Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_021729 Acinetobacter baumannii BJAB0868, complete sequence 1 crisprs DEDDh,csa3,cas3,WYL 0 0 5 0
NC_021731 Acinetobacter baumannii BJAB0868 plasmid p2BJAB0868, complete sequence 1 crisprs NA 0 1 0 0
NC_021732 Acinetobacter baumannii BJAB0868 plasmid p3BJAB0868, complete sequence 0 crisprs NA 0 0 0 0
NC_021730 Acinetobacter baumannii BJAB0868 plasmid p1BJAB0868, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_021729
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021729_1 1633475-1633560 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 261449 : 286186 24 Vibriophage(50.0%) transposase,integrase attL 273249:273308|attR 288602:294469
DBSCAN-SWA_2 1004203 : 1016987 19 Acinetobacter_phage(53.85%) NA NA
DBSCAN-SWA_3 1237992 : 1270028 46 Acinetobacter_phage(43.33%) terminase,protease,capsid,portal,head,integrase,tail attL 1234103:1234156|attR 1270189:1270242
DBSCAN-SWA_4 2723842 : 2738639 10 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_5 3175264 : 3227163 75 Acinetobacter_phage(90.16%) terminase,capsid,integrase attL 3175076:3175096|attR 3227902:3227922
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_021731
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021731_1 58445-58535 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_021731_1 1.1|58476|29|NC_021731|CRISPRCasFinder 58476-58504 29 NZ_CP018144 Acinetobacter baumannii strain HRAB-85 plasmid unnamed, complete sequence 68613-68641 0 1.0
NC_021731_1 1.1|58476|29|NC_021731|CRISPRCasFinder 58476-58504 29 NZ_MK386682 Acinetobacter baumannii strain ABAY10001 plasmid pABAY10001_1C, complete sequence 6236-6264 0 1.0
NC_021731_1 1.1|58476|29|NC_021731|CRISPRCasFinder 58476-58504 29 NC_021727 Acinetobacter baumannii BJAB07104 plasmid p1BJAB07104, complete sequence 58478-58506 0 1.0
NC_021731_1 1.1|58476|29|NC_021731|CRISPRCasFinder 58476-58504 29 NZ_CP018422 Acinetobacter baumannii strain XDR-BJ83 isolate male patient plasmid pBJ83, complete sequence 17316-17344 0 1.0
NC_021731_1 1.1|58476|29|NC_021731|CRISPRCasFinder 58476-58504 29 NC_017848 Acinetobacter baumannii MDR-TJ plasmid pABTJ1, complete sequence 50506-50534 0 1.0
NC_021731_1 1.1|58476|29|NC_021731|CRISPRCasFinder 58476-58504 29 NZ_KM922672 Acinetobacter baumannii strain A221 plasmid pAZJ221, complete sequence 58478-58506 0 1.0
NC_021731_1 1.1|58476|29|NC_021731|CRISPRCasFinder 58476-58504 29 NC_021731 Acinetobacter baumannii BJAB0868 plasmid p2BJAB0868, complete sequence 58476-58504 0 1.0
NC_021731_1 1.1|58476|29|NC_021731|CRISPRCasFinder 58476-58504 29 NZ_CP018144 Acinetobacter baumannii strain HRAB-85 plasmid unnamed, complete sequence 68493-68521 1 0.966
NC_021731_1 1.1|58476|29|NC_021731|CRISPRCasFinder 58476-58504 29 NZ_CP018144 Acinetobacter baumannii strain HRAB-85 plasmid unnamed, complete sequence 68553-68581 1 0.966
NC_021731_1 1.1|58476|29|NC_021731|CRISPRCasFinder 58476-58504 29 NZ_MK386682 Acinetobacter baumannii strain ABAY10001 plasmid pABAY10001_1C, complete sequence 6116-6144 1 0.966
NC_021731_1 1.1|58476|29|NC_021731|CRISPRCasFinder 58476-58504 29 NZ_MK386682 Acinetobacter baumannii strain ABAY10001 plasmid pABAY10001_1C, complete sequence 6176-6204 1 0.966
NC_021731_1 1.1|58476|29|NC_021731|CRISPRCasFinder 58476-58504 29 NZ_CP018422 Acinetobacter baumannii strain XDR-BJ83 isolate male patient plasmid pBJ83, complete sequence 17376-17404 1 0.966
NC_021731_1 1.1|58476|29|NC_021731|CRISPRCasFinder 58476-58504 29 NZ_CP018422 Acinetobacter baumannii strain XDR-BJ83 isolate male patient plasmid pBJ83, complete sequence 17436-17464 1 0.966
NC_021731_1 1.1|58476|29|NC_021731|CRISPRCasFinder 58476-58504 29 NC_017848 Acinetobacter baumannii MDR-TJ plasmid pABTJ1, complete sequence 50566-50594 1 0.966
NC_021731_1 1.1|58476|29|NC_021731|CRISPRCasFinder 58476-58504 29 NC_017848 Acinetobacter baumannii MDR-TJ plasmid pABTJ1, complete sequence 50626-50654 1 0.966
NC_021731_1 1.1|58476|29|NC_021731|CRISPRCasFinder 58476-58504 29 NZ_KM922672 Acinetobacter baumannii strain A221 plasmid pAZJ221, complete sequence 58538-58566 1 0.966
NC_021731_1 1.1|58476|29|NC_021731|CRISPRCasFinder 58476-58504 29 NZ_KM922672 Acinetobacter baumannii strain A221 plasmid pAZJ221, complete sequence 58598-58626 1 0.966

1. spacer 1.1|58476|29|NC_021731|CRISPRCasFinder matches to NZ_CP018144 (Acinetobacter baumannii strain HRAB-85 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agtactttctgtggatcttgagctacttc	CRISPR spacer
agtactttctgtggatcttgagctacttc	Protospacer
*****************************

2. spacer 1.1|58476|29|NC_021731|CRISPRCasFinder matches to NZ_MK386682 (Acinetobacter baumannii strain ABAY10001 plasmid pABAY10001_1C, complete sequence) position: , mismatch: 0, identity: 1.0

agtactttctgtggatcttgagctacttc	CRISPR spacer
agtactttctgtggatcttgagctacttc	Protospacer
*****************************

3. spacer 1.1|58476|29|NC_021731|CRISPRCasFinder matches to NC_021727 (Acinetobacter baumannii BJAB07104 plasmid p1BJAB07104, complete sequence) position: , mismatch: 0, identity: 1.0

agtactttctgtggatcttgagctacttc	CRISPR spacer
agtactttctgtggatcttgagctacttc	Protospacer
*****************************

4. spacer 1.1|58476|29|NC_021731|CRISPRCasFinder matches to NZ_CP018422 (Acinetobacter baumannii strain XDR-BJ83 isolate male patient plasmid pBJ83, complete sequence) position: , mismatch: 0, identity: 1.0

agtactttctgtggatcttgagctacttc	CRISPR spacer
agtactttctgtggatcttgagctacttc	Protospacer
*****************************

5. spacer 1.1|58476|29|NC_021731|CRISPRCasFinder matches to NC_017848 (Acinetobacter baumannii MDR-TJ plasmid pABTJ1, complete sequence) position: , mismatch: 0, identity: 1.0

agtactttctgtggatcttgagctacttc	CRISPR spacer
agtactttctgtggatcttgagctacttc	Protospacer
*****************************

6. spacer 1.1|58476|29|NC_021731|CRISPRCasFinder matches to NZ_KM922672 (Acinetobacter baumannii strain A221 plasmid pAZJ221, complete sequence) position: , mismatch: 0, identity: 1.0

agtactttctgtggatcttgagctacttc	CRISPR spacer
agtactttctgtggatcttgagctacttc	Protospacer
*****************************

7. spacer 1.1|58476|29|NC_021731|CRISPRCasFinder matches to NC_021731 (Acinetobacter baumannii BJAB0868 plasmid p2BJAB0868, complete sequence) position: , mismatch: 0, identity: 1.0

agtactttctgtggatcttgagctacttc	CRISPR spacer
agtactttctgtggatcttgagctacttc	Protospacer
*****************************

8. spacer 1.1|58476|29|NC_021731|CRISPRCasFinder matches to NZ_CP018144 (Acinetobacter baumannii strain HRAB-85 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

9. spacer 1.1|58476|29|NC_021731|CRISPRCasFinder matches to NZ_CP018144 (Acinetobacter baumannii strain HRAB-85 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

10. spacer 1.1|58476|29|NC_021731|CRISPRCasFinder matches to NZ_MK386682 (Acinetobacter baumannii strain ABAY10001 plasmid pABAY10001_1C, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

11. spacer 1.1|58476|29|NC_021731|CRISPRCasFinder matches to NZ_MK386682 (Acinetobacter baumannii strain ABAY10001 plasmid pABAY10001_1C, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

12. spacer 1.1|58476|29|NC_021731|CRISPRCasFinder matches to NZ_CP018422 (Acinetobacter baumannii strain XDR-BJ83 isolate male patient plasmid pBJ83, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

13. spacer 1.1|58476|29|NC_021731|CRISPRCasFinder matches to NZ_CP018422 (Acinetobacter baumannii strain XDR-BJ83 isolate male patient plasmid pBJ83, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

14. spacer 1.1|58476|29|NC_021731|CRISPRCasFinder matches to NC_017848 (Acinetobacter baumannii MDR-TJ plasmid pABTJ1, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

15. spacer 1.1|58476|29|NC_021731|CRISPRCasFinder matches to NC_017848 (Acinetobacter baumannii MDR-TJ plasmid pABTJ1, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

16. spacer 1.1|58476|29|NC_021731|CRISPRCasFinder matches to NZ_KM922672 (Acinetobacter baumannii strain A221 plasmid pAZJ221, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

17. spacer 1.1|58476|29|NC_021731|CRISPRCasFinder matches to NZ_KM922672 (Acinetobacter baumannii strain A221 plasmid pAZJ221, complete sequence) position: , mismatch: 1, identity: 0.966

agtactttctgtggatcttgagctacttc	CRISPR spacer
ggtactttctgtggatcttgagctacttc	Protospacer
.****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage