CRISPR spacer
gccgctaaggaacatcag	Protospacer
*********.***** **

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_021514_3 3.2|2643573|31|NC_021514|CRISPRCasFinder 2643573-2643603 31 NZ_CP034567 Vibrio parahaemolyticus strain D3112 plasmid p1, complete sequence 30785-30815 6 0.806
NC_021514_3 3.2|2643573|31|NC_021514|CRISPRCasFinder 2643573-2643603 31 NZ_CP033143 Vibrio parahaemolyticus strain 160807 plasmid pVPWZ1, complete sequence 85109-85139 6 0.806
NC_021514_3 3.2|2643573|31|NC_021514|CRISPRCasFinder 2643573-2643603 31 NZ_CP034300 Vibrio parahaemolyticus strain 20160303005-1 plasmid pVPSD2016-1, complete sequence 82262-82292 6 0.806
NC_021514_3 3.2|2643573|31|NC_021514|CRISPRCasFinder 2643573-2643603 31 NZ_CP033139 Vibrio owensii strain 1700302 plasmid pVOWZ1, complete sequence 19890-19920 6 0.806
NC_021514_1 1.2|355068|30|NC_021514|CRT 355068-355097 30 NZ_CP006988 Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence 31047-31076 7 0.767
NC_021514_1 1.2|355068|30|NC_021514|CRT 355068-355097 30 NC_042345 Phage Salvo, complete genome 4721-4750 8 0.733
NC_021514_3 3.2|2643573|31|NC_021514|CRISPRCasFinder 2643573-2643603 31 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1245593-1245623 8 0.742

1. spacer 3.2|2643573|31|NC_021514|CRISPRCasFinder matches to NZ_CP034567 (Vibrio parahaemolyticus strain D3112 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.806

aaacccagcgccacaaccaaacccggcgccg	CRISPR spacer
catcaaagcgccactaccaaacgcggcgccg	Protospacer
 * *  ******** ******* ********

2. spacer 3.2|2643573|31|NC_021514|CRISPRCasFinder matches to NZ_CP033143 (Vibrio parahaemolyticus strain 160807 plasmid pVPWZ1, complete sequence) position: , mismatch: 6, identity: 0.806

aaacccagcgccacaaccaaacccggcgccg	CRISPR spacer
catcaaagcgccactaccaaacgcggcgccg	Protospacer
 * *  ******** ******* ********

3. spacer 3.2|2643573|31|NC_021514|CRISPRCasFinder matches to NZ_CP034300 (Vibrio parahaemolyticus strain 20160303005-1 plasmid pVPSD2016-1, complete sequence) position: , mismatch: 6, identity: 0.806

aaacccagcgccacaaccaaacccggcgccg	CRISPR spacer
catcaaagcgccactaccaaacgcggcgccg	Protospacer
 * *  ******** ******* ********

4. spacer 3.2|2643573|31|NC_021514|CRISPRCasFinder matches to NZ_CP033139 (Vibrio owensii strain 1700302 plasmid pVOWZ1, complete sequence) position: , mismatch: 6, identity: 0.806

aaacccagcgccacaaccaaacccggcgccg	CRISPR spacer
catcaaagcgccactaccaaacgcggcgccg	Protospacer
 * *  ******** ******* ********

5. spacer 1.2|355068|30|NC_021514|CRT matches to NZ_CP006988 (Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence) position: , mismatch: 7, identity: 0.767

cacaagaagaaagcggccaagaaacataag	CRISPR spacer
cacaagaataaagccgccaagaagctccgg	Protospacer
******** ***** ********.* . .*

6. spacer 1.2|355068|30|NC_021514|CRT matches to NC_042345 (Phage Salvo, complete genome) position: , mismatch: 8, identity: 0.733

cacaagaagaaagcggccaagaaacataag	CRISPR spacer
ccggggaagtaagcggacaagaaacatact	Protospacer
*  ..**** ****** ***********  

7. spacer 3.2|2643573|31|NC_021514|CRISPRCasFinder matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

aaacccagcgccacaaccaaacccggcgccg	CRISPR spacer
ccgctgagcgacacaaccaaaccctgcgcct	Protospacer
  .*. **** ************* ***** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 316060 : 428170 106 Bacillus_phage(21.43%) protease,bacteriocin,tRNA,transposase,holin NA
DBSCAN-SWA_2 590819 : 599443 11 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_3 791826 : 828440 29 unidentified_phage(22.22%) integrase,transposase,protease attL 823175:823196|attR 826993:827014
DBSCAN-SWA_4 1196159 : 1205997 9 Lactobacillus_phage(87.5%) NA NA
DBSCAN-SWA_5 2026598 : 2089266 81 Lactobacillus_phage(53.66%) integrase,transposase,portal,tail,head,holin,capsid,terminase attL 2040370:2040385|attR 2095532:2095547
DBSCAN-SWA_6 2277819 : 2286330 9 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_021517
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 3438 2 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_2 10919 : 18886 2 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_3 23935 : 32878 7 Lactobacillus_phage(28.57%) transposase NA
DBSCAN-SWA_4 36059 : 37951 2 Enterococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_021518
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 6775 6 Paenibacillus_phage(33.33%) holin,transposase NA
DBSCAN-SWA_2 11900 : 18561 6 Acanthocystis_turfacea_Chlorella_virus(25.0%) holin NA
DBSCAN-SWA_3 39002 : 47954 9 Staphylococcus_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage