Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_021726 Acinetobacter baumannii BJAB07104, complete sequence 1 crisprs DEDDh,RT,cas3,csa3,WYL 0 0 7 0
NC_021728 Acinetobacter baumannii BJAB07104 plasmid p2BJAB07104, complete sequence 0 crisprs NA 0 0 0 0
NC_021727 Acinetobacter baumannii BJAB07104 plasmid p1BJAB07104, complete sequence 1 crisprs NA 0 1 0 0

Results visualization

1. NC_021726
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021726_1 2404526-2404611 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 264504 : 292343 23 Vibriophage(60.0%) transposase,integrase attL 277494:277553|attR 292848:298715
DBSCAN-SWA_2 1002373 : 1010470 14 Acinetobacter_phage(57.14%) integrase attL 997700:997714|attR 1009612:1009626
DBSCAN-SWA_3 1230762 : 1243110 24 Acinetobacter_phage(95.65%) NA NA
DBSCAN-SWA_4 1247069 : 1275743 38 Acinetobacter_phage(93.55%) terminase,capsid NA
DBSCAN-SWA_5 1281358 : 1318810 54 Acinetobacter_phage(45.45%) terminase,portal,capsid,head,integrase,tail,protease attL 1282884:1282937|attR 1318971:1319024
DBSCAN-SWA_6 1606686 : 1657446 71 Acinetobacter_phage(89.66%) terminase,integrase,capsid,transposase attL 1603868:1603884|attR 1650567:1650583
DBSCAN-SWA_7 2815287 : 2830084 10 Acinetobacter_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_021727
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021727_1 58447-58537 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_021727_1 1.1|58478|29|NC_021727|CRISPRCasFinder 58478-58506 29 NZ_CP018144 Acinetobacter baumannii strain HRAB-85 plasmid unnamed, complete sequence 68613-68641 0 1.0
NC_021727_1 1.1|58478|29|NC_021727|CRISPRCasFinder 58478-58506 29 NZ_MK386682 Acinetobacter baumannii strain ABAY10001 plasmid pABAY10001_1C, complete sequence 6236-6264 0 1.0
NC_021727_1 1.1|58478|29|NC_021727|CRISPRCasFinder 58478-58506 29 NC_021727 Acinetobacter baumannii BJAB07104 plasmid p1BJAB07104, complete sequence 58478-58506 0 1.0
NC_021727_1 1.1|58478|29|NC_021727|CRISPRCasFinder 58478-58506 29 NZ_CP018422 Acinetobacter baumannii strain XDR-BJ83 isolate male patient plasmid pBJ83, complete sequence 17316-17344 0 1.0
NC_021727_1 1.1|58478|29|NC_021727|CRISPRCasFinder 58478-58506 29 NC_017848 Acinetobacter baumannii MDR-TJ plasmid pABTJ1, complete sequence 50506-50534 0 1.0
NC_021727_1 1.1|58478|29|NC_021727|CRISPRCasFinder 58478-58506 29 NZ_KM922672 Acinetobacter baumannii strain A221 plasmid pAZJ221, complete sequence 58478-58506 0 1.0
NC_021727_1 1.1|58478|29|NC_021727|CRISPRCasFinder 58478-58506 29 NC_021731 Acinetobacter baumannii BJAB0868 plasmid p2BJAB0868, complete sequence 58476-58504 0 1.0
NC_021727_1 1.1|58478|29|NC_021727|CRISPRCasFinder 58478-58506 29 NZ_CP018144 Acinetobacter baumannii strain HRAB-85 plasmid unnamed, complete sequence 68493-68521 1 0.966
NC_021727_1 1.1|58478|29|NC_021727|CRISPRCasFinder 58478-58506 29 NZ_CP018144 Acinetobacter baumannii strain HRAB-85 plasmid unnamed, complete sequence 68553-68581 1 0.966
NC_021727_1 1.1|58478|29|NC_021727|CRISPRCasFinder 58478-58506 29 NZ_MK386682 Acinetobacter baumannii strain ABAY10001 plasmid pABAY10001_1C, complete sequence 6116-6144 1 0.966
NC_021727_1 1.1|58478|29|NC_021727|CRISPRCasFinder 58478-58506 29 NZ_MK386682 Acinetobacter baumannii strain ABAY10001 plasmid pABAY10001_1C, complete sequence 6176-6204 1 0.966
NC_021727_1 1.1|58478|29|NC_021727|CRISPRCasFinder 58478-58506 29 NZ_CP018422 Acinetobacter baumannii strain XDR-BJ83 isolate male patient plasmid pBJ83, complete sequence 17376-17404 1 0.966
NC_021727_1 1.1|58478|29|NC_021727|CRISPRCasFinder 58478-58506 29 NZ_CP018422 Acinetobacter baumannii strain XDR-BJ83 isolate male patient plasmid pBJ83, complete sequence 17436-17464 1 0.966
NC_021727_1 1.1|58478|29|NC_021727|CRISPRCasFinder 58478-58506 29 NC_017848 Acinetobacter baumannii MDR-TJ plasmid pABTJ1, complete sequence 50566-50594 1 0.966
NC_021727_1 1.1|58478|29|NC_021727|CRISPRCasFinder 58478-58506 29 NC_017848 Acinetobacter baumannii MDR-TJ plasmid pABTJ1, complete sequence 50626-50654 1 0.966
NC_021727_1 1.1|58478|29|NC_021727|CRISPRCasFinder 58478-58506 29 NZ_KM922672 Acinetobacter baumannii strain A221 plasmid pAZJ221, complete sequence 58538-58566 1 0.966
NC_021727_1 1.1|58478|29|NC_021727|CRISPRCasFinder 58478-58506 29 NZ_KM922672 Acinetobacter baumannii strain A221 plasmid pAZJ221, complete sequence 58598-58626 1 0.966

1. spacer 1.1|58478|29|NC_021727|CRISPRCasFinder matches to NZ_CP018144 (Acinetobacter baumannii strain HRAB-85 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agtactttctgtggatcttgagctacttc	CRISPR spacer
agtactttctgtggatcttgagctacttc	Protospacer
*****************************

2. spacer 1.1|58478|29|NC_021727|CRISPRCasFinder matches to NZ_MK386682 (Acinetobacter baumannii strain ABAY10001 plasmid pABAY10001_1C, complete sequence) position: , mismatch: 0, identity: 1.0

agtactttctgtggatcttgagctacttc	CRISPR spacer
agtactttctgtggatcttgagctacttc	Protospacer
*****************************

3. spacer 1.1|58478|29|NC_021727|CRISPRCasFinder matches to NC_021727 (Acinetobacter baumannii BJAB07104 plasmid p1BJAB07104, complete sequence) position: , mismatch: 0, identity: 1.0

agtactttctgtggatcttgagctacttc	CRISPR spacer
agtactttctgtggatcttgagctacttc	Protospacer
*****************************

4. spacer 1.1|58478|29|NC_021727|CRISPRCasFinder matches to NZ_CP018422 (Acinetobacter baumannii strain XDR-BJ83 isolate male patient plasmid pBJ83, complete sequence) position: , mismatch: 0, identity: 1.0

agtactttctgtggatcttgagctacttc	CRISPR spacer
agtactttctgtggatcttgagctacttc	Protospacer
*****************************

5. spacer 1.1|58478|29|NC_021727|CRISPRCasFinder matches to NC_017848 (Acinetobacter baumannii MDR-TJ plasmid pABTJ1, complete sequence) position: , mismatch: 0, identity: 1.0

agtactttctgtggatcttgagctacttc	CRISPR spacer
agtactttctgtggatcttgagctacttc	Protospacer
*****************************

6. spacer 1.1|58478|29|NC_021727|CRISPRCasFinder matches to NZ_KM922672 (Acinetobacter baumannii strain A221 plasmid pAZJ221, complete sequence) position: , mismatch: 0, identity: 1.0

agtactttctgtggatcttgagctacttc	CRISPR spacer
agtactttctgtggatcttgagctacttc	Protospacer
*****************************

7. spacer 1.1|58478|29|NC_021727|CRISPRCasFinder matches to NC_021731 (Acinetobacter baumannii BJAB0868 plasmid p2BJAB0868, complete sequence) position: , mismatch: 0, identity: 1.0

agtactttctgtggatcttgagctacttc	CRISPR spacer
agtactttctgtggatcttgagctacttc	Protospacer
*****************************

8. spacer 1.1|58478|29|NC_021727|CRISPRCasFinder matches to NZ_CP018144 (Acinetobacter baumannii strain HRAB-85 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

9. spacer 1.1|58478|29|NC_021727|CRISPRCasFinder matches to NZ_CP018144 (Acinetobacter baumannii strain HRAB-85 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

10. spacer 1.1|58478|29|NC_021727|CRISPRCasFinder matches to NZ_MK386682 (Acinetobacter baumannii strain ABAY10001 plasmid pABAY10001_1C, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

11. spacer 1.1|58478|29|NC_021727|CRISPRCasFinder matches to NZ_MK386682 (Acinetobacter baumannii strain ABAY10001 plasmid pABAY10001_1C, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

12. spacer 1.1|58478|29|NC_021727|CRISPRCasFinder matches to NZ_CP018422 (Acinetobacter baumannii strain XDR-BJ83 isolate male patient plasmid pBJ83, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

13. spacer 1.1|58478|29|NC_021727|CRISPRCasFinder matches to NZ_CP018422 (Acinetobacter baumannii strain XDR-BJ83 isolate male patient plasmid pBJ83, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

14. spacer 1.1|58478|29|NC_021727|CRISPRCasFinder matches to NC_017848 (Acinetobacter baumannii MDR-TJ plasmid pABTJ1, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

15. spacer 1.1|58478|29|NC_021727|CRISPRCasFinder matches to NC_017848 (Acinetobacter baumannii MDR-TJ plasmid pABTJ1, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

16. spacer 1.1|58478|29|NC_021727|CRISPRCasFinder matches to NZ_KM922672 (Acinetobacter baumannii strain A221 plasmid pAZJ221, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

17. spacer 1.1|58478|29|NC_021727|CRISPRCasFinder matches to NZ_KM922672 (Acinetobacter baumannii strain A221 plasmid pAZJ221, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage