1. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 1, identity: 0.955
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggcggtgcc Protospacer
********************.*
2. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
3. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
4. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcgggccggcggca Protospacer
**********.***********
5. spacer 9.15|1570502|22|NC_021740|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
6. spacer 9.15|1570502|22|NC_021740|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
7. spacer 9.15|1570502|22|NC_021740|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
8. spacer 9.15|1570502|22|NC_021740|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
9. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 2, identity: 0.917
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcgggacagcatggcgttg Protospacer
******* *.**************
10. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 2, identity: 0.917
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcgggacagcatggcgttg Protospacer
******* *.**************
11. spacer 2.6|335718|24|NC_021740|CRT matches to NC_028947 (Mycobacterium phage Kratio, complete genome) position: , mismatch: 2, identity: 0.917
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgccaaacggcatggcgttg Protospacer
********.***.***********
12. spacer 2.8|335814|24|NC_021740|CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 2, identity: 0.917
atgagcccgccggcgccgccgttg CRISPR spacer
aagagcacgccggcgccgccgttg Protospacer
* **** *****************
13. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.917
atgagcccgccggcgccgccgttg CRISPR spacer
atgaggacgccggcgccgccgttg Protospacer
***** *****************
14. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggcggtggg Protospacer
********************
15. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
agtcggcggtgccgacggtgtc Protospacer
*************.*******
16. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggcgtc Protospacer
.*****************.***
17. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgtcggcggtgtc Protospacer
.**********.**********
18. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
ggtcggcggtgccggcggcgtc Protospacer
*****************.***
19. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggccgtgta Protospacer
**************** ****
20. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggccgtgta Protospacer
**************** ****
21. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
ggtcggcggtgccggccgtgtc Protospacer
*************** *****
22. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NC_047977 (Microbacterium phage Hendrix, complete genome) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgacggcggtgccggcggtgtg Protospacer
** ******************
23. spacer 8.15|1211366|22|NC_021740|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 2, identity: 0.909
ggacggtggtaccggcggtcag CRISPR spacer
tgacggtggtgccggcggtcag Protospacer
*********.***********
24. spacer 9.2|1569575|22|NC_021740|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
25. spacer 9.2|1569575|22|NC_021740|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
26. spacer 9.2|1569575|22|NC_021740|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
27. spacer 9.2|1569575|22|NC_021740|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
28. spacer 9.2|1569575|22|NC_021740|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
29. spacer 9.3|1569629|22|NC_021740|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909
ggtaccgtcctcgccggcggtg CRISPR spacer
ggcaccgtcctcgccggcggtt Protospacer
**.******************
30. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
31. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
32. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
33. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
34. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
35. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
36. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
37. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
38. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
39. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgggg Protospacer
******************** .
40. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
accgccgatcaggccggcggca Protospacer
..********************
41. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ctcggcgatcaggccggcggca Protospacer
*** *****************
42. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
43. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
44. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
45. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
46. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcg Protospacer
***************** ***.
47. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ggcgccgatcaggccggcggcc Protospacer
* *******************
48. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggcctgcggcg Protospacer
*************** *****.
49. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
50. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgccg Protospacer
******************* *.
51. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgagcaggccggcggcc Protospacer
******** ************
52. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
53. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
54. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
55. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
56. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 3, identity: 0.889
gcggcgccgaagagcaggccggcgttg CRISPR spacer
acggcggcgaggagcaggccggcgttg Protospacer
.***** ***.****************
57. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
58. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP026559 (Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p2_tig3, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgctgaacagcatgccgttg Protospacer
******.********** *****
59. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
60. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
61. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP019872 (Pseudomonas syringae pv. tomato strain B13-200 plasmid pB13-200A, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgctgaacagcatgccgttg Protospacer
******.********** *****
62. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
63. spacer 2.6|335718|24|NC_021740|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
64. spacer 2.6|335718|24|NC_021740|CRT matches to NC_017385 (Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgccgagcagcatggcgctg Protospacer
*********.**********.**
65. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
66. spacer 2.6|335718|24|NC_021740|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
67. spacer 2.6|335718|24|NC_021740|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacaggatggcgtcg Protospacer
************* *******.*
68. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcagaacagcatggcgcag Protospacer
******* *************. *
69. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP012910 (Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgccgagcagcatggcgctg Protospacer
*********.**********.**
70. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
71. spacer 2.6|335718|24|NC_021740|CRT matches to CP054316 (Escherichia coli strain SCU-483 plasmid pSCU-483-1) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcagaacagcatggcggtt Protospacer
******* ************* *
72. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
73. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
74. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
75. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_LR723679 (Arsenite-oxidising bacterium NT-25 plasmid 3) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagcatgccgtcg Protospacer
***************** ***.*
76. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
77. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcggtgaacagcatggcgttc Protospacer
****** .***************
78. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
79. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP029986 (Sphingomonas sp. FARSPH plasmid p01, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcagcgccgaacagcatggcgtcg Protospacer
*.*******************.*
80. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
81. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
82. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
83. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
84. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
85. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
86. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
87. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
88. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
89. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
90. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgccgatcagcatggcggcg Protospacer
********** ********** .*
91. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
92. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
93. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
94. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
95. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
96. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP031228 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pPla107-2) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgctgaacagcatgccgttg Protospacer
******.********** *****
97. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
98. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
99. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
100. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
101. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
102. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacaggatggcgtcg Protospacer
************* *******.*
103. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
104. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacaggatggcgtcg Protospacer
************* *******.*
105. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
106. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
107. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP044960 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.3, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcagaacagcatggcggtt Protospacer
******* ************* *
108. spacer 2.6|335718|24|NC_021740|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
109. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
110. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
111. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
112. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
113. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052880 (Escherichia coli strain C21 plasmid pC21-3, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcagaacagcatggcggtt Protospacer
******* ************* *
114. spacer 2.6|335718|24|NC_021740|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgccggacagcatggcgagg Protospacer
*********.*********** *
115. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP044333 (Methylocystis parvus strain BRCS2 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgccgaacaggatggcgatg Protospacer
************* ****** **
116. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
117. spacer 2.6|335718|24|NC_021740|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
118. spacer 2.6|335718|24|NC_021740|CRT matches to NC_014626 (Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgccgagcagcatggcgctg Protospacer
*********.**********.**
119. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
120. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP019215 (Escherichia coli strain WCHEC050613 plasmid pI_050613, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcagaacagcatggcggtt Protospacer
******* ************* *
121. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
122. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
123. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
124. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
125. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
126. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
127. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
128. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
129. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
130. spacer 2.6|335718|24|NC_021740|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
131. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
132. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
133. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
134. spacer 2.6|335718|24|NC_021740|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
135. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
136. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_LN890525 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcagaacagcatggcggtt Protospacer
******* ************* *
137. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
138. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
139. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
140. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
141. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
142. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
143. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_LT963412 (Pseudomonas syringae isolate CFBP3840 plasmid PP3, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgctgaacagcatgccgttg Protospacer
******.********** *****
144. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
145. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
146. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
147. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
148. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
149. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
150. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
151. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
152. spacer 2.6|335718|24|NC_021740|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcggcgaacagcatggcgatc Protospacer
****** ************** *
153. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
154. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
155. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
156. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
157. spacer 2.6|335718|24|NC_021740|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
158. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
159. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
160. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
161. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
162. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
163. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
164. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
165. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
166. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
167. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP047261 (Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326F, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgctgaacagcatgccgttg Protospacer
******.********** *****
168. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
169. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ttgagccagccggcgccgccgttc Protospacer
****** ***************
170. spacer 2.8|335814|24|NC_021740|CRT matches to MN010758 (Gordonia phage Dardanus, complete genome) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtgaacccgccggcgccgccgttc Protospacer
.***.******************
171. spacer 2.8|335814|24|NC_021740|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
172. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
173. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP044330 (Methylocystis rosea strain BRCS1 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgacgccgccggcgccgccgttg Protospacer
*** ******************
174. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
atcagcccgccggcgccgccgaag Protospacer
** ****************** *
175. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
176. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
177. spacer 2.8|335814|24|NC_021740|CRT matches to MT740732 (Ralstonia phage Darius, complete genome) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgagcccgccggcgccgccatag Protospacer
*******************.* *
178. spacer 2.8|335814|24|NC_021740|CRT matches to MH638294 (Ralstonia phage GP4, complete genome) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgagcccgccggcgccgccatag Protospacer
*******************.* *
179. spacer 2.8|335814|24|NC_021740|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
180. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP025550 (Mycobacterium paragordonae strain 49061 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
atgagcccgccagcgccgccgcgg Protospacer
***********.*********. *
181. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP034088 (Methylocystis rosea strain GW6 plasmid pGW6_2, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgacgccgccggcgccgccgttg Protospacer
*** ******************
182. spacer 2.8|335814|24|NC_021740|CRT matches to MT740740 (Ralstonia phage Gervaise, complete genome) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgagcccgccggcgccgccatag Protospacer
*******************.* *
183. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgacctcggcggcgcgggcga Protospacer
.***************** ****.
184. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctgggcggcgctggcgg Protospacer
****.*** **************
185. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
186. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
agccgacctcggcggcgatggcgc Protospacer
*.*************** *****
187. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
188. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
189. spacer 6.16|926014|24|NC_021740|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
190. spacer 6.16|926014|24|NC_021740|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
191. spacer 6.16|926014|24|NC_021740|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
192. spacer 6.16|926014|24|NC_021740|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
193. spacer 6.16|926014|24|NC_021740|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
194. spacer 6.16|926014|24|NC_021740|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
195. spacer 6.16|926014|24|NC_021740|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aaccggcctcggcggcgctgccgc Protospacer
*****.************** **
196. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccgagctcggcggcgctgccgg Protospacer
***** ************* ***
197. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctcggcggcgcgggcgg Protospacer
****.************ *****
198. spacer 6.16|926014|24|NC_021740|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aacccacctcggcggcgatggcgc Protospacer
**** ************ *****
199. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 3, identity: 0.88
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgcgggcggcctcggcgtagcgctt Protospacer
*** *******************..
200. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 3, identity: 0.88
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgcgggcggcctcggcgtagcgctt Protospacer
*** *******************..
201. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtgag Protospacer
.*******************
202. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
gtgcggcggtgccggcggtgtc Protospacer
*******************
203. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
gtgcggcggtgccggcggtgtc Protospacer
*******************
204. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtgag Protospacer
.*******************
205. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtggt Protospacer
.******************* .
206. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
catcggcggtgccggcggtgtg Protospacer
..*******************
207. spacer 8.11|1211165|22|NC_021740|CRISPRCasFinder matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.864
gctgtggggcggcggtggtgcc CRISPR spacer
cgtgtggggcggcggtggtgca Protospacer
*******************
208. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgcgg Protospacer
******************* .
209. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
ttcgccgatcaggccggcggtg Protospacer
*******************..
210. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
ctcgccgaacacgcggaagccgtct Protospacer
**.*********** *********
211. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
attgtcgaacacgcggaagccgtcg Protospacer
***.********* **********
212. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
213. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
214. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
215. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
catgcggaacacgccgaatccgtcg Protospacer
* *** ************ ******
216. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgatcacgccgtagccgttg Protospacer
******** ******* ******.*
217. spacer 9.15|1570502|22|NC_021740|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864
caatccggcggcgccgccggca CRISPR spacer
gaatccggcggcgccgccgggc Protospacer
*******************
218. spacer 11.5|2083080|24|NC_021740|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
219. spacer 11.5|2083080|24|NC_021740|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
220. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_023695 (Mycobacterium phage Violet, complete genome) position: , mismatch: 3, identity: 0.889
caccggcggcaaaggcggcatgggcgg CRISPR spacer
taccggcggcaaaggcggcaacggcgg Protospacer
.******************* *****
221. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 3, identity: 0.889
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cctcggcggcaaaggcggcattggcgg Protospacer
* .****************** *****
222. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_LR134449 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 7, complete sequence) position: , mismatch: 4, identity: 0.852
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccggcgaagagcaggccggcggcg Protospacer
*** ** ***************** .*
223. spacer 2.4|335619|27|NC_021740|CRT matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 4, identity: 0.852
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcggcgccgaggagccggccggcgacg Protospacer
**********.**** ******** .*
224. spacer 2.4|335619|27|NC_021740|CRT matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 4, identity: 0.852
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcggcgccgaggagccggccggcggtc Protospacer
**********.**** ******** *
225. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
gcggcgccgaagagcaggccggcgttg CRISPR spacer
acggcgcagaagagcgggccggcgtgg Protospacer
.****** *******.********* *
226. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gccgcgccgaagagcagggcggcactg Protospacer
** *************** ****..**
227. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP046258 (Gordonia sp. 135 plasmid pG135, complete sequence) position: , mismatch: 4, identity: 0.852
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gagacgccgaagaacgggccggcgttg Protospacer
* *.*********.*.***********
228. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
229. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
230. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
231. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
232. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgccgaacagcatcgcgaac Protospacer
***************** ***
233. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
234. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
235. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
236. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
237. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
238. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
239. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
240. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
241. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
242. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
243. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
244. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
245. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
246. spacer 2.6|335718|24|NC_021740|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
247. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.833
atgagcccgccggcgccgccgttg CRISPR spacer
tcgagcccgccggcgccgccattc Protospacer
.******************.**
248. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
atgagcccgccggcgccgccgttg CRISPR spacer
tccagcccgccggcgccggcgttg Protospacer
. *************** *****
249. spacer 3.1|366505|27|NC_021740|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
250. spacer 3.1|366505|27|NC_021740|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
251. spacer 3.7|366901|27|NC_021740|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
252. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
253. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
254. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.867
accacgccggtgaccacgccg-ccaacgacg CRISPR spacer
accacgccggtggccacgccgaccagcggc- Protospacer
************.******** ***.**.*
255. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010326 (Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggctgggctggcggggatat Protospacer
********** ************* .
256. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP021045 (Phaeobacter gallaeciensis strain P129 plasmid pP129_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
257. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010678 (Phaeobacter gallaeciensis strain P75 plasmid pP75_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
258. spacer 6.6|925573|27|NC_021740|CRT matches to NC_023142 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
259. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010789 (Phaeobacter gallaeciensis strain P63 plasmid pP63_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
260. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010642 (Phaeobacter gallaeciensis strain P73 plasmid pP73_f, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
261. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010593 (Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
262. spacer 6.6|925573|27|NC_021740|CRT matches to AM419438 (Archaeal BJ1 virus complete genome) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcggcggcgggggtggcgggggcgg Protospacer
****.********* ********. **
263. spacer 6.6|925573|27|NC_021740|CRT matches to NC_008695 (Archaeal BJ1 virus, complete genome) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcggcggcgggggtggcgggggcgg Protospacer
****.********* ********. **
264. spacer 6.10|925729|27|NC_021740|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgcatccggcggcggcggttgcgttct Protospacer
** **************** ***** .
265. spacer 6.10|925729|27|NC_021740|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggcctcggcggcggcggtggcgttgc Protospacer
*** ..*************.*******
266. spacer 6.10|925729|27|NC_021740|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggccgcggcggcggcggtagcggtgc Protospacer
*** . ***************** ***
267. spacer 6.15|925966|30|NC_021740|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc Protospacer
************ ********* ***.**
268. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
269. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
gcccgatctcggcggcgctggcgt Protospacer
. ****.****************
270. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
271. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgtcgacgtcggcggcgctggcgg Protospacer
..**** ****************
272. spacer 6.16|926014|24|NC_021740|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cttcgacttcggcggcgctggcgg Protospacer
.****.****************
273. spacer 6.16|926014|24|NC_021740|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
274. spacer 6.16|926014|24|NC_021740|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
275. spacer 6.16|926014|24|NC_021740|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
276. spacer 6.16|926014|24|NC_021740|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
277. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgccgacctcggcggcggtggcga Protospacer
.*************** *****.
278. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
279. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
280. spacer 6.16|926014|24|NC_021740|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tctcgacctcggcggcgatggcgg Protospacer
.************** ******
281. spacer 6.16|926014|24|NC_021740|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tgccgacctcggctgcgctggcgc Protospacer
.*********** *********
282. spacer 6.16|926014|24|NC_021740|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ggtcgacctcgacggcgctggcgg Protospacer
...********.************
283. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggcggcctcggcggagcgctg Protospacer
**************** *****.
284. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggcggcctcggcggagcgctg Protospacer
**************** *****.
285. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
286. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to CP003956 (Rhodococcus opacus PD630 plasmid 7, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
gtccggcggccttggcgtagcgcct Protospacer
**********.***********.
287. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
288. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggccccggcgtcgcgcga Protospacer
***********.****** ****
289. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtaatggtc Protospacer
*******************..* .*
290. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggcatcggcgtagcggcg Protospacer
.********* *********** *
291. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggcctccgcgtcgcgcct Protospacer
.************ **** *****.
292. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgtcggcggcctcggcgtagcgggc Protospacer
.*.******************* *
293. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NC_022437 (Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggccgcgtcgtagcgcca Protospacer
.********** ** *********
294. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
295. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggtgtcctcggcgtagcgcga Protospacer
******.* **************
296. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctccgcgaagcgctt Protospacer
************* *** *****..
297. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggctgcctcggcatagcgccg Protospacer
****** ********.*******
298. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
299. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggtggcctcggcgtagccccg Protospacer
.*****.************** **
300. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctccgcgaagcgctt Protospacer
************* *** *****..
301. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tggcggcggcctcgccgtagcgctt Protospacer
** *********** ********..
302. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgtcggcggcctcggcgtagcggac Protospacer
.*.******************* *
303. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
agccggcggcctcggcctcgcgccg Protospacer
*************** * *****
304. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
305. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
306. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
307. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
308. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
tccgccgaacgcgccgaagccgtcg Protospacer
...*******.**************
309. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
310. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
311. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
312. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
313. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
314. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacacgccgatgccctgc Protospacer
***************** *** *
315. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
aatgccgaattcgccgaagccgtcg Protospacer
*******. **************
316. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cccgtagaacacgccgaagccgtcg Protospacer
*..*. *******************
317. spacer 9.14|1570445|25|NC_021740|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgccaccgacccccccttgc CRISPR spacer
ttttccgacaccgacccccccttga Protospacer
.** *** ****************
318. spacer 11.5|2083080|24|NC_021740|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
319. spacer 11.5|2083080|24|NC_021740|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
320. spacer 11.5|2083080|24|NC_021740|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
321. spacer 16.18|3929481|27|NC_021740|CRT matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cccgggcggcaagggcggcaagggcgg Protospacer
* * ********.******* ******
322. spacer 16.18|3929481|27|NC_021740|CRT matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cccgggcggcaagggcggcaagggcgg Protospacer
* * ********.******* ******
323. spacer 16.18|3929481|27|NC_021740|CRT matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cccgggcggcaagggcggcaagggcgg Protospacer
* * ********.******* ******
324. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cccgggcggcaagggcggcaagggcgg Protospacer
* * ********.******* ******
325. spacer 16.18|3929481|27|NC_021740|CRT matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cccgggcggcaagggcggcaagggcgg Protospacer
* * ********.******* ******
326. spacer 16.18|3929481|27|NC_021740|CRT matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cccgggcggcaagggcggcaagggcgg Protospacer
* * ********.******* ******
327. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
acccggcggcaaaggcgcaatgggcgg Protospacer
*************** ********
328. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP041048 (Citrobacter sp. CF971 plasmid pBM527-2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
329. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KX832927 (Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
330. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KX786648 (Enterobacter cloacae strain B557 plasmid pB557-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
331. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KY399975 (Enterobacter cloacae strain EClY2403 plasmid pNDM1_EClY2403, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
332. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KY399974 (Enterobacter cloacae strain EClY2402 plasmid pNDM1_EClY2402, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
333. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP053895 (Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
334. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_AP023051 (Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
335. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP034756 (Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
336. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
337. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KU302802 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
338. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KU302801 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
339. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KJ588779 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US-2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
340. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KR351290 (Klebsiella pneumoniae subsp. pneumoniae strain K351 plasmid pK351, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
341. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KJ802405 (Providencia stuartii isolate GN576 plasmid pNDM-PstGN576, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
342. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KJ812998 (Enterobacter cloacae isolate GN574 plasmid pNDM-Ec1GN574, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
343. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KP900016 (Leclercia adecarboxylata strain P10164 plasmid pP10164-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
344. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KP765744 (Enterobacter cloacae strain ECN49 plasmid pNDM-ECN49, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
345. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KP868647 (Enterobacter cloacae strain WCHECl-14653 plasmid pNDM1_EC14653, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
346. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KJ802404 (Escherichia coli isolate GN568 plasmid pNDM-EcoGN568, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
347. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KT965092 (Acinetobacter towneri strain G165 plasmid pNDM-GJ01, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
348. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KT965093 (Acinetobacter towneri strain G295 plasmid pNDM-GJ02, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
349. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_023322 (Acinetobacter bereziniae strain CHI-40-1 plasmid pNDM-40-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
350. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP029731 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
351. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KC887916 (Escherichia coli strain ARL10/167 isolate EC4 plasmid pEC4-NDM-6, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
352. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KC887917 (Enterobacter cloacae isolate ECL3 plasmid pECL3-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
353. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP020524 (Escherichia coli strain 190 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
354. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP010370 (Acinetobacter nosocomialis strain 6411 plasmid p6411-9.012kb, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
355. spacer 16.18|3929481|27|NC_021740|CRT matches to MN061454 (Enterobacter cloacae strain EC-14-60 plasmid pECL-14-60-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
356. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP032278 (Acinetobacter sp. WCHAc010034 plasmid pNDM1_010034, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
357. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP045561 (Acinetobacter nosocomialis strain AC1530 plasmid pAC1530, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
358. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019045 (Escherichia coli strain N10-2337 plasmid pNDM102337, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
359. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_025130 (Raoultella planticola strain RJA274 plasmid NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
360. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019158 (Klebsiella pneumoniae plasmid pNDM10469, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
361. spacer 16.18|3929481|27|NC_021740|CRT matches to MN310375 (Klebsiella quasipneumoniae strain QD1501 plasmid pQD1501-Ct1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
362. spacer 16.18|3929481|27|NC_021740|CRT matches to MN310377 (Klebsiella pneumoniae strain 12085 plasmid p12085-Ct1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
363. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
364. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
365. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP037965 (Klebsiella pneumoniae strain SCKP020135 plasmid pNDM1_020135, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
366. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_025184 (Klebsiella pneumoniae strain RJF866 plasmid pRJF866, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
367. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcgg-catgggcgg CRISPR spacer
caccggcggcaaaggcggccatcgaca- Protospacer
****************** *** *.*.
368. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcagaggcggcaagggcgg Protospacer
*. ********.******** ******
369. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
370. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP021962 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000008, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
371. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP022350 (Klebsiella michiganensis strain K516 plasmid pK516_NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
372. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP046274 (Enterobacter hormaechei strain E70 plasmid pE70-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
373. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP039811 (Klebsiella pneumoniae strain C2660 plasmid pC2660-4-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
374. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cctcggccgcaaaggcggcattggcgg Protospacer
* .**** ************* *****
375. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_025000 (Acinetobacter lwoffii strain Iz4b plasmid pNDM-Iz4b, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
376. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_024959 (Acinetobacter calcoaceticus strain NDM-WS2 plasmid pNDM-WS2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
377. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gatcggcggcaagggcggcatggccgg Protospacer
*.*********.********** ***
378. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP021536 (Escherichia coli strain AR_0119 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
379. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP010399 (Acinetobacter baumannii strain 6200 plasmid p6200-47.274kb, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
380. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP035935 (Acinetobacter cumulans strain WCHAc060092 plasmid pNDM1_060092, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
381. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP006661 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
382. spacer 16.18|3929481|27|NC_021740|CRT matches to CP050164 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
383. spacer 16.18|3929481|27|NC_021740|CRT matches to MK933278 (Enterobacter hormaechei strain SCNJ07 plasmid pNDM-SCNJ07, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
384. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
385. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019069 (Escherichia coli plasmid pNDM10505, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
386. spacer 16.18|3929481|27|NC_021740|CRT matches to AMXH01000087 (Acinetobacter pittii strain XM1570 plasmid pXM1, complete sequence, whole genome shotgun sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
387. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_JQ739158 (Acinetobacter lwoffii strain ABZ78 plasmid pABZ78, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
388. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP043383 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
389. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019985 (Acinetobacter baumannii ZW85-1 plasmid pAbNDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
390. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
391. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP018366 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
392. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP023187 (Klebsiella michiganensis strain K518 plasmid pK518_NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
393. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP028786 (Klebsiella pneumoniae strain SCKP020049 plasmid pNDM1_020049, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
394. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP021936 (Escherichia coli strain AR_0055 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
395. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
396. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
397. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP041938 (Klebsiella pneumoniae strain KP14003 plasmid pNDM-KP14003, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
398. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_022589 (Providencia rettgeri strain 09ACRGNY2001 plasmid pPrY2001, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
399. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP015835 (Escherichia coli strain MS6198 plasmid pMS6198A, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
400. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
401. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP014478 (Acinetobacter pittii strain AP_882 plasmid pNDM-AP_882, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
402. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_023908 (Klebsiella pneumoniae strain KP1 plasmid pKP1-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
403. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
404. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019268 (Acinetobacter lwoffii plasmid pNDM-BJ01, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
405. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019281 (Acinetobacter lwoffii plasmid pNDM-BJ02, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
406. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_025116 (Acinetobacter sp. M131 plasmid pM131_NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
407. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP040884 (Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
408. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP026015 (Klebsiella variicola strain 13450 plasmid p13450-3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
409. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_AP018143 (Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
410. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cctcggccgcaaaggcggcattggcgg Protospacer
* .**** ************* *****
411. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP048797 (Providencia vermicola strain P8538 plasmid p8538-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
412. spacer 16.18|3929481|27|NC_021740|CRT matches to MN937240 (Enterobacter cloacae strain BSI034 plasmid pBSI034-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
413. spacer 16.18|3929481|27|NC_021740|CRT matches to MN603981 (Klebsiella aerogenes strain 1564 plasmid p1564, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
414. spacer 16.18|3929481|27|NC_021740|CRT matches to MN604268 (Escherichia coli strain J53 plasmid pJ53_SAL-19-0623_NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
415. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_LN833432 (Acinetobacter baumannii isolate CHI-32 plasmid pNDM-32, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
416. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MK123268 (Serratia marcescens strain M17468 plasmid pSMA17468, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
417. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP053897 (Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
418. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP032132 (Acinetobacter chinensis strain WCHAc010005 plasmid pNDM1_010005, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
419. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH995508 (Enterobacter cloacae strain ECL17464 plasmid pECL17464, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
420. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH995506 (Citrobacter freundii strain CFR17394 plasmid pCFR17394, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
421. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH917283 (Klebsiella pneumoniae strain A575 plasmid pA575-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
422. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH909345 (Klebsiella pneumoniae strain N201205880 plasmid p205880-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
423. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH105050 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncA/C-IncX3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
424. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH909343 (Klebsiella pneumoniae strain 1012018 plasmid p12018-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
425. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH909347 (Klebsiella pneumoniae strain 362713 plasmid p362713-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
426. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH263652 (Providencia rettgeri strain QD51 plasmid pNDM-QD51, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
427. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH917281 (Klebsiella pneumoniae strain 14504 plasmid p14504-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
428. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MK101346 (Citrobacter freundii strain CRE3 plasmid pCRE7-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
429. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MK757441 (Alcaligenes faecalis strain AN70 plasmid pAN70-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
430. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP020090 (Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
431. spacer 16.18|3929481|27|NC_021740|CRT matches to MN657245 (Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
432. spacer 16.18|3929481|27|NC_021740|CRT matches to MN657246 (Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
433. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF344560 (Enterobacter hormaechei strain 128379 plasmid p128379-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
434. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MG462729 (Escherichia coli strain AMA1742 plasmid pAMA1742, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
435. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP035537 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
436. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
437. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
438. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
439. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KX470734 (Escherichia coli strain Ecoli14-55 plasmid pEC55-NDM4, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
440. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KY296103 (Enterobacter cloacae strain 13E169 plasmid pHN84NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
441. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KY978629 (Cronobacter sakazakii strain 505108 plasmid p505108-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
442. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF072961 (Citrobacter freundii strain P10159 plasmid pP10159-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
443. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF042356 (Enterobacter cloacae strain 20ES plasmid pNDM_20ES, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
444. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF042359 (Serratia marcescens strain 7209 plasmid pNDM_7209, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
445. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KU726616 (Salmonella enterica subsp. enterica serovar Stanley strain LS001 plasmid pHS36-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
446. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KU314941 (Klebsiella pneumoniae isolate KP04 plasmid pKP04NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
447. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KX094555 (Escherichia coli strain ZHDC33 plasmid pZHDC33, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
448. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KR059864 (Klebsiella pneumoniae strain KP-YQ13450 plasmid pYQ12450, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
449. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KP987216 (Citrobacter freundii strain 112298 plasmid p112298-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
450. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP022126 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752AC2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
451. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
452. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
453. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
454. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP028588 (Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
455. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP041930 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
456. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP028560 (Acinetobacter sp. WCHA45 plasmid pNDM1_010045, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
457. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_018994 (Escherichia coli plasmid pNDM-1_Dok01, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
458. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
459. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019153 (Klebsiella pneumoniae plasmid pNDM-KN, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
460. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019162 (Klebsiella pneumoniae strain CRE380 plasmid pNDM-HN380, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
461. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP032878 (Escherichia coli strain WCHEC000837 plasmid pNDM4_000837, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
462. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP018817 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
463. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cctcggccgcaaaggcggcattggcgg Protospacer
* .**** ************* *****
464. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cctcggccgcaaaggcggcattggcgg Protospacer
* .**** ************* *****
465. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
466. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP048828 (Acinetobacter baumannii strain ABF9692 plasmid pABF9692, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
467. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP021206 (Escherichia coli strain Z1002 plasmid p1002-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
468. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP050416 (Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
469. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP032284 (Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
470. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_020811 (Klebsiella pneumoniae strain KPN5047 plasmid pKPN5047, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
471. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP050426 (Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
472. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_023914 (Enterobacter cloacae strain CRE727 plasmid pNDM-HF727, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
473. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP044035 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
474. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP029118 (Escherichia coli strain AR435 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
475. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
476. spacer 16.18|3929481|27|NC_021740|CRT matches to MN178638 (Kluyvera cryocrescens strain SCW13 plasmid pNDM1_SCW13, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
477. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP038280 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
478. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
479. spacer 16.18|3929481|27|NC_021740|CRT matches to CP050158 (Enterobacter cloacae plasmid Carbapenemase(NDM-1)_IncX3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
480. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
481. spacer 16.18|3929481|27|NC_021740|CRT matches to CP050161 (Escherichia coli plasmid Carbapenemase(NDM-1)_IncX3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
482. spacer 16.18|3929481|27|NC_021740|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
483. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_021501 (Klebsiella michiganensis E718 plasmid pKOX_NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
484. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP017672 (Providencia rettgeri strain RB151 plasmid pRB151-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
485. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP023914 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
486. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP029386 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pNDM6_040074, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
487. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP022226 (Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
488. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
489. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_020552 (Citrobacter freundii plasmid pYE315203, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
490. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP040598 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15_NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
491. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP014297 (Klebsiella pneumoniae strain KP38731 plasmid unnamed13 sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
492. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP020056 (Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
493. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP031884 (Klebsiella pneumoniae strain WCHKP095845 plasmid pNDM1_095845, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
494. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP031297 (Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
495. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP041229 (Acinetobacter haemolyticus strain AN54 plasmid pAhaeAN54e, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
496. spacer 16.18|3929481|27|NC_021740|CRT matches to MN604267 (Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
497. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MK372385 (Morganella morganii strain ABC140 plasmid pABC140-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
498. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MK372381 (Klebsiella pneumoniae strain ABC52 plasmid pABC52-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
499. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP053899 (Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
500. spacer 16.18|3929481|27|NC_021740|CRT matches to MN657249 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
501. spacer 16.18|3929481|27|NC_021740|CRT matches to MN657250 (Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
502. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH909333 (Klebsiella pneumoniae strain 7-SP plasmid p7SP-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
503. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH909346 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
504. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH909335 (Klebsiella pneumoniae strain 11-SP plasmid p11SP-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
505. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH234505 (Escherichia coli strain CRE3694 plasmid pNDM-HK3694, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
506. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH917282 (Klebsiella pneumoniae strain A457 plasmid pA457-NDA, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
507. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH349095 (Escherichia coli strain 948 plasmid pMTC948, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
508. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MK372386 (Klebsiella pneumoniae strain BC700 plasmid pBC700-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
509. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MK372380 (Enterobacter cloacae strain ABC40 plasmid pABC40-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
510. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MK372382 (Escherichia coli strain ABC54 plasmid pABC54-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
511. spacer 16.18|3929481|27|NC_021740|CRT matches to MN657241 (Enterobacteriaceae bacterium strain 20-16 plasmid pCF104a-T3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
512. spacer 16.18|3929481|27|NC_021740|CRT matches to MN657242 (Enterobacteriaceae bacterium strain 128-16 plasmid pEC405a-T3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
513. spacer 16.18|3929481|27|NC_021740|CRT matches to MN657243 (Enterobacteriaceae bacterium strain 24-16 plasmid pEC744-T5, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
514. spacer 16.18|3929481|27|NC_021740|CRT matches to MN657244 (Enterobacteriaceae bacterium strain 690-16 plasmid pEC6332-T3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
515. spacer 16.18|3929481|27|NC_021740|CRT matches to MN657247 (Enterobacteriaceae bacterium strain 460-16 plasmid pECl-T3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
516. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
517. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH457126 (Vibrio alginolyticus strain Vb1394 plasmid pC1394, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
518. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH105052 (Escherichia coli strain EC600 plasmid pSL131T_IncX3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
519. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP044464 (Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
520. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF042350 (Klebsiella pneumoniae strain 18ES plasmid pNDM_18ES, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
521. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF042354 (Klebsiella pneumoniae strain 6TM plasmid pNDM_6TM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
522. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF042353 (Klebsiella pneumoniae strain 1TM plasmid pNDM_1TM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
523. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF042351 (Serratia marcescens strain 12TM plasmid pNDM_12TM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
524. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF042358 (Enterobacter cloacae strain 22ES plasmid pNDM_22ES, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
525. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF415608 (Enterobacter cloacae strain hhy03 plasmid pNDM-BJ03, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
526. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF042352 (Serratia marcescens strain 4TM plasmid pNDM_4TM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
527. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF042357 (Serratia marcescens strain 9580 plasmid pNDM_9580, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
528. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MG252893 (Raoultella ornithinolytica strain pRor-30818cz plasmid Ror-30818cz, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
529. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ctcaggcggcaaaggcggcagcggcgg Protospacer
* * **************** *****
530. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cgcgggcggcacagccggcatgggcgg Protospacer
*.* ******* ** ************
531. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ctcaggcggcaaaggcggcagcggcgg Protospacer
* * **************** *****
532. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ctcaggcggcaaaggcggcagcggcgg Protospacer
* * **************** *****
533. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cgcgggcggcaacggcggcaggggcgg Protospacer
*.* ******** ******* ******
534. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
catgggcggcatgggcggcatgggcgg Protospacer
**. ******* .**************
535. spacer 16.18|3929481|27|NC_021740|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
catgggcggcatgggcggcatgggcgg Protospacer
**. ******* .**************
536. spacer 16.18|3929481|27|NC_021740|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
catgggcggcatgggcggcatgggcgg Protospacer
**. ******* .**************
537. spacer 16.18|3929481|27|NC_021740|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
catgggcggcatgggcggcatgggcgg Protospacer
**. ******* .**************
538. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caagggcggcaagggcggcatcggcgg Protospacer
** ********.******** *****
539. spacer 2.4|335619|27|NC_021740|CRT matches to NC_014811 (Mycolicibacterium gilvum Spyr1 plasmid pMSPYR101, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
acggcgccgatgagcaggccggcgagc Protospacer
.********* *************
540. spacer 2.4|335619|27|NC_021740|CRT matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
attgcgccgaagagcaggccggagatg Protospacer
.. ******************* * **
541. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
attgcgccgaagagcaggccggagatg Protospacer
.. ******************* * **
542. spacer 2.4|335619|27|NC_021740|CRT matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgacgagcaggccggcgagc Protospacer
*** ****** *************
543. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP018865 (Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcggcgccgaagatcaggccggtgcgc Protospacer
************* ********.*.
544. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021796 (Sinorhizobium meliloti strain USDA1157 plasmid accessoryA, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
attgcgccgaagagcaggccggagatg Protospacer
.. ******************* * **
545. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcggcgccgcagcgcaggccggcggcc Protospacer
********* ** *********** .
546. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tcggcgccgaagaacaggcccgcgatc Protospacer
************.****** *** *
547. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
548. spacer 2.4|335619|27|NC_021740|CRT matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ccggcgccgatgagcaggccgccgacg Protospacer
********* ********** ** .*
549. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
550. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
551. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
552. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
553. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
554. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
555. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
556. spacer 2.4|335619|27|NC_021740|CRT matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
557. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
558. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
559. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
560. spacer 2.4|335619|27|NC_021740|CRT matches to KM659098 (Sinorhizobium sp. LM21 plasmid pLM21S1, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ctgtcgccgatgagcaggccggcgtgg Protospacer
.* ****** ************** *
561. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
562. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
563. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
564. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
565. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
566. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
567. spacer 2.4|335619|27|NC_021740|CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
atgtcgccgaagagcaggccggcttcg Protospacer
..* ******************* *.*
568. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
569. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
570. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP030829 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence) position: , mismatch: 5, identity: 0.792
ccggcgccgaacagcatggcgttg CRISPR spacer
atggcgccgaacagcatggcgcga Protospacer
.*******************. .
571. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 5, identity: 0.848
-ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gtcggcg-tgccgatgacgccggccgggccggat Protospacer
.***** .**** ************ *******
572. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 5, identity: 0.848
-ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gtcggcg-tgccgatgacgccggccgggccggat Protospacer
.***** .**** ************ *******
573. spacer 3.1|366505|27|NC_021740|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
574. spacer 3.1|366505|27|NC_021740|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
575. spacer 3.7|366901|27|NC_021740|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
576. spacer 3.7|366901|27|NC_021740|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
577. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
578. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
579. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
580. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
581. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
582. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
583. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
584. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
585. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
586. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
587. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
588. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
589. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
590. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
591. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
592. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
593. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
594. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
595. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
596. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
597. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
598. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
599. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
600. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
601. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
602. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
603. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
604. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
605. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
606. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
607. spacer 6.6|925573|27|NC_021740|CRT matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggctgggcaggcggggatat Protospacer
********** **** ******** .
608. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcaccggcggggctggcggcatcgg Protospacer
***** *************** . **
609. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP045223 (Achromobacter xylosoxidans strain DN002 plasmid unnamed) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
ccaaagcggcgagactggcggggaggg Protospacer
* *******.*.*************
610. spacer 6.6|925573|27|NC_021740|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
tgttcacggcggggctggcggggacgg Protospacer
.**. .****************** **
611. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cggcagcggcggggctggcggagccgc Protospacer
** ******************.* *
612. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cggcagcggcggggctggcggagccgc Protospacer
** ******************.* *
613. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
actcgccggcgcggctggcggggaggg Protospacer
**. ***** ***************
614. spacer 6.10|925729|27|NC_021740|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
615. spacer 6.10|925729|27|NC_021740|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
616. spacer 6.10|925729|27|NC_021740|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
617. spacer 6.10|925729|27|NC_021740|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
618. spacer 6.10|925729|27|NC_021740|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgggtccggcggcggcggtggcggttt Protospacer
***.***************.*** * .
619. spacer 6.10|925729|27|NC_021740|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgactccggcggcgggggtagcgttcg Protospacer
**. *********** *********
620. spacer 6.10|925729|27|NC_021740|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgccgccggcggcggcggtggcgttgg Protospacer
** **************.******
621. spacer 6.10|925729|27|NC_021740|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
622. spacer 6.10|925729|27|NC_021740|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
623. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgaggccggcctgctggtcgtctccgggct Protospacer
*** **************** ******
624. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agattccggcctgttcgtcggctccggcgg Protospacer
**. ********.* **************
625. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg Protospacer
** *..********** ***** *******
626. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg Protospacer
** ******************* * * **
627. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
cgacgccggcatgccggtcggcttcctgct- Protospacer
********** ***.******* *** **
628. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
629. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
630. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg Protospacer
*******.***** ********** ***
631. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctg--ttcggctccggcggcgctggcgg CRISPR spacer
--tactgattacggctccggcggtgctggcgg Protospacer
*.*** * ************.********
632. spacer 6.15|925966|30|NC_021740|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833
--cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg Protospacer
***.* *************** *.*****
633. spacer 6.16|926014|24|NC_021740|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792
aaccgacctcggcggcgctggcgg CRISPR spacer
gggcgacctcggcggcgctggcct Protospacer
.. *******************
634. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 5, identity: 0.853
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggcgacggcgggttcccc Protospacer
******************** ******** *.
635. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
gcgcggcggcctcggcgtagagccg Protospacer
***************** ***
636. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtggccgag Protospacer
******************.**
637. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
caccggcggcctcggcgtagcttgc Protospacer
..******************* . *
638. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NC_009469 (Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtggccgag Protospacer
******************.**
639. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gctgccgtgggtgccatcgttgccgagt Protospacer
*.***** *****************. .
640. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
641. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
642. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gttgccgcgggtgccctcgttgcggacg Protospacer
******* ******* ******* *.*
643. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gccgccgaacacgccgaagccgttt Protospacer
..********************.
644. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaacacgccgacgccgcgc Protospacer
**************** ****.
645. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
646. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
647. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
648. spacer 9.13|1570379|34|NC_021740|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853
gtcgccgtgcagccagccaccaccgcca-ccggcg CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc- Protospacer
*************.********* *** ** **
649. spacer 10.2|1634254|27|NC_021740|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 5, identity: 0.815
acctgcgttgaaggcctggttgccggg CRISPR spacer
aagagcgctgagggcctggttgccggg Protospacer
* ***.***.***************
650. spacer 10.2|1634254|27|NC_021740|CRT matches to NZ_CP030832 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750d, complete sequence) position: , mismatch: 5, identity: 0.815
acctgcgttgaaggcctggttgccggg CRISPR spacer
tgcggcgatgaaggccgggttgccggg Protospacer
* *** ******** **********
651. spacer 10.2|1634254|27|NC_021740|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 5, identity: 0.815
acctgcgttgaaggcctggttgccggg CRISPR spacer
aagagcgctgagggcctggttgccggg Protospacer
* ***.***.***************
652. spacer 15.7|3723528|31|NC_021740|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.839
aacgccc-acttcaccgccgttgccgccgtca CRISPR spacer
-acacccgacttcaccgccgctgccgccgaga Protospacer
**.*** ************.******** *
653. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaacggcggcatcgggca Protospacer
************ ******** ** .
654. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
655. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP053737 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
656. spacer 16.18|3929481|27|NC_021740|CRT matches to MT077883 (Escherichia coli plasmid p23, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
657. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
658. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP013221 (Salmonella enterica subsp. enterica serovar Anatum strain GT-01 plasmid PDM02, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
659. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP024285 (Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
660. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaacggcggcatcgggca Protospacer
************ ******** ** .
661. spacer 16.18|3929481|27|NC_021740|CRT matches to CP049307 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N58631 plasmid p58631, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
662. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_009140 (Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
663. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP012168 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-239.973kb, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
664. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcaaaggcggcaagagcgg Protospacer
. ***************** *.****
665. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_012690 (Escherichia coli plasmid peH4H, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
666. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcaaacgcggcctgggcgg Protospacer
. ********** ***** *******
667. spacer 16.18|3929481|27|NC_021740|CRT matches to CP048298 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-1, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
668. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019066 (Escherichia coli plasmid pAPEC1990_61, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
669. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_021813 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_01, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
670. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_012692 (Escherichia coli plasmid pAR060302, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
671. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaacggcggcatcgggca Protospacer
************ ******** ** .
672. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP037904 (Escherichia coli strain LHM10-1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
673. spacer 16.18|3929481|27|NC_021740|CRT matches to MK994522 (Methanobacterium virus PhiF1, complete genome) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
aggcggcggcaaaggcggcaagggagg Protospacer
. ***************** *** **
674. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP013224 (Salmonella enterica subsp. enterica serovar Anatum strain GT-38 plasmid PDM04, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
675. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP009413 (Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
676. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP048296 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
677. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gccgggccggaaaggcggcatgggcgg Protospacer
* *** * *****************
678. spacer 16.18|3929481|27|NC_021740|CRT matches to CP049311 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N53023 plasmid pN53023, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
679. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP030191 (Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
680. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019123 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH1148_107, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
681. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcaaaagcggcctgggcgg Protospacer
. **********.***** *******
682. spacer 16.18|3929481|27|NC_021740|CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tggcggcggcatgggcggcatgggcgg Protospacer
.. ******** .**************
683. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tgtcggcggcaatggcggcgtgggcgg Protospacer
...********* ******.*******
684. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaacggcggcatcgggca Protospacer
************ ******** ** .
685. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gaccggcggcaatggcggcattggcct Protospacer
*********** ******** ***
686. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
687. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
688. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_LT985293 (Escherichia coli strain 4410-1 plasmid RCS79_p, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
689. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_LT985268 (Escherichia coli strain 699 plasmid RCS58_p, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
690. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gaagggcggcaatggcggcatcggcgg Protospacer
* ******** ******** *****
691. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cgccggcggcaagggcggcacgggcct Protospacer
*.**********.*******.****
692. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gccgggccggaaaggcggcatgggcgg Protospacer
* *** * *****************
693. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gccgggcggcatgggcggcatgggcgg Protospacer
* ******* .**************
694. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcctggcggcatgggcggcatgggcgg Protospacer
*.******* .**************
695. spacer 16.18|3929481|27|NC_021740|CRT matches to JN698993 (Mycobacterium phage Firecracker, complete genome) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gatgggcggcaagggcggcaagggcgg Protospacer
*. ********.******* ******
696. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cgacggcggcgaaggcggcacgggcgc Protospacer
*. *******.*********.*****
697. spacer 16.18|3929481|27|NC_021740|CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tatgggcggcatgggcggcatgggcgg Protospacer
.*. ******* .**************
698. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gccgggccggaaaggcggcatgggcgg Protospacer
* *** * *****************
699. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcctggcggcatgggcggcatgggcgg Protospacer
*.******* .**************
700. spacer 2.4|335619|27|NC_021740|CRT matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcggcgccgacgagcaggcccgccagc Protospacer
********** ********* **
701. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
agtgcgccgaagagcagggcggcgtaa Protospacer
. *************** ****** .
702. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tcgccgccggagagcaggccggcgcgc Protospacer
** *****.**************.
703. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
acggcggcgatgagcaggccggcgacc Protospacer
.***** *** ************* .
704. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
705. spacer 2.4|335619|27|NC_021740|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
706. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
707. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ccggcgccgacgagcaggtcggcgacc Protospacer
********* *******.***** .
708. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
709. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcggcgacgaagagcaggccgtccgca Protospacer
****** ************** * ..
710. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ccggcgccgaagagcagggcggagaac Protospacer
***************** *** *
711. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcggcggcgaacagcaggccggccacc Protospacer
****** **** *********** .
712. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
713. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
acggcgccgatgagcaggccgccgaac Protospacer
.********* ********** **
714. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013108 (Sinorhizobium americanum strain CFNEI 73 plasmid A, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
agttcgccgaagagcacgccggcgatg Protospacer
. ************ ******* **
715. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
716. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
717. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
718. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
719. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
720. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
721. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
722. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
723. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
724. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
725. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
726. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
727. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
728. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP028919 (Gemmobacter sp. HYN0069 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tcggcgccgaagatcaggcgggcgact Protospacer
************ ***** **** .
729. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
730. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
731. spacer 2.4|335619|27|NC_021740|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
732. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
733. spacer 2.4|335619|27|NC_021740|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
734. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
735. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
736. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
737. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
738. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
739. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
740. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ccggcgccgaagagccgtccggcgcgc Protospacer
************** * ******.
741. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tcggcgccgaacatcaggccggcgcaa Protospacer
********** * **********. .
742. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
743. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
744. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
745. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
746. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
747. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
748. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ccggcggcgaacagcaggccggcgacc Protospacer
***** **** ************ .
749. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
750. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
751. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
752. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
753. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
754. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
755. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
756. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ccggcggcgaacagcaggccggcgacc Protospacer
***** **** ************ .
757. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
758. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
759. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
760. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
761. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
762. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
763. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
764. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
765. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
766. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
767. spacer 2.4|335619|27|NC_021740|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
768. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
769. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
770. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
771. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
772. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
773. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
774. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
775. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
776. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
777. spacer 2.4|335619|27|NC_021740|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
accgcgccgaagagaaggccggcgcgt Protospacer
.* *********** *********.
778. spacer 2.4|335619|27|NC_021740|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
accgcgccgaagagaaggccggcgcgt Protospacer
.* *********** *********.
779. spacer 2.4|335619|27|NC_021740|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
accgcgccgaagagaaggccggcgcgt Protospacer
.* *********** *********.
780. spacer 2.4|335619|27|NC_021740|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
accgcgccgaagagaaggccggcgcgt Protospacer
.* *********** *********.
781. spacer 2.4|335619|27|NC_021740|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
accgcgccgaagagaaggccggcgcgt Protospacer
.* *********** *********.
782. spacer 2.4|335619|27|NC_021740|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
accgcgccgaagagaaggccggcgcgt Protospacer
.* *********** *********.
783. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
784. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
785. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
786. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
acggcgccgatgagcaggcgggcgaca Protospacer
.********* ******** **** ..
787. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tcggcgccgaacatcaggccggcgcaa Protospacer
********** * **********. .
788. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
789. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
790. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
791. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
792. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcggcgccgaagaacagggcggccagc Protospacer
*************.**** ****
793. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
794. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcggcgccgtcgagcaggccggccgcc Protospacer
********* ************ .
795. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
796. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
atgtcgccgaagagcaggccggcttca Protospacer
..* ******************* *..
797. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ccggcggcgaacagcaggccggcgacc Protospacer
***** **** ************ .
798. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cttgcgccgaggagcaggccggcgctt Protospacer
. *******.*************.*
799. spacer 2.4|335619|27|NC_021740|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
800. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
801. spacer 2.4|335619|27|NC_021740|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
802. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ccggcggcgaacagcaggccggcgacc Protospacer
***** **** ************ .
803. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ctcgcgccgaggagcaggcgggcgttc Protospacer
. *******.******** ******
804. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ccggcgccgaagagcagggcggagaac Protospacer
***************** *** *
805. spacer 2.7|335763|30|NC_021740|CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 6, identity: 0.8
ccgatcccactgctggcgaccccgccagcg CRISPR spacer
ccggcgccactgctggcgtccacgccagcc Protospacer
***.. ************ ** *******
806. spacer 2.7|335763|30|NC_021740|CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 6, identity: 0.8
ccgatcccactgctggcgaccccgccagcg CRISPR spacer
ccggcgccactgctggcgtccacgccagcc Protospacer
***.. ************ ** *******
807. spacer 2.7|335763|30|NC_021740|CRT matches to KC292025 (Halovirus HHTV-1, complete genome) position: , mismatch: 6, identity: 0.8
ccgatcccactgctggcgaccccgccagcg-- CRISPR spacer
tcgatcccactgctggccaccctg--aacggc Protospacer
.**************** ****.* *.**
808. spacer 2.9|335859|33|NC_021740|CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 6, identity: 0.818
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gcgatgccgccgttgccgccggccccgccgggt Protospacer
**..********** ******** ******.*
809. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.818
ccggcgccgccgttgacgccggccgcg--ccggat CRISPR spacer
tccgcgccgccgtcgacgcccgccgcgacccgg-- Protospacer
.* **********.****** ****** ****
810. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 6, identity: 0.818
-ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gcaggcg-tgccgttgacgccggtcgcgcaggaa Protospacer
* **** .**************.***** ***
811. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 6, identity: 0.818
-ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gcaggcg-tgccgttgacgccggtcgcgcaggaa Protospacer
* **** .**************.***** ***
812. spacer 3.1|366505|27|NC_021740|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
813. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
814. spacer 3.7|366901|27|NC_021740|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
815. spacer 3.9|367051|27|NC_021740|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
816. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
817. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
818. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
819. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
820. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gcgccgccggtgactacgccgccagcgaca Protospacer
.* **********.*********.****.
821. spacer 4.2|631344|30|NC_021740|CRT matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
822. spacer 4.2|631344|30|NC_021740|CRT matches to NC_041891 (Propionibacterium phage B22, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
823. spacer 4.2|631344|30|NC_021740|CRT matches to NC_041894 (Propionibacterium phage E6, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
824. spacer 4.2|631344|30|NC_021740|CRT matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
825. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tccacgccggtgaccacgccgaccaccttg Protospacer
******************** * ** .*
826. spacer 4.2|631344|30|NC_021740|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
aagaggccggcgagcacgccgccaacgaag Protospacer
* * *****.** ************** *
827. spacer 4.2|631344|30|NC_021740|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
828. spacer 4.2|631344|30|NC_021740|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
829. spacer 4.2|631344|30|NC_021740|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
830. spacer 4.2|631344|30|NC_021740|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
831. spacer 4.2|631344|30|NC_021740|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
832. spacer 4.2|631344|30|NC_021740|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
833. spacer 4.2|631344|30|NC_021740|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
834. spacer 4.2|631344|30|NC_021740|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
835. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
836. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_LN907829 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
tgtaagcggctgggctggcggggatat Protospacer
.** ****** ************* .
837. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
tgtcagcggcggggctggcgttcatcg Protospacer
.******************* * *
838. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010826 (Thermus aquaticus Y51MC23 plasmid pTA78, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
tagaagcggcggggctggtggagaggg Protospacer
.. **************.**.*****
839. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
gcgcaccggcggggctggcggggcggc Protospacer
** ***************** **
840. spacer 6.10|925729|27|NC_021740|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggatcctgcggcggcggtagaaagcc Protospacer
******* ************* . *
841. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
842. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
843. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctggtggtcggctacctcga Protospacer
***** ******* ********* * **.
844. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
845. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
846. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
847. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
848. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
849. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac Protospacer
** ** ****************.****.
850. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
851. spacer 6.13|925870|30|NC_021740|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
852. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
853. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcg----gctccggcgg CRISPR spacer
cgacgccggccggctggtcggagagctgcg---- Protospacer
*********** ******** *** **
854. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
855. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
856. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg Protospacer
** *************.******.* * *
857. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
858. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
859. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
860. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
861. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
862. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
863. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
864. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
865. spacer 6.13|925870|30|NC_021740|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc Protospacer
** *..************** * ******
866. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccgacctgctggtcggggcggactg Protospacer
********.************ * *.* *
867. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
caagctggtcggccccggcggcgctggcaa Protospacer
* **** *****.**************..
868. spacer 6.15|925966|30|NC_021740|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tcacctgtccggctccggcggcggtggcga Protospacer
.* ****.************** *****.
869. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
870. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
871. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg-- CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg Protospacer
.************* ******** .**.*
872. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
873. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
874. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
875. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
876. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg Protospacer
* * .*.******.***************
877. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
878. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
879. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
880. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
881. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
882. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
883. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
884. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
885. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
886. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt--cggctccggcggcgctggcgg CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg Protospacer
.**.*.* **** ****************
887. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt----cggctccggcggcgctggcgg CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg Protospacer
* *** *************** *****
888. spacer 6.15|925966|30|NC_021740|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8
-cctgctgttcggctccggcggcgctggcgg CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg Protospacer
..** * ****** *.**************
889. spacer 6.17|926056|36|NC_021740|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 6, identity: 0.833
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgttgtcggcaacggcggtaacggcgggggtggcgg Protospacer
* .************************ .*****
890. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ggccggcggcaagggcggcgacggcggcgccggc-- Protospacer
************ ******* ***** * .***
891. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
caccggcggcaacggcggcggcggcggcttcggc-- Protospacer
.****************** ****** * ***
892. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
caccggcggcagcggcggcgccggcggcacggct- Protospacer
.*********.*************** ..****
893. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cggcggcggcaacggcggcgctggt-ggtggcaac Protospacer
* ******************.**. ****** *
894. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
895. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
896. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccggcggtgccatcggtgccgagg Protospacer
* ****** ********** *****.
897. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
898. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
899. spacer 9.13|1570379|34|NC_021740|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824
--gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca Protospacer
****.* ***** ******************.
900. spacer 10.2|1634254|27|NC_021740|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 6, identity: 0.778
acctgcgttgaaggcctggttgccggg CRISPR spacer
gcgcacgtcgaaggcctggttgccggc Protospacer
.* ..***.*****************
901. spacer 15.7|3723528|31|NC_021740|CRT matches to NC_009478 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence) position: , mismatch: 6, identity: 0.806
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgaccacttcaccgccgtcgccgccggcg Protospacer
. ** ***************.******* *.
902. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 6, identity: 0.818
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gagcagcgccaccggcggggccggcggcgactc Protospacer
*. .*** *****************.******
903. spacer 16.8|3928590|36|NC_021740|CRT matches to NZ_CP054842 (Acidovorax sp. 16-35-5 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.833
tagcagcggtgccggcggcaccaacggctccggcgg- CRISPR spacer
ccgcatcggtgccggcggcaccatcggc-acggcggc Protospacer
. *** ***************** **** ******
904. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggccaaggcggcatcggcgc Protospacer
. ******* ********** ****
905. spacer 16.18|3929481|27|NC_021740|CRT matches to CP047389 (Agrobacterium sp. CGMCC 11546 plasmid pA) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
taccggcggcaaaggcggcatccacct Protospacer
.******************** .*
906. spacer 16.18|3929481|27|NC_021740|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaaaggcggcaacctctt Protospacer
******************** *
907. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
908. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tgtgggcggcacaggcggcacgggcgg Protospacer
... ******* ********.******
909. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggccggcggcaatgtcggcatgggcac Protospacer
.********** * **********.
910. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcaaaggcggcgagggcga Protospacer
. ****************. *****.
911. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaggggcggcatggcgac Protospacer
***********..********** .
912. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
atccggcggcaccggcggcatgggcaa Protospacer
********* ************..
913. spacer 16.18|3929481|27|NC_021740|CRT matches to AY129335 (Mycobacterium virus Corndog, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
914. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_004685 (Mycobacterium phage Corndog, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
915. spacer 16.18|3929481|27|NC_021740|CRT matches to MG099943 (Mycobacterium phage Familton, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
916. spacer 16.18|3929481|27|NC_021740|CRT matches to MN585964 (Mycobacterium phage Blessica, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
917. spacer 16.18|3929481|27|NC_021740|CRT matches to KJ829260 (Mycobacterium phage YungJamal, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
918. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_022057 (Mycobacterium phage Catdawg, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
919. spacer 16.18|3929481|27|NC_021740|CRT matches to MN428052 (Mycobacterium phage Smooch, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
920. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tggtggcggcgcaggcggcatgggcgg Protospacer
.. .******. ***************
921. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcgagggcggcatggtgac Protospacer
**********.*.********** .
922. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_007713 (Sodalis glossinidius str. 'morsitans' plasmid pSG1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
923. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_014840 (Pantoea sp. At-9b plasmid pPAT9B03, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gatcgtcggcaaaggcggcatggggcc Protospacer
*.** ******************
924. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP032313 (Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcaaaggtggcatcggcga Protospacer
. ************.***** ****.
925. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_LN854558 (Sodalis glossinidius str. 'morsitans' isolate B4 plasmid pSG1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
926. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcgagggcggcatggtgac Protospacer
**********.*.********** .
927. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP013528 (Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cgccggcggcaagggcggcatggcgtc Protospacer
*.**********.**********
928. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tgccggcggcaaaggcggcatctgtgt Protospacer
..******************* *.*
929. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP033036 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13a, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaaaggcgacatccttga Protospacer
*****************.*** .*.
930. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gatcgtcggcaaaggcggcatggggcc Protospacer
*.** ******************
931. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP013581 (Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cgccggcggcaagggcggcatggcgtc Protospacer
*.**********.**********
932. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tggcggcggcgacggcggcatgggcgt Protospacer
.. *******.* *************
933. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_007182 (Sodalis glossinidius pSG1 plasmid from Glossina austeni) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
934. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_007183 (Sodalis glossinidius pSG1 plasmid from Glossina palpalis palpalis) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
935. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP053024 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-C-Sy, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcgagggcggcatggtgac Protospacer
**********.*.********** .
936. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_003064 (Agrobacterium fabrum str. C58 plasmid At, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaaaggcgacatccttga Protospacer
*****************.*** .*.
937. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_AP022338 (Mameliella alba strain KU6B plasmid pKUB257, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gacaggcggcaagggcggcatgggtca Protospacer
** ********.***********. .
938. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP021816 (Sinorhizobium meliloti strain M270 plasmid accessoryB, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg- CRISPR spacer
caccggcggcaaaggcggc-cgtctgac Protospacer
******************* .* .*.
939. spacer 16.18|3929481|27|NC_021740|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcgagggcggcatggtgac Protospacer
**********.*.********** .
940. spacer 16.18|3929481|27|NC_021740|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcgagggcggcatggtgac Protospacer
**********.*.********** .
941. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP033024 (Agrobacterium fabrum strain 1D132 plasmid pAt1D132a, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaaaggcgacatccttga Protospacer
*****************.*** .*.
942. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
943. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
944. spacer 2.4|335619|27|NC_021740|CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
attgcgccgaagagcaggccggagcct Protospacer
.. ******************* *..
945. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
946. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
947. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
948. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
949. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
950. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
951. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
952. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
953. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
attgcgccgaagagcaggccggagcct Protospacer
.. ******************* *..
954. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
attgcgccgaagagcaggccggagcct Protospacer
.. ******************* *..
955. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.788
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
cgggcgccgccgatgacgccggccgcgtggagc Protospacer
* ********** **************. *...
956. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttgacgccgccgttgccgccgcccgcgccgctt Protospacer
..*.*********** ***** ******** *
957. spacer 2.9|335859|33|NC_021740|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.788
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttgacgccgccgttgccgccgcccgcgccgctt Protospacer
..*.*********** ***** ******** *
958. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 7, identity: 0.788
ccggc--gccgccgttgacgccggccgcgccggat CRISPR spacer
--ggttggccgccgctgccgccggccgcgccgcct Protospacer
**. *******.** ************** *
959. spacer 3.4|366700|27|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
960. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
taggcgccggtgaccccgccgccgacgatg Protospacer
.*********** *******.****.*
961. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tgcgtggcggtgaccacgccgccaatggcg Protospacer
*..* ******************.*.**
962. spacer 4.2|631344|30|NC_021740|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atagcgccggtcaccgcgccgccaacgata Protospacer
*. .******* ***.************..
963. spacer 4.2|631344|30|NC_021740|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
964. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
965. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
966. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
967. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ccggcgccggtgaccgcgccgccaaggcag Protospacer
* .***********.********* * *
968. spacer 4.2|631344|30|NC_021740|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggcccgccgatggccacgccgccaacggca Protospacer
. * *****.**.**************.*.
969. spacer 4.2|631344|30|NC_021740|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gtcgaggcggtgaccacgccgccgccgacg Protospacer
..*. * ****************. *****
970. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
971. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
972. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
973. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
974. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
975. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
976. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
977. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
978. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
979. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
980. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
981. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
982. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
983. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
984. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
985. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
986. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010614 (Phaeobacter inhibens strain P92 plasmid pP92_d, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
987. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010626 (Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
988. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010671 (Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
989. spacer 6.6|925573|27|NC_021740|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggcgggggtggcggcacacc Protospacer
************** ****** . .
990. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010598 (Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
991. spacer 6.6|925573|27|NC_021740|CRT matches to NC_018288 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
992. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP031955 (Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
993. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP016368 (Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattggcggcggggctggcggggatct Protospacer
.*..*******************
994. spacer 6.6|925573|27|NC_021740|CRT matches to NC_018422 (Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
995. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggcgggggtggcggcacacc Protospacer
************** ****** . .
996. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggcgggggtggcggcacacc Protospacer
************** ****** . .
997. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010605 (Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
998. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010744 (Phaeobacter inhibens strain P59 plasmid pP59_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
999. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010622 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
1000. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010732 (Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
1001. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010655 (Phaeobacter inhibens strain P54 plasmid pP54_e, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
1002. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010711 (Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
1003. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010702 (Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
1004. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010748 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
1005. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010739 (Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
1006. spacer 6.13|925870|30|NC_021740|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc Protospacer
* ****************** *.***
1007. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1008. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1009. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
1010. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1011. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1012. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
1013. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1014. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1015. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1016. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1017. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1018. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1019. spacer 6.13|925870|30|NC_021740|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggaccggcccgctggtcggccccggctt Protospacer
**. .******.**********.*****
1020. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gctgggcggcctgctggtcggctggggcgg Protospacer
* ***************** *****
1021. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1022. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1023. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1024. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1025. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1026. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1027. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt Protospacer
************* ********.*. *
1028. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1029. spacer 6.13|925870|30|NC_021740|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1030. spacer 6.13|925870|30|NC_021740|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1031. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1032. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1033. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1034. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1035. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1036. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1037. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1038. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1039. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1040. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1041. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1042. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1043. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1044. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1045. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1046. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1047. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1048. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1049. spacer 6.13|925870|30|NC_021740|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1050. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1051. spacer 6.13|925870|30|NC_021740|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1052. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1053. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1054. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1055. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1056. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1057. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1058. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1059. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1060. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1061. spacer 6.13|925870|30|NC_021740|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1062. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1063. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1064. spacer 6.13|925870|30|NC_021740|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1065. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1066. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1067. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1068. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1069. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1070. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1071. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1072. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1073. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1074. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1075. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1076. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1077. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1078. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1079. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1080. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1081. spacer 6.13|925870|30|NC_021740|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1082. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1083. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1084. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1085. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1086. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1087. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1088. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1089. spacer 6.13|925870|30|NC_021740|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
acacgccgccctgctggtcggcttaggtcg Protospacer
****** **************. **. *
1090. spacer 6.13|925870|30|NC_021740|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc Protospacer
.****** **************. * **
1091. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agacgccggcctgctgttcggcctcgaccc Protospacer
*************** *****..**.*
1092. spacer 6.13|925870|30|NC_021740|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggctcggcctgctgctcggcttcggcga Protospacer
**. .********** ******.*****.
1093. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
gtcggccggcctgctggtcggcgcccggct- Protospacer
****************** .*****
1094. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctgctggtcgacttcatccc Protospacer
***** **************.**.*. *
1095. spacer 6.13|925870|30|NC_021740|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
1096. spacer 6.13|925870|30|NC_021740|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac Protospacer
** **************** *.****.
1097. spacer 6.13|925870|30|NC_021740|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga Protospacer
.******* ************* * **.
1098. spacer 6.13|925870|30|NC_021740|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
1099. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
1100. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
1101. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg Protospacer
*.. .*.*************** ******
1102. spacer 6.15|925966|30|NC_021740|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
1103. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
1104. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
1105. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
1106. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
1107. spacer 6.15|925966|30|NC_021740|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
1108. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
1109. spacer 6.15|925966|30|NC_021740|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
1110. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
1111. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
1112. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
1113. spacer 6.15|925966|30|NC_021740|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
actgctgtccggctccggcggca-tgatgtc Protospacer
*******.*************. **..*
1114. spacer 6.15|925966|30|NC_021740|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccggccttcgacttcggcggcgctggcgg Protospacer
*.* . ****.**.***************
1115. spacer 6.15|925966|30|NC_021740|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
1116. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gttcctccacggttccggcggcgctggcgg Protospacer
.* ** . ***.*****************
1117. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
1118. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
1119. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
1120. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
1121. spacer 6.17|926056|36|NC_021740|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 7, identity: 0.806
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgtgatcggcaacggcggaaacggcgggagctgggg Protospacer
**************** *********. * * **
1122. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
ggccggaggcaccggcggcgccggcggcacgggc- Protospacer
****** **** *************** ..** .
1123. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
gaccggcggcagcggcggcgcgggcggagccggc-- Protospacer
*.*********.********* *****. .***
1124. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
cgcaggcggcaacggcggccccggcggcgccgcc- Protospacer
** *************** ******* *. **.
1125. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta---- CRISPR spacer
ggccgggggcaacggcggcgacggc----gtctacgac Protospacer
****** ************* **** * ***
1126. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
1127. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
1128. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
tgtcggcggcagcggcggcggcggcggggccggc-- Protospacer
*.********.******** ******* .***
1129. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
ggccggcggcatcggcgacgccggctgcttcagc-- Protospacer
*********** *****.******* * * .**
1130. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
caccggcggccacggcggcaccggc-ggcggcgat Protospacer
.******** ********.***** **.*** *
1131. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP039641 (Azospirillum sp. TSH100 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggcggcaccggcggcggcggcggtgaggcc- Protospacer
.* ******** ******** ****** * ***.
1132. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1133. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1134. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1135. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1136. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1137. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1138. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1139. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1140. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1141. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1142. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggtggcagcggcggcgccggcggcggtgct- Protospacer
.* ***.****.*************** * ***
1143. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg-tggcta CRISPR spacer
ggtcggcgccaacggcggcgccggtgaactgggt- Protospacer
**.***** ***************.*.. *** *
1144. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
1145. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
tggcggcggcaacggcggcggtggc-ggtggcggt Protospacer
* ***************** .*** ****** .
1146. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
1147. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
tgctggcggcaacggcggcgtcggcatcgctggc-- Protospacer
**.****************.****. * ****
1148. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cgacggcggcaacggcggcggtggc-ggtggtcac Protospacer
* ***************** .*** *****..*
1149. spacer 8.9|1211066|37|NC_021740|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.811
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
tgtcggcggtgccggcggtgccggcggtgccggcgac Protospacer
******************..******* . ***.**
1150. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75
gttgccgggggtgccatcgttgccggcc CRISPR spacer
agcacccggggtgccgtcgttgccggcg Protospacer
. ..** ********.***********
1151. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc Protospacer
. * **** *********.**********
1152. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg Protospacer
**. ***.************ ******. *.
1153. spacer 10.2|1634254|27|NC_021740|CRT matches to NZ_CP048637 (Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.741
acctgcgttgaaggcctggttgccggg CRISPR spacer
cggcgcgtagaaggcctggttgccgcc Protospacer
.**** ****************
1154. spacer 11.3|2082990|30|NC_021740|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
1155. spacer 11.3|2082990|30|NC_021740|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
1156. spacer 11.3|2082990|30|NC_021740|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
1157. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
1158. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
1159. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atccgccatttcaccgccgttgccgacgccg Protospacer
* * ***.**************** **.*.
1160. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
caacggcggggccggcggtagcggcggcgcaggcgc Protospacer
**.************************ ** ..* .
1161. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cagcggcggggacggcggcagcggcggcgggctctt Protospacer
*********** ******.******** * ***
1162. spacer 16.3|3928209|36|NC_021740|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1163. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1164. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1165. spacer 16.3|3928209|36|NC_021740|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1166. spacer 16.3|3928209|36|NC_021740|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1167. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1168. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1169. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1170. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1171. spacer 16.5|3928353|33|NC_021740|CRT matches to CP006582 (Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence) position: , mismatch: 7, identity: 0.788
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcggcgc Protospacer
*****.****.************* . **.* *
1172. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
caacggcggggccggcggtagcggcggcgcaggcgc Protospacer
**.************************ ** ..* .
1173. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cagcggcggggacggcggcagcggcggcgggctctt Protospacer
*********** ******.******** * ***
1174. spacer 16.17|3929409|36|NC_021740|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1175. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1176. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1177. spacer 16.17|3929409|36|NC_021740|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1178. spacer 16.17|3929409|36|NC_021740|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1179. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1180. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1181. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1182. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1183. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 7, identity: 0.741
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcttctcggcaaaggcggcatgggcga Protospacer
.. ********************.
1184. spacer 2.9|335859|33|NC_021740|CRT matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccgtcgccgccgttgccgccggccgcgatcacc Protospacer
*** *********** *********** . . .
1185. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta Protospacer
********* ***** ******** * **
1186. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
caggcgccgccgtcgacgccggccgccatcgcc Protospacer
* ***********.************ . * .
1187. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta Protospacer
********* ***** ******** * **
1188. spacer 2.9|335859|33|NC_021740|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta Protospacer
********* ***** ******** * **
1189. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
caggcgccgccgtcgacgccggccgccatcgcc Protospacer
* ***********.************ . * .
1190. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
caggcgccgtcgttgacgccggacgcgttgccg Protospacer
* *******.************ ****..*
1191. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
acgaagccgccgttgccgccggccgcaccgccg Protospacer
**. ********** **********.***
1192. spacer 2.9|335859|33|NC_021740|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ggggagccgccgttgccgccggccgccgccgac Protospacer
** ********** ********** * **.
1193. spacer 2.9|335859|33|NC_021740|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccacccccgccgttggcgccgcccgcgccgccg Protospacer
**. * *********.***** ********
1194. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
acgaagccgccgtcgccgccggccgcgccgccg Protospacer
**. ********.* **************
1195. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
tgatcgccgccgtcgacgccgcccgcgccatat Protospacer
. . *********.******* *******. **
1196. spacer 2.9|335859|33|NC_021740|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccactgccggcgttgacgccgcccgcgccgccc Protospacer
**. .**** *********** ******** .
1197. spacer 2.9|335859|33|NC_021740|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccactgccggcgttgacgccgcccgcgccgccc Protospacer
**. .**** *********** ******** .
1198. spacer 2.9|335859|33|NC_021740|CRT matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcaccgccgttgccgccggccgtataggcc Protospacer
*****.********* *********... ** .
1199. spacer 2.9|335859|33|NC_021740|CRT matches to MK524485 (Mycobacterium phage MissDaisy, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ctcgcgccgccggtgacgcgggccgcgctgccg Protospacer
*. ********* ****** ********.*
1200. spacer 2.9|335859|33|NC_021740|CRT matches to MH926058 (Mycobacterium phage Reptar3000, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ctcgcgccgccggtgacgcgggccgcgctgccg Protospacer
*. ********* ****** ********.*
1201. spacer 2.9|335859|33|NC_021740|CRT matches to MK524488 (Mycobacterium phage Patt, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ctcgcgccgccggtgacgcgggccgcgctgccg Protospacer
*. ********* ****** ********.*
1202. spacer 2.9|335859|33|NC_021740|CRT matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcaccgccgttgccgccggccgtataggcc Protospacer
*****.********* *********... ** .
1203. spacer 2.9|335859|33|NC_021740|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccactgccggcgttgacgccgcccgcgccgccc Protospacer
**. .**** *********** ******** .
1204. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat---- CRISPR spacer
ccggcgccgccgttggcgccgac----ccgaactaca Protospacer
***************.*****.* ***.*.
1205. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gcggagccgccgttgccgccggccgaacctcgt Protospacer
*** ********** ********* .** .*
1206. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta Protospacer
********* ***** ******** * **
1207. spacer 2.9|335859|33|NC_021740|CRT matches to MH271296 (Gordonia phage Emperor, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
cccttgtcgcctttggcgccggccgcgccggtg Protospacer
** .*.**** ***.***************
1208. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
1209. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
1210. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
1211. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
1212. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
1213. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cagacctcggtgaccacgccggcaacgatc Protospacer
** .************** ******.
1214. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggttggccggtgaccactccgccagcgatg Protospacer
. . ************ ******.***.*
1215. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccggcctgctggtcgggctgacctc Protospacer
********************* .. . *
1216. spacer 6.13|925870|30|NC_021740|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
1217. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
1218. spacer 6.13|925870|30|NC_021740|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
1219. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc Protospacer
* . *** ******************
1220. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
1221. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct Protospacer
* ************* ********
1222. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
1223. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcaccgccctgctgatcggctccggcat Protospacer
*.*** *******.***********.
1224. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
1225. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
1226. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt Protospacer
. ******************. *** *
1227. spacer 6.13|925870|30|NC_021740|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc Protospacer
* ..************** * ******
1228. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
1229. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
1230. spacer 6.13|925870|30|NC_021740|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
1231. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
1232. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
1233. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
1234. spacer 6.15|925966|30|NC_021740|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgaccatctcggctccgacggcgctggcgc Protospacer
* * .*********.***********
1235. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
1236. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccaccccgcggctccggaggcgctggcgg Protospacer
*..*. . ********* ***********
1237. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
1238. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
1239. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
1240. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
1241. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
1242. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
1243. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
1244. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
1245. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
1246. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
1247. spacer 6.15|925966|30|NC_021740|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
1248. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgatcggctccggcgccggcttctc Protospacer
******* ************ ** . *
1249. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgtgcggctccggcggcaaccccga Protospacer
******* *************. . **.
1250. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgatgttcgactccggcggcgacgcacc Protospacer
**** ******.*********** .*
1251. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg Protospacer
* * .************** ******
1252. spacer 6.17|926056|36|NC_021740|CRT matches to MG770216 (Mycobacterium phage Rem711, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
attcggcggcaacggcggcaacggcgcggccggcgc Protospacer
..* . ************.******* ********
1253. spacer 6.17|926056|36|NC_021740|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
1254. spacer 6.17|926056|36|NC_021740|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
1255. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcgacggcggtcgcggt-- Protospacer
. ***************** ****** *.**.
1256. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ccccggcggcaacggcggcaacggcggcaatgcc-- Protospacer
*****************. ****** .** *
1257. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
cgccggcggcagcgccggcgccggcagtatcggc-- Protospacer
**********.** **********.* .***
1258. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
tgtcggcggtaacggcggcgtcggcgg--agccagc Protospacer
*.******.**********.****** .**.*
1259. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
1260. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_047958 (Burkholderia phage vB_BmuP_KL4, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggccgcaacgacggcgccggcggccggtgc Protospacer
****** ******.************ .**.
1261. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
1262. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
1263. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcgggaagggcggcgccggcggcggtctg Protospacer
******* ** ************** * **.
1264. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
1265. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
1266. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggaaacggtggcgccggcggcacggtg Protospacer
******** *****.*********** * *.
1267. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
taccggcggcaatggaggcgccggcggcatcgcc- Protospacer
.**********.** *********** .* **.
1268. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
1269. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
1270. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1271. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1272. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1273. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1274. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1275. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1276. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1277. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1278. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1279. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1280. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1281. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1282. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1283. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg----gtggcta CRISPR spacer
cggcggcggcaccggcggcaccggcggtgccgtg---- Protospacer
* ******** *******.******* ***
1284. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ggccggcggcaacgggagcgccggc--ctcgccgcc Protospacer
*************** .******** * **..
1285. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcg-gcaacggcggcgccggcgggtggcta CRISPR spacer
-ccgagcgcgccacggcggctccggcgggtggccc Protospacer
* .*** ** ******** ************.
1286. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1287. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1288. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1289. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1290. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1291. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1292. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1293. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1294. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1295. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1296. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1297. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1298. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1299. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1300. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1301. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1302. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1303. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggccctggcggctcggtg Protospacer
.***************** *.***** * * *.
1304. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1305. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1306. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caccggcggcagcggcggcgcaggcggaaacggc-- Protospacer
.*********.********* ***** ..***
1307. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1308. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1309. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
tctcggcggcgacggcggcgacggcggtgttgat- Protospacer
.*******.********* ****** ** * *
1310. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcaacggcggccgcggctgccagcca Protospacer
.****************** **** * ..**.*
1311. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
gcgcggcggcaccggcggcaccggc-ggcggtcat Protospacer
* ******** *******.***** **.**..*
1312. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggcagcggcggcggcggcggacgtcca Protospacer
*.********.******** ******..* *.*
1313. spacer 8.9|1211066|37|NC_021740|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.784
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
agtcggcggcggcggcggcaccggcgggaccggcggc Protospacer
********.* **************** . ***..*
1314. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc Protospacer
. ********.******.*********
1315. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1316. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1317. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1318. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1319. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1320. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1321. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc Protospacer
. **************** *.***** *
1322. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1323. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgc--gccttgcccgccgttgccgccggca CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg Protospacer
..** ********** *********** .
1324. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
attgccgccctggccgccgttgccgccgatc Protospacer
* * ****.** ***************..
1325. spacer 11.3|2082990|30|NC_021740|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
1326. spacer 11.3|2082990|30|NC_021740|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
1327. spacer 14.24|3108841|29|NC_021740|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724
tccgcgaaattcactgcgcgttattcaag CRISPR spacer
gacgcgaaatacactgcgctttattttca Protospacer
******** ******** *****. .
1328. spacer 15.7|3723528|31|NC_021740|CRT matches to CP033373 (Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ttagcccacttcacggccgttgccgacgcgg Protospacer
*********** ********** **. .
1329. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1330. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1331. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1332. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1333. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1334. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1335. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1336. spacer 15.7|3723528|31|NC_021740|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1337. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1338. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct Protospacer
.*. *. ***********.**********
1339. spacer 15.7|3723528|31|NC_021740|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1340. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1341. spacer 15.7|3723528|31|NC_021740|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1342. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca Protospacer
** . .****.*******.**********
1343. spacer 15.7|3723528|31|NC_021740|CRT matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atcgcccacttcaccggcgtttccgaccctt Protospacer
* ************** **** *** * ..
1344. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggccccggcggtgccggcgataccga Protospacer
*.******** ******* ********.. *
1345. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cggcggcggcgccggcggggccggcggcgggac Protospacer
*.. ******.***************.**. *
1346. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcaccac Protospacer
*****.****.************* . *. * *
1347. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcaccac Protospacer
*****.****.************* . *. * *
1348. spacer 16.8|3928590|36|NC_021740|CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 8, identity: 0.778
tagcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gcgctgatgcgccggcgacaccaaaggctccggcgg Protospacer
** * *.*******.****** ***********
1349. spacer 2.9|335859|33|NC_021740|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
agcgcgccgccgatgacgccggccacggtggcg Protospacer
********* ***********.** .**
1350. spacer 2.9|335859|33|NC_021740|CRT matches to NC_010399 (Clavibacter michiganensis subsp. sepedonicus plasmid pCS1, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gctccgccgccgcagacgccggccgcgccatgc Protospacer
* ********. ***************. ..
1351. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
agcgcgccgccgatgacgccggccacggtggcg Protospacer
********* ***********.** .**
1352. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
agcgcgccgccgatgacgccggccacggtggcg Protospacer
********* ***********.** .**
1353. spacer 2.9|335859|33|NC_021740|CRT matches to MN369761 (Mycobacterium phage Malthus, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
1354. spacer 2.9|335859|33|NC_021740|CRT matches to MK224497 (Mycobacterium phage Henu3, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
1355. spacer 2.9|335859|33|NC_021740|CRT matches to KJ944841 (Mycobacterium phage Cheetobro, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
1356. spacer 2.9|335859|33|NC_021740|CRT matches to AP018469 (Mycobacterium phage Y10 DNA, complete genome, note: sample1) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
1357. spacer 2.9|335859|33|NC_021740|CRT matches to KY087992 (Mycobacterium phage Mitti, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
1358. spacer 2.9|335859|33|NC_021740|CRT matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcaccgccgttgccgccggccgtatagacc Protospacer
*****.********* *********... *. .
1359. spacer 2.9|335859|33|NC_021740|CRT matches to MF140402 (Mycobacterium phage Chancellor, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
1360. spacer 2.9|335859|33|NC_021740|CRT matches to AP018470 (Mycobacterium phage Y2 DNA, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
1361. spacer 2.9|335859|33|NC_021740|CRT matches to KT361920 (Mycobacterium phage Slarp, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
1362. spacer 2.9|335859|33|NC_021740|CRT matches to MT310882 (Mycobacterium phage JF1, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
1363. spacer 2.9|335859|33|NC_021740|CRT matches to AP018471 (Mycobacterium phage Y10 DNA, complete genome, note: sample2) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
1364. spacer 2.9|335859|33|NC_021740|CRT matches to KX621007 (Mycobacterium phage Taquito, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
1365. spacer 2.9|335859|33|NC_021740|CRT matches to MH051258 (Mycobacterium phage SamScheppers, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
1366. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP036221 (Mycobacterium avium subsp. hominissuis strain mc2 2500 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg Protospacer
**. ****** ********** ******.
1367. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP040251 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid unnamed1) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg Protospacer
**. ****** ********** ******.
1368. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP040252 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid unnamed2) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg Protospacer
**. ****** ********** ******.
1369. spacer 2.9|335859|33|NC_021740|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
agggcgccgccgctgccgccggccgcctccggg Protospacer
**********.** ********** .* *.
1370. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP029334 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109b, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg Protospacer
**. ****** ********** ******.
1371. spacer 2.9|335859|33|NC_021740|CRT matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccactaccggcgttgacgccgcccgcgccgccc Protospacer
**. ..*** *********** ******** .
1372. spacer 2.9|335859|33|NC_021740|CRT matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccactaccggcgttgacgccgcccgcgccgccc Protospacer
**. ..*** *********** ******** .
1373. spacer 2.9|335859|33|NC_021740|CRT matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
aggacgccgccggagacgccggccgcgcggtcc Protospacer
*.******** ************** * .
1374. spacer 2.9|335859|33|NC_021740|CRT matches to JX163858 (Caulobacter phage phiCbK, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccactaccggcgttgacgccgcccgcgccgccc Protospacer
**. ..*** *********** ******** .
1375. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
1376. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
1377. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
1378. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
1379. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cccacgccggtcaccacgccgctgcccggc Protospacer
********** **********.. * .
1380. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
1381. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
1382. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
1383. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggcgccggcctgctggtcggactgctcac Protospacer
**.****************** .. *.
1384. spacer 6.15|925966|30|NC_021740|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
1385. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
1386. spacer 6.17|926056|36|NC_021740|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 9, identity: 0.75
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtacggc Protospacer
** ******** *************** * .. *
1387. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcaacggc-- Protospacer
. ****************. ****** ..***
1388. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcggcaacggcggccgcggcggcgacggc-- Protospacer
. **************** ***** *..***
1389. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggcaactgcggcgccggcgcccaccgc Protospacer
************ ************ .. *
1390. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcagcaatggcggcgccggcggcgccggc-- Protospacer
. ****.****.************* * .***
1391. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcgggaccggcggcgccggcggcagtatc Protospacer
* ****** * *************** * *
1392. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
1393. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
1394. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
1395. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
1396. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
1397. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggccacggcggcgtcggcggtcaggaa Protospacer
*.******* *********.****** ..* *
1398. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcggcggcgggggcacc Protospacer
.********* ******** ******* * .
1399. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggcgccggcgtctaccag Protospacer
********** ************* *. * .
1400. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1401. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaccggcggcgccgccggccatcat Protospacer
*.********* *********** *** .. *
1402. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1403. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1404. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1405. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1406. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcggcaatggcggcaccggcggcacggtc Protospacer
* *********.******.******* * *
1407. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1408. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1409. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcggcagcggtggtgga Protospacer
****************** *.**** * *
1410. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1411. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1412. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1413. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1414. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1415. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1416. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1417. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1418. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1419. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1420. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1421. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1422. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1423. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1424. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1425. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1426. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaacggcggcggcggtggctcctcg Protospacer
*.****************** ***.** * ...
1427. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1428. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1429. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1430. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1431. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1432. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1433. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1434. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggccccggcggcgccggccagctgcac Protospacer
********* ************* .*. **
1435. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1436. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ctgcggcggcgacggcggcaccggcggaggcagc-- Protospacer
*******.********.****** **..**
1437. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gttcggcggcgagggcggcgccggcggcaagcgt Protospacer
* .*******.* ************** .**
1438. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1439. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggcggcaacggcggccgcggcggctccgtg Protospacer
* **************** ****** * *.
1440. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1441. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcgccggcggcgccggcggcgaggga Protospacer
* *******. *************** .* *
1442. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1443. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1444. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caccggcggcaacggcggcaccgccgacaacggc-- Protospacer
.*****************.*** ** ...***
1445. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1446. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1447. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1448. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1449. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1450. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1451. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1452. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcggcagc-- Protospacer
. ****************. ***** **..**
1453. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1454. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggcaacggcggcttcccc Protospacer
*. ****************. ****** * *.
1455. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggccgcaacggcggctccggcggcgggaac Protospacer
* **** *********** ******* **
1456. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1457. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1458. spacer 8.9|1211066|37|NC_021740|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.757
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
ggtgggcggtgccggcggcagcggcggcatggccttc Protospacer
** **************** ****** *.* * *
1459. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg Protospacer
.... ****.***************** .*.
1460. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
tggcccgccttgccctccattgccgccggac Protospacer
. . ********** **.**********
1461. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
atccttgccttgaccgccgttgccgccgctg Protospacer
* .. .****** *************** ..
1462. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accccagccctgcccgccgttgccgccgctc Protospacer
* .. ***.****************** .
1463. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc Protospacer
. ******** ********* **** .*
1464. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accggcaccttgcccgccattgccgccatgt Protospacer
* . **.***********.********.
1465. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc Protospacer
. *******.******* *******.*
1466. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
agcgtggccttggccgccgttgccggcggtc Protospacer
*.. ****** ************ ***.
1467. spacer 15.5|3723387|34|NC_021740|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg Protospacer
.** .********.**** ***********.
1468. spacer 15.5|3723387|34|NC_021740|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg Protospacer
*. . *. *****.***** *************.
1469. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cagcggcggggacggcggcagcggcgtgcagcgctg Protospacer
*********** ******.******* * .**
1470. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
tggtgacggcaccggcggtgccggcggcgatgc Protospacer
... *.************ *******.***. *
1471. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cggccgcggcaccggcggggccgccgccgatca Protospacer
*.. ****************** ** ***..
1472. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1473. spacer 16.5|3928353|33|NC_021740|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1474. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1475. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1476. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1477. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg Protospacer
*.**************** * *****. . *
1478. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg Protospacer
*.**************** * *****. . *
1479. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1480. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1481. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1482. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggtacccggcaccgccgaggccggcgacgagtt Protospacer
. * ******** **.************ *.
1483. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1484. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1485. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
catgaccggcaccggcagggctggcgacgagca Protospacer
** .. **********.****.******** .
1486. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
catgaccggcaccggcagggctggcgacgagca Protospacer
** .. **********.****.******** .
1487. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1488. spacer 16.11|3928818|36|NC_021740|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.75
ggccggcggtagcggcggggccaacttcaacggcgg CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct Protospacer
*********** ******* ****** **.*
1489. spacer 16.11|3928818|36|NC_021740|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.75
ggccggcggtagcggcggggccaacttcaacggcgg CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct Protospacer
*********** ******* ****** **.*
1490. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cagcggcggggacggcggcagcggcgtgcagcgctg Protospacer
*********** ******.******* * .**
1491. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
tgctcgccgccgatgacgccggccgtgcgcagt Protospacer
. ******** ************.** ..*
1492. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP018080 (Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
agggcgccgccgatgacggcggccgcggtcagg Protospacer
********** ***** ******** . ..
1493. spacer 2.9|335859|33|NC_021740|CRT matches to MH371116 (Mycobacterium phage DMoney, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1494. spacer 2.9|335859|33|NC_021740|CRT matches to MH045569 (Mycobacterium phage Schiebel, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1495. spacer 2.9|335859|33|NC_021740|CRT matches to MH371119 (Mycobacterium phage OctaviousRex, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1496. spacer 2.9|335859|33|NC_021740|CRT matches to MF919497 (Mycobacterium phage Chance64, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1497. spacer 2.9|335859|33|NC_021740|CRT matches to MH001456 (Mycobacterium phage CLED96, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1498. spacer 2.9|335859|33|NC_021740|CRT matches to GQ303261 (Mycobacterium phage Hope, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1499. spacer 2.9|335859|33|NC_021740|CRT matches to MG099946 (Mycobacterium phage LouisV14, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1500. spacer 2.9|335859|33|NC_021740|CRT matches to KC787112 (Mycobacterium phage Clark, partial genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1501. spacer 2.9|335859|33|NC_021740|CRT matches to MH779513 (Mycobacterium phage Olga, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1502. spacer 2.9|335859|33|NC_021740|CRT matches to MK919475 (Mycobacterium phage Camri, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1503. spacer 2.9|335859|33|NC_021740|CRT matches to MK310146 (Mycobacterium phage Crespo, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1504. spacer 2.9|335859|33|NC_021740|CRT matches to MK524493 (Mycobacterium phage Darionha, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1505. spacer 2.9|335859|33|NC_021740|CRT matches to MH779505 (Mycobacterium phage Grizzly, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1506. spacer 2.9|335859|33|NC_021740|CRT matches to EU568876 (Mycobacterium phage BPs, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1507. spacer 2.9|335859|33|NC_021740|CRT matches to KC787107 (Mycobacterium phage Bo4, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1508. spacer 2.9|335859|33|NC_021740|CRT matches to MF668268 (Mycobacterium phage Aroostook, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1509. spacer 2.9|335859|33|NC_021740|CRT matches to MK524494 (Mycobacterium phage Rabbs, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1510. spacer 2.9|335859|33|NC_021740|CRT matches to KX588251 (Mycobacterium phage Jane, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1511. spacer 2.9|335859|33|NC_021740|CRT matches to KC787103 (Mycobacterium phage Chy2, partial genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1512. spacer 2.9|335859|33|NC_021740|CRT matches to MH001455 (Mycobacterium phage Remy19, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1513. spacer 2.9|335859|33|NC_021740|CRT matches to KT355472 (Mycobacterium phage Cedasite, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1514. spacer 2.9|335859|33|NC_021740|CRT matches to KX664455 (Mycobacterium phage Zombie, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1515. spacer 2.9|335859|33|NC_021740|CRT matches to MH077584 (Mycobacterium phage Phish, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1516. spacer 2.9|335859|33|NC_021740|CRT matches to KC787108 (Mycobacterium phage DNAIII, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1517. spacer 2.9|335859|33|NC_021740|CRT matches to MN444875 (Mycobacterium phage Jonghyun, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1518. spacer 2.9|335859|33|NC_021740|CRT matches to MK433279 (Mycobacterium phage Kareem, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1519. spacer 2.9|335859|33|NC_021740|CRT matches to KJ725374 (Mycobacterium phage Guo1, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1520. spacer 2.9|335859|33|NC_021740|CRT matches to NC_031102 (Mycobacterium phage Sneeze, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1521. spacer 2.9|335859|33|NC_021740|CRT matches to MT818422 (Mycobacterium phage Periodt, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1522. spacer 2.9|335859|33|NC_021740|CRT matches to MK305884 (Mycobacterium phage BQuat, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1523. spacer 2.9|335859|33|NC_021740|CRT matches to MF668272 (Mycobacterium phage Gideon, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1524. spacer 2.9|335859|33|NC_021740|CRT matches to KC787111 (Mycobacterium phage Sedge, partial genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1525. spacer 2.9|335859|33|NC_021740|CRT matches to KC787104 (Mycobacterium phage Chy3, partial genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1526. spacer 2.9|335859|33|NC_021740|CRT matches to NC_012788 (Mycobacterium phage Angel, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1527. spacer 2.9|335859|33|NC_021740|CRT matches to KX443326 (Mycobacterium phage BruceB, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1528. spacer 2.9|335859|33|NC_021740|CRT matches to MK433277 (Mycobacterium phage Renaissance, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1529. spacer 2.9|335859|33|NC_021740|CRT matches to MH590605 (Mycobacterium phage Cherrybomb426, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1530. spacer 2.9|335859|33|NC_021740|CRT matches to MH779509 (Mycobacterium phage Kasen3, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1531. spacer 2.9|335859|33|NC_021740|CRT matches to JN699002 (Mycobacterium phage Avrafan, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1532. spacer 2.9|335859|33|NC_021740|CRT matches to MH779507 (Mycobacterium phage Hotshotbaby7, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1533. spacer 2.9|335859|33|NC_021740|CRT matches to KT355474 (Mycobacterium phage Frosty24, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1534. spacer 2.9|335859|33|NC_021740|CRT matches to KC787109 (Mycobacterium phage Legendre, partial genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1535. spacer 2.9|335859|33|NC_021740|CRT matches to JN412593 (Mycobacterium phage Liefie, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1536. spacer 2.9|335859|33|NC_021740|CRT matches to MH479920 (Mycobacterium phage Mowgli, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1537. spacer 2.9|335859|33|NC_021740|CRT matches to KM923970 (Mycobacterium phage Gomashi, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1538. spacer 2.9|335859|33|NC_021740|CRT matches to MH450127 (Mycobacterium phage Plagueis, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1539. spacer 2.9|335859|33|NC_021740|CRT matches to KT347314 (Mycobacterium phage Phreak, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1540. spacer 2.9|335859|33|NC_021740|CRT matches to KT365399 (Mycobacterium phage Annihilator, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1541. spacer 2.9|335859|33|NC_021740|CRT matches to KC787110 (Mycobacterium phage Leo, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
1542. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
1543. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
1544. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
1545. spacer 6.2|925366|39|NC_021740|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744
cggcgcgggcggggccgtcacgggaaccggcgccaccgg CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc Protospacer
*. * ** ********.**************** *
1546. spacer 6.5|925519|36|NC_021740|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
1547. spacer 6.5|925519|36|NC_021740|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
1548. spacer 6.5|925519|36|NC_021740|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
1549. spacer 6.5|925519|36|NC_021740|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
1550. spacer 6.5|925519|36|NC_021740|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
1551. spacer 6.17|926056|36|NC_021740|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
atctggaggcaacggcggtaacggcggggccagcac Protospacer
... . ************************.**.
1552. spacer 6.17|926056|36|NC_021740|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gaccggcggcaacggcggaaacggcggcgccgcagc Protospacer
* . . ************ ******** **** *
1553. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcg-----ggtggcta CRISPR spacer
ccgcggcggcgacggcggcgcgggcggcaccggt----- Protospacer
*******.********** **** ***
1554. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggtaccggcggtgacgtc Protospacer
*. ***************..******* . *
1555. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acccggcggcaccggcggcgcgggcggtccggcc Protospacer
. ********* ********* ***** . * .
1556. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggcatcggcgccgccggcgcggcatcg Protospacer
********** ***** ******** * ....
1557. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaccggaggcgccggcggaggcacc Protospacer
********* *** ***********. * .
1558. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
atccggcggcgccggcggcgccggcggcggaact Protospacer
. ********. *************** *. .
1559. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
1560. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcaccggcggcaccgga Protospacer
.********* *******.******* *
1561. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
1562. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
1563. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1564. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to AP018709 (Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1565. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta------- CRISPR spacer
ggccgacggcaagggcggcgcc-------ggttacgcctcc Protospacer
*****.****** ********* **.**
1566. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
1567. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1568. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgacggcggcaacagcggcaccggcggagcgaag Protospacer
* **********.*****.*******. * .
1569. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1570. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1571. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
1572. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1573. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1574. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_008385 (Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1575. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1576. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1577. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_MN366359 (Bacterium plasmid pALTS31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1578. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcaacaacggcggcgccggcgccttcttc Protospacer
.*****..***************** * .*
1579. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1580. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1581. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1582. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1583. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
1584. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
1585. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1586. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
1587. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
1588. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1589. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1590. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1591. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1592. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1593. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1594. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1595. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1596. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1597. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1598. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_001381 (Mycobacterium fortuitum plasmid pAL5000, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcagcggcggcgctggcggcggcacg Protospacer
* ********.*********.***** * ..
1599. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1600. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1601. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1602. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1603. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1604. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to KU356987 (Variovorax paradoxus plasmid pBS64, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1605. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to KU356988 (Variovorax paradoxus plasmid pHB44, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1606. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcgacggcggcgacggcgccccgcgc Protospacer
********.********* ***** . **
1607. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP009797 (Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1608. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_013176 (Pseudomonas putida plasmid pW2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1609. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1610. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP017455 (Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1611. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1612. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1613. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacgtcggcaccggcggcgccggcggcgcgaag Protospacer
* ** ***** *************** * .
1614. spacer 8.9|1211066|37|NC_021740|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 10, identity: 0.73
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc Protospacer
. ***.**************.*******. * * *
1615. spacer 8.9|1211066|37|NC_021740|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 10, identity: 0.73
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc Protospacer
. ***.**************.*******. * * *
1616. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
1617. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg Protospacer
.. ****** *******.******** .
1618. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggccagaacttccccgctgttgccgccggca Protospacer
..... . *** *****.*************
1619. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
1620. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc Protospacer
... ****** ************ ***.
1621. spacer 9.13|1570379|34|NC_021740|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706
gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca Protospacer
. .. .*******.***************.**.
1622. spacer 13.9|3106243|35|NC_021740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
1623. spacer 14.20|3109714|34|NC_021740|CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
1624. spacer 14.36|3109718|34|NC_021740|PILER-CR matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
1625. spacer 15.5|3723387|34|NC_021740|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc Protospacer
. * ***** **************** **
1626. spacer 15.5|3723387|34|NC_021740|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
1627. spacer 15.5|3723387|34|NC_021740|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
1628. spacer 15.5|3723387|34|NC_021740|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
1629. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 10, identity: 0.722
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ggccggcggggccggcgggaccggcggggccggggg Protospacer
. *************** * **********..
1630. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 10, identity: 0.697
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gacgcgcggcaccggctggtccggcgacgcgcg Protospacer
* . *********** ** ********* .
1631. spacer 16.5|3928353|33|NC_021740|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 10, identity: 0.697
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggcaggcggcgccggcgaggccggcgaggggca Protospacer
. *******.******.********* *. .
1632. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 10, identity: 0.722
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ggccggcggggccggcgggaccggcggggccggggg Protospacer
. *************** * **********..
1633. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 11, identity: 0.667
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gacaggccgccgtcgacgccggccgcaccccgc Protospacer
. ********.************.** ..
1634. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcacgtcg Protospacer
. ****************. ****** *...
1635. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcagcggcggcggcggcggaaccccg Protospacer
.********.******** ******. *..
1636. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH051334 (Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
1637. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MG852086 (Escherichia phage vB_EcoS-Ro145clw, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
1638. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggccacggcggggccggcggcgacgcg Protospacer
.******** ******* ******** . ..
1639. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcaagggcggcgccgccggcgatcag Protospacer
.********* ********** *** . * .
1640. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caggggcggcaacggcggccccggcaggacggcg Protospacer
. *************** *****.** * ..
1641. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cataggcggcgatggcggcgccggcgggatggcg Protospacer
.. ******.*.*************** * ..
1642. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccgacggcaagggcggcgccggatacgccccc Protospacer
*****.****** *********** . *.
1643. spacer 8.5|1210850|40|NC_021740|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.725
tgccggcggcgccggcggtgtcggcggacccgccgggttg CRISPR spacer
ggttggcggcaccggcggtgtcggcggagccggtgacatc Protospacer
*..******.***************** *** .*. *
1644. spacer 15.5|3723387|34|NC_021740|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc Protospacer
...*. **.********.************
1645. spacer 16.3|3928209|36|NC_021740|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 11, identity: 0.694
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc Protospacer
*. .********************.** ** ..
1646. spacer 16.3|3928209|36|NC_021740|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 11, identity: 0.694
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc Protospacer
*. .********************.** ** ..
1647. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 11, identity: 0.667
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcccggccgcaccggcggtgccggcgaccgagg Protospacer
*** ********** ********* .
1648. spacer 16.17|3929409|36|NC_021740|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 11, identity: 0.694
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc Protospacer
*. .********************.** ** ..
1649. spacer 16.17|3929409|36|NC_021740|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 11, identity: 0.694
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc Protospacer
*. .********************.** ** ..
1650. spacer 2.9|335859|33|NC_021740|CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 12, identity: 0.636
--ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
acagcgcgccgccggcgtccacggcggcgccgt-- Protospacer
********* .* * **** ******
1651. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
aaccggcggcgacggcgtcgccggcgccaattcg Protospacer
..********.****** ******** . ...
1652. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP026703 (Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgc-----cggcgggtggcta CRISPR spacer
-gccggaaacgccggcgccgctgttgcggccggtg---- Protospacer
***** ..*. ***** *** **** ****
1653. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 14, identity: 0.588
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccggcgtttccgccgaga----- Protospacer
***** ****. ***** . *** **.*
1654. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 15, identity: 0.559
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccgacgtttccgccgaga----- Protospacer
***** ****. **.** . *** **.*