Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_021740 Mycobacterium tuberculosis EAI5, complete sequence 17 crisprs csa3,c2c9_V-U4,cas3,DinG,WYL,cas4,DEDDh,cas2,cas1,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6 17 52 1 1

Results visualization

1. NC_021740
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021740_1 334509-334696 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021740_2 335394-335966 Orphan NA
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021740_3 366472-367170 Orphan NA
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021740_4 631290-631427 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021740_5 692035-692111 TypeV-U4 NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021740_6 925273-926220 Orphan NA
19 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021740_7 1189965-1190073 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021740_8 1210599-1211455 Orphan NA
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021740_9 1569483-1570555 Orphan NA
15 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021740_10 1634200-1634388 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021740_11 2082870-2083124 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021740_12 2163397-2163616 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021740_13 3105615-3106969 TypeIII II-B,III-A
18 spacers
cas2,cas1,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021740_14 3108292-3110006 TypeIII II-B,III-A
23 spacers
cas2,cas1,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021740_15 3723040-3723581 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021740_16 3927999-3929750 Orphan NA
21 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021740_17 4090312-4090400 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 NC_021740.1 338595-338618 0 1.0
NC_021740_2 2.10|335913|33|NC_021740|CRT 335913-335945 33 NC_021740.1 338676-338708 0 1.0
NC_021740_8 8.8|1211027|16|NC_021740|CRISPRCasFinder 1211027-1211042 16 NC_021740.1 2083185-2083200 0 1.0
NC_021740_16 16.8|3928590|36|NC_021740|CRT 3928590-3928625 36 NC_021740.1 3926706-3926741 0 1.0
NC_021740_16 16.8|3928590|36|NC_021740|CRT 3928590-3928625 36 NC_021740.1 3927048-3927083 0 1.0
NC_021740_16 16.8|3928590|36|NC_021740|CRT 3928590-3928625 36 NC_021740.1 3927639-3927674 0 1.0
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NC_021740.1 338622-338654 1 0.97
NC_021740_4 4.1|631308|18|NC_021740|CRT 631308-631325 18 NC_021740.1 22466-22483 1 0.944
NC_021740_4 4.1|631308|18|NC_021740|CRT 631308-631325 18 NC_021740.1 1410721-1410738 1 0.944
NC_021740_4 4.3|631392|18|NC_021740|CRT 631392-631409 18 NC_021740.1 971891-971908 1 0.944
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 674783-674801 1 0.947
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 840508-840526 1 0.947
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1212125-1212143 1 0.947
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1216266-1216284 1 0.947
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1216338-1216356 1 0.947
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1627979-1627997 1 0.947
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1630805-1630823 1 0.947
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1986741-1986759 1 0.947
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 2056110-2056128 1 0.947
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 2056557-2056575 1 0.947
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 2056656-2056674 1 0.947
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 2789875-2789893 1 0.947
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 2793403-2793421 1 0.947
NC_021740_10 10.3|1634299|18|NC_021740|CRT 1634299-1634316 18 NC_021740.1 2789800-2789817 1 0.944
NC_021740_10 10.3|1634299|18|NC_021740|CRT 1634299-1634316 18 NC_021740.1 3749092-3749109 1 0.944
NC_021740_11 11.2|2082951|18|NC_021740|CRT 2082951-2082968 18 NC_021740.1 401070-401087 1 0.944
NC_021740_11 11.2|2082951|18|NC_021740|CRT 2082951-2082968 18 NC_021740.1 607429-607446 1 0.944
NC_021740_11 11.4|2083041|18|NC_021740|CRT 2083041-2083058 18 NC_021740.1 3436625-3436642 1 0.944
NC_021740_16 16.8|3928590|36|NC_021740|CRT 3928590-3928625 36 NC_021740.1 3927990-3928025 1 0.972
NC_021740_3 3.5|366760|42|NC_021740|CRISPRCasFinder 366760-366801 42 NC_021740.1 374791-374832 2 0.952
NC_021740_3 3.6|366835|33|NC_021740|CRISPRCasFinder 366835-366867 33 NC_021740.1 373606-373638 2 0.939
NC_021740_6 6.17|926056|36|NC_021740|CRT 926056-926091 36 NC_021740.1 675102-675137 2 0.944
NC_021740_6 6.17|926056|36|NC_021740|CRT 926056-926091 36 NC_021740.1 1212398-1212433 2 0.944
NC_021740_6 6.17|926056|36|NC_021740|CRT 926056-926091 36 NC_021740.1 2416976-2417011 2 0.944
NC_021740_8 8.7|1210982|22|NC_021740|CRISPRCasFinder 1210982-1211003 22 NC_021740.1 2948322-2948343 2 0.909
NC_021740_8 8.11|1211165|22|NC_021740|CRISPRCasFinder 1211165-1211186 22 NC_021740.1 837446-837467 2 0.909
NC_021740_8 8.11|1211165|22|NC_021740|CRISPRCasFinder 1211165-1211186 22 NC_021740.1 1216293-1216314 2 0.909
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 150187-150205 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 333773-333791 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 335192-335210 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 337994-338012 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 338123-338141 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 338390-338408 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 338437-338455 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 338513-338531 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 363044-363062 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 443420-443438 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 546762-546780 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 623991-624009 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 624213-624231 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 673949-673967 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 840229-840247 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1089629-1089647 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1090277-1090295 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1094317-1094335 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1211654-1211672 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1212044-1212062 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1216686-1216704 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1487848-1487866 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1615943-1615961 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1616396-1616414 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1633318-1633336 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1633327-1633345 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1861604-1861622 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1862132-1862150 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1986015-1986033 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 1996040-1996058 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 2083380-2083398 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 2298076-2298094 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 2351523-2351541 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 2412837-2412855 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 2416906-2416924 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 2559685-2559703 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 2682647-2682665 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 2783195-2783213 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 2783777-2783795 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 3041023-3041041 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 3041122-3041140 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 3689223-3689241 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 3719828-3719846 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 3720452-3720470 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 3720695-3720713 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 3720828-3720846 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 3783352-3783370 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 3783535-3783553 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 3783703-3783721 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 3910154-3910172 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 3911884-3911902 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 3920391-3920409 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 4011351-4011369 2 0.895
NC_021740_8 8.13|1211282|19|NC_021740|CRISPRCasFinder 1211282-1211300 19 NC_021740.1 4073895-4073913 2 0.895
NC_021740_16 16.8|3928590|36|NC_021740|CRT 3928590-3928625 36 NC_021740.1 3912439-3912474 2 0.944
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_021740.1 362002-362028 2 0.926
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_021740.1 3920892-3920918 2 0.926
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_021740.1 3921228-3921254 2 0.926
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_021740.1 3921574-3921600 2 0.926

1. spacer 2.8|335814|24|NC_021740|CRT matches to position: 338595-338618, mismatch: 0, identity: 1.0

atgagcccgccggcgccgccgttg	CRISPR spacer
atgagcccgccggcgccgccgttg	Protospacer
************************

2. spacer 2.10|335913|33|NC_021740|CRT matches to position: 338676-338708, mismatch: 0, identity: 1.0

attaaccagccgccgtccccgccattggccccg	CRISPR spacer
attaaccagccgccgtccccgccattggccccg	Protospacer
*********************************

3. spacer 8.8|1211027|16|NC_021740|CRISPRCasFinder matches to position: 2083185-2083200, mismatch: 0, identity: 1.0

gtggctgtacggcgac	CRISPR spacer
gtggctgtacggcgac	Protospacer
****************

4. spacer 16.8|3928590|36|NC_021740|CRT matches to position: 3926706-3926741, mismatch: 0, identity: 1.0

tagcagcggtgccggcggcaccaacggctccggcgg	CRISPR spacer
tagcagcggtgccggcggcaccaacggctccggcgg	Protospacer
************************************

5. spacer 16.8|3928590|36|NC_021740|CRT matches to position: 3927048-3927083, mismatch: 0, identity: 1.0

tagcagcggtgccggcggcaccaacggctccggcgg	CRISPR spacer
tagcagcggtgccggcggcaccaacggctccggcgg	Protospacer
************************************

6. spacer 16.8|3928590|36|NC_021740|CRT matches to position: 3927639-3927674, mismatch: 0, identity: 1.0

tagcagcggtgccggcggcaccaacggctccggcgg	CRISPR spacer
tagcagcggtgccggcggcaccaacggctccggcgg	Protospacer
************************************

7. spacer 2.9|335859|33|NC_021740|CRT matches to position: 338622-338654, mismatch: 1, identity: 0.97

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccggccccgccgttgacgccggccgcgccggat	Protospacer
***** ***************************

8. spacer 4.1|631308|18|NC_021740|CRT matches to position: 22466-22483, mismatch: 1, identity: 0.944

accacgtcggcgacgacg	CRISPR spacer
acgacgtcggcgacgacg	Protospacer
** ***************

9. spacer 4.1|631308|18|NC_021740|CRT matches to position: 1410721-1410738, mismatch: 1, identity: 0.944

accacgtcggcgacgacg	CRISPR spacer
acctcgtcggcgacgacg	Protospacer
*** **************

10. spacer 4.3|631392|18|NC_021740|CRT matches to position: 971891-971908, mismatch: 1, identity: 0.944

accacgccgccaacgacg	CRISPR spacer
accacgccgcccacgacg	Protospacer
*********** ******

11. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 674783-674801, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggtggggccggtggc	Protospacer
******.************

12. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 840508-840526, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

13. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1212125-1212143, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

14. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1216266-1216284, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggaggc	Protospacer
*************** ***

15. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1216338-1216356, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

16. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1627979-1627997, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggtggc	Protospacer
********* *********

17. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1630805-1630823, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggaggc	Protospacer
*************** ***

18. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1986741-1986759, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

19. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 2056110-2056128, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

20. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 2056557-2056575, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

21. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 2056656-2056674, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

22. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 2789875-2789893, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggccggtggc	Protospacer
** ****************

23. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 2793403-2793421, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggcgggtggc	Protospacer
************ ******

24. spacer 10.3|1634299|18|NC_021740|CRT matches to position: 2789800-2789817, mismatch: 1, identity: 0.944

accgccgacgccaccagc	CRISPR spacer
accgccgaccccaccagc	Protospacer
********* ********

25. spacer 10.3|1634299|18|NC_021740|CRT matches to position: 3749092-3749109, mismatch: 1, identity: 0.944

accgccgacgccaccagc	CRISPR spacer
accgccaacgccaccagc	Protospacer
******.***********

26. spacer 11.2|2082951|18|NC_021740|CRT matches to position: 401070-401087, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

27. spacer 11.2|2082951|18|NC_021740|CRT matches to position: 607429-607446, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

28. spacer 11.4|2083041|18|NC_021740|CRT matches to position: 3436625-3436642, mismatch: 1, identity: 0.944

gatcagcgtcccgccggt	CRISPR spacer
gatcagcgtcccgctggt	Protospacer
**************.***

29. spacer 16.8|3928590|36|NC_021740|CRT matches to position: 3927990-3928025, mismatch: 1, identity: 0.972

tagcagcggtgccggcggcaccaacggctccggcgg	CRISPR spacer
tagcagctgtgccggcggcaccaacggctccggcgg	Protospacer
******* ****************************

30. spacer 3.5|366760|42|NC_021740|CRISPRCasFinder matches to position: 374791-374832, mismatch: 2, identity: 0.952

ccggtgcccgagttgaagaacccgatgtttccgctgccggag	CRISPR spacer
ccggtgcccgagttgaacaacccgacgtttccgctgccggag	Protospacer
***************** *******.****************

31. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to position: 373606-373638, mismatch: 2, identity: 0.939

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
aggctgccgaacccgatctggccgctgccggtg	Protospacer
********** *************.********

32. spacer 6.17|926056|36|NC_021740|CRT matches to position: 675102-675137, mismatch: 2, identity: 0.944

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gctgatgggcaacggcggcaacggcggggccggcgg	Protospacer
****** ***********.*****************

33. spacer 6.17|926056|36|NC_021740|CRT matches to position: 1212398-1212433, mismatch: 2, identity: 0.944

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gctgatcggcaacggcggccacggcggggccggcgg	Protospacer
******************. ****************

34. spacer 6.17|926056|36|NC_021740|CRT matches to position: 2416976-2417011, mismatch: 2, identity: 0.944

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcggtgccggcgg	Protospacer
******************.******** ********

35. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to position: 2948322-2948343, mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tggcgggggtgccggcggtgtc	Protospacer
** *** ***************

36. spacer 8.11|1211165|22|NC_021740|CRISPRCasFinder matches to position: 837446-837467, mismatch: 2, identity: 0.909

gctgtggggcggcggtggtgcc	CRISPR spacer
gctgtggggcgccggtggggcc	Protospacer
*********** ****** ***

37. spacer 8.11|1211165|22|NC_021740|CRISPRCasFinder matches to position: 1216293-1216314, mismatch: 2, identity: 0.909

gctgtggggcggcggtggtgcc	CRISPR spacer
gctgtggggcgtcggtggcgcc	Protospacer
*********** ******.***

38. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 150187-150205, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcggcggtggc	Protospacer
********* * *******

39. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 333773-333791, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

40. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 335192-335210, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

41. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 337994-338012, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggcgggcggc	Protospacer
************ **.***

42. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 338123-338141, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

43. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 338390-338408, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggtcggtggc	Protospacer
** ********.*******

44. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 338437-338455, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgccgccggtggc	Protospacer
********  *********

45. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 338513-338531, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccgccggc	Protospacer
************** .***

46. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 363044-363062, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccgtcggcgccggtggc	Protospacer
***** *** *********

47. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 443420-443438, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cggcggcggggacggtggc	Protospacer
** ******** *******

48. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 546762-546780, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggccgggccggtggc	Protospacer
** **** ***********

49. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 623991-624009, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggcgccggtggc	Protospacer
** ****** *********

50. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 624213-624231, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

51. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 673949-673967, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

52. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 840229-840247, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggcgggcggc	Protospacer
************ **.***

53. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1089629-1089647, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

54. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1090277-1090295, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggaggggccggcggc	Protospacer
****** ********.***

55. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1094317-1094335, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

56. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1211654-1211672, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggggccggaggc	Protospacer
******.******** ***

57. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1212044-1212062, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cggcggcggggccggcggc	Protospacer
** ************.***

58. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1216686-1216704, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

59. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1487848-1487866, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

60. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1615943-1615961, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

61. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1616396-1616414, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggagccggtggc	Protospacer
******.**.*********

62. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1633318-1633336, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggcgccggtggc	Protospacer
******.** *********

63. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1633327-1633345, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggcgccggtggc	Protospacer
*** ***** *********

64. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1861604-1861622, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgctggcggggccggcggc	Protospacer
***.***********.***

65. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1862132-1862150, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgctggcggggccggcggc	Protospacer
***.***********.***

66. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1986015-1986033, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

67. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 1996040-1996058, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgtcggcggtgccggtggc	Protospacer
**.****** *********

68. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 2083380-2083398, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggggccggcggc	Protospacer
*** ***********.***

69. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 2298076-2298094, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccgtcggc	Protospacer
************** .***

70. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 2351523-2351541, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccgccggc	Protospacer
************** .***

71. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 2412837-2412855, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggtcgatggc	Protospacer
***********.**.****

72. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 2416906-2416924, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgcggccggcggc	Protospacer
******** ******.***

73. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 2559685-2559703, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggcgccggtggc	Protospacer
*** ***** *********

74. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 2682647-2682665, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

75. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 2783195-2783213, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcaggcggtgccggtggc	Protospacer
*** ***** *********

76. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 2783777-2783795, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgggaccggcggc	Protospacer
**********.****.***

77. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 3041023-3041041, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggggccggcggc	Protospacer
*** ***********.***

78. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 3041122-3041140, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

79. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 3689223-3689241, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccgtcgggcccggtggc	Protospacer
***** **** ********

80. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 3719828-3719846, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

81. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 3720452-3720470, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgcaggtggc	Protospacer
********* ** ******

82. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 3720695-3720713, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggtgccggtggc	Protospacer
******.** *********

83. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 3720828-3720846, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgcggccggcggc	Protospacer
******** ******.***

84. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 3783352-3783370, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggccggcggc	Protospacer
** ************.***

85. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 3783535-3783553, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggcgccggtggc	Protospacer
*** ***** *********

86. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 3783703-3783721, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

87. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 3910154-3910172, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccagcggggccggcggc	Protospacer
****.**********.***

88. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 3911884-3911902, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgctggcggggccggcggc	Protospacer
***.***********.***

89. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 3920391-3920409, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgggcacggtggc	Protospacer
**********  *******

90. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 4011351-4011369, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

91. spacer 8.13|1211282|19|NC_021740|CRISPRCasFinder matches to position: 4073895-4073913, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

92. spacer 16.8|3928590|36|NC_021740|CRT matches to position: 3912439-3912474, mismatch: 2, identity: 0.944

tagcagcggtgccggcggcaccaacggctccggcgg	CRISPR spacer
tagcagcggtgccggcggcaccaacggctctggtgg	Protospacer
******************************.**.**

93. spacer 16.18|3929481|27|NC_021740|CRT matches to position: 362002-362028, mismatch: 2, identity: 0.926

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caacggcggcaacggcggcatgggcgg	Protospacer
** ********* **************

94. spacer 16.18|3929481|27|NC_021740|CRT matches to position: 3920892-3920918, mismatch: 2, identity: 0.926

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caccggcggcaaaggcggcaccggcgg	Protospacer
********************. *****

95. spacer 16.18|3929481|27|NC_021740|CRT matches to position: 3921228-3921254, mismatch: 2, identity: 0.926

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caccggcggcaaaggcggcaccggcgg	Protospacer
********************. *****

96. spacer 16.18|3929481|27|NC_021740|CRT matches to position: 3921574-3921600, mismatch: 2, identity: 0.926

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caccggcggcaaaggcggcaccggcgg	Protospacer
********************. *****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_021740_8 8.7|1210982|22|NC_021740|CRISPRCasFinder 1210982-1211003 22 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 136890-136911 1 0.955
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1975819-1975840 1 0.955
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1109892-1109913 1 0.955
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP016457 Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence 87869-87890 1 0.955
NC_021740_9 9.15|1570502|22|NC_021740|CRISPRCasFinder 1570502-1570523 22 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 362668-362689 1 0.955
NC_021740_9 9.15|1570502|22|NC_021740|CRISPRCasFinder 1570502-1570523 22 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2289382-2289403 1 0.955
NC_021740_9 9.15|1570502|22|NC_021740|CRISPRCasFinder 1570502-1570523 22 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 81656-81677 1 0.955
NC_021740_9 9.15|1570502|22|NC_021740|CRISPRCasFinder 1570502-1570523 22 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 56160-56181 1 0.955
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 188879-188902 2 0.917
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 187457-187480 2 0.917
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NC_028947 Mycobacterium phage Kratio, complete genome 49096-49119 2 0.917
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 297225-297248 2 0.917
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 1001256-1001279 2 0.917
NC_021740_8 8.7|1210982|22|NC_021740|CRISPRCasFinder 1210982-1211003 22 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 794580-794601 2 0.909
NC_021740_8 8.7|1210982|22|NC_021740|CRISPRCasFinder 1210982-1211003 22 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 75477-75498 2 0.909
NC_021740_8 8.7|1210982|22|NC_021740|CRISPRCasFinder 1210982-1211003 22 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 713470-713491 2 0.909
NC_021740_8 8.7|1210982|22|NC_021740|CRISPRCasFinder 1210982-1211003 22 NC_021056 Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence 29437-29458 2 0.909
NC_021740_8 8.7|1210982|22|NC_021740|CRISPRCasFinder 1210982-1211003 22 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 56975-56996 2 0.909
NC_021740_8 8.7|1210982|22|NC_021740|CRISPRCasFinder 1210982-1211003 22 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 458462-458483 2 0.909
NC_021740_8 8.7|1210982|22|NC_021740|CRISPRCasFinder 1210982-1211003 22 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1354617-1354638 2 0.909
NC_021740_8 8.7|1210982|22|NC_021740|CRISPRCasFinder 1210982-1211003 22 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 881389-881410 2 0.909
NC_021740_8 8.7|1210982|22|NC_021740|CRISPRCasFinder 1210982-1211003 22 NC_047977 Microbacterium phage Hendrix, complete genome 3065-3086 2 0.909
NC_021740_8 8.15|1211366|22|NC_021740|CRISPRCasFinder 1211366-1211387 22 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 917429-917450 2 0.909
NC_021740_9 9.2|1569575|22|NC_021740|CRISPRCasFinder 1569575-1569596 22 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 881140-881161 2 0.909
NC_021740_9 9.2|1569575|22|NC_021740|CRISPRCasFinder 1569575-1569596 22 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 225972-225993 2 0.909
NC_021740_9 9.2|1569575|22|NC_021740|CRISPRCasFinder 1569575-1569596 22 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 451168-451189 2 0.909
NC_021740_9 9.2|1569575|22|NC_021740|CRISPRCasFinder 1569575-1569596 22 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 234992-235013 2 0.909
NC_021740_9 9.2|1569575|22|NC_021740|CRISPRCasFinder 1569575-1569596 22 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 597449-597470 2 0.909
NC_021740_9 9.3|1569629|22|NC_021740|CRISPRCasFinder 1569629-1569650 22 NZ_CP025510 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence 117076-117097 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 448838-448859 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 160471-160492 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 175264-175285 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 457593-457614 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 166709-166730 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 166709-166730 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 166709-166730 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 166709-166730 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 164465-164486 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 97458-97479 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP012698 Microbacterium sp. No. 7 plasmid A, complete sequence 53118-53139 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 100830-100851 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 307854-307875 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 23841-23862 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 279961-279982 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 359201-359222 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 606826-606847 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 411558-411579 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 300111-300132 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 483830-483851 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP024312 Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence 68146-68167 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 175112-175133 2 0.909
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 314082-314103 2 0.909
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 402883-402907 2 0.92
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 416172-416196 2 0.92
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 472935-472959 2 0.92
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 381330-381356 3 0.889
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 375654-375677 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP026559 Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p2_tig3, complete sequence 12135-12158 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 260829-260852 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1821931-1821954 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP019872 Pseudomonas syringae pv. tomato strain B13-200 plasmid pB13-200A, complete sequence 81654-81677 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 273666-273689 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 250323-250346 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NC_017385 Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence 44875-44898 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 480848-480871 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 254377-254400 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 2010169-2010192 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_LR594668 Variovorax sp. SRS16 plasmid 3 54596-54619 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP012910 Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence 200117-200140 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 265021-265044 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 CP054316 Escherichia coli strain SCU-483 plasmid pSCU-483-1 45481-45504 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 270707-270730 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 380949-380972 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1687209-1687232 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_LR723679 Arsenite-oxidising bacterium NT-25 plasmid 3 2843-2866 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 253437-253460 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 393175-393198 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 314805-314828 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP029986 Sphingomonas sp. FARSPH plasmid p01, complete sequence 124761-124784 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 273638-273661 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 480906-480929 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 406874-406897 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1981273-1981296 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1728868-1728891 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1745573-1745596 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 480857-480880 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 162425-162448 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 254382-254405 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 865520-865543 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 400610-400633 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1243459-1243482 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 58875-58898 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 254696-254719 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 248416-248439 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 137027-137050 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP031228 Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pPla107-2 11324-11347 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 261731-261754 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 251479-251502 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 143214-143237 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 265021-265044 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 258245-258268 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1913539-1913562 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 258234-258257 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1913541-1913564 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 250562-250585 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 267505-267528 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP044960 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.3, complete sequence 43462-43485 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 273471-273494 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 265033-265056 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 265054-265077 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 265020-265043 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 829451-829474 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052880 Escherichia coli strain C21 plasmid pC21-3, complete sequence 48182-48205 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 251854-251877 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP044333 Methylocystis parvus strain BRCS2 plasmid unnamed2, complete sequence 39977-40000 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 247761-247784 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 251727-251750 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NC_014626 Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence 96035-96058 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 254713-254736 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP019215 Escherichia coli strain WCHEC050613 plasmid pI_050613, complete sequence 44752-44775 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 267505-267528 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 269171-269194 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 253464-253487 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 267504-267527 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 273458-273481 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 314873-314896 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 246331-246354 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 269171-269194 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 253464-253487 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 480739-480762 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1709818-1709841 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 267505-267528 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 269171-269194 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 457781-457804 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 260849-260872 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_LN890525 Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 2, complete sequence 17240-17263 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 246334-246357 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 269171-269194 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 253464-253487 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 253464-253487 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 253464-253487 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 267505-267528 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_LT963412 Pseudomonas syringae isolate CFBP3840 plasmid PP3, complete sequence 43562-43585 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1843176-1843199 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 267505-267528 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 246334-246357 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 261714-261737 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 260848-260871 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 261686-261709 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 258316-258339 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 256443-256466 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 255213-255236 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 251975-251998 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 267505-267528 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 246334-246357 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 269171-269194 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 334406-334429 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 267499-267522 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 246334-246357 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 246334-246357 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 267505-267528 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 253464-253487 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1825224-1825247 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 267505-267528 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 267505-267528 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1825224-1825247 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP047261 Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326F, complete sequence 350063-350086 3 0.875
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 260844-260867 3 0.875
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2294259-2294282 3 0.875
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 MN010758 Gordonia phage Dardanus, complete genome 17671-17694 3 0.875
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1150737-1150760 3 0.875
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1078865-1078888 3 0.875
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 NZ_CP044330 Methylocystis rosea strain BRCS1 plasmid unnamed2, complete sequence 185601-185624 3 0.875
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 986912-986935 3 0.875
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1156661-1156684 3 0.875
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1153402-1153425 3 0.875
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 MT740732 Ralstonia phage Darius, complete genome 41818-41841 3 0.875
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 MH638294 Ralstonia phage GP4, complete genome 1904-1927 3 0.875
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 836023-836046 3 0.875
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 NZ_CP025550 Mycobacterium paragordonae strain 49061 plasmid unnamed4, complete sequence 12981-13004 3 0.875
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 NZ_CP034088 Methylocystis rosea strain GW6 plasmid pGW6_2, complete sequence 207718-207741 3 0.875
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 MT740740 Ralstonia phage Gervaise, complete genome 7571-7594 3 0.875
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4024254-4024277 3 0.875
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4460576-4460599 3 0.875
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NZ_CP034768 Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence 122201-122224 3 0.875
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 37773-37796 3 0.875
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 116652-116675 3 0.875
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 72348-72371 3 0.875
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 KU716094 Mycobacterium phage Eidsmoe, complete genome 5649-5672 3 0.875
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 MH371122 Mycobacterium phage Priya, complete genome 5650-5673 3 0.875
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 MK016502 Mycobacterium phage Pat3, complete genome 22827-22850 3 0.875
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 MK937593 Mycobacterium phage Flypotenuse, complete genome 23717-23740 3 0.875
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 MG872835 Mycobacterium phage Conquerage, complete genome 5649-5672 3 0.875
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 MH536820 Mycobacterium phage Glexan, complete genome 23717-23740 3 0.875
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 91001-91024 3 0.875
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 44795-44818 3 0.875
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1701753-1701776 3 0.875
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 MH271298 Microbacterium phage Floof, complete genome 37939-37962 3 0.875
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 MN703413 Arthrobacter phage Powerpuff, complete genome 38834-38858 3 0.88
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 MT024871 Arthrobacter phage YesChef, complete genome 37693-37717 3 0.88
NC_021740_8 8.7|1210982|22|NC_021740|CRISPRCasFinder 1210982-1211003 22 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 355111-355132 3 0.864
NC_021740_8 8.7|1210982|22|NC_021740|CRISPRCasFinder 1210982-1211003 22 NZ_CP040721 Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence 58695-58716 3 0.864
NC_021740_8 8.7|1210982|22|NC_021740|CRISPRCasFinder 1210982-1211003 22 NZ_CP040721 Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence 90623-90644 3 0.864
NC_021740_8 8.7|1210982|22|NC_021740|CRISPRCasFinder 1210982-1211003 22 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1457966-1457987 3 0.864
NC_021740_8 8.7|1210982|22|NC_021740|CRISPRCasFinder 1210982-1211003 22 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 422944-422965 3 0.864
NC_021740_8 8.7|1210982|22|NC_021740|CRISPRCasFinder 1210982-1211003 22 KT381864 Thiobacimonas phage vB_ThpS-P1, complete genome 3900-3921 3 0.864
NC_021740_8 8.11|1211165|22|NC_021740|CRISPRCasFinder 1211165-1211186 22 NZ_CP048287 Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence 4076-4097 3 0.864
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_KY349138 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence 9264-9285 3 0.864
NC_021740_9 9.4|1569683|22|NC_021740|CRISPRCasFinder 1569683-1569704 22 NZ_CP021649 Acidovorax sp. T1 plasmid p1-T1, complete sequence 13233-13254 3 0.864
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 937294-937318 3 0.88
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1470762-1470786 3 0.88
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 MN586053 Arthrobacter phage BeatusComedenti, complete genome 26689-26713 3 0.88
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 NC_031254 Arthrobacter phage Kitkat, complete genome 26809-26833 3 0.88
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 NC_031231 Arthrobacter phage KellEzio, complete genome 26691-26715 3 0.88
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 633177-633201 3 0.88
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 NZ_CP030129 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence 74124-74148 3 0.88
NC_021740_9 9.15|1570502|22|NC_021740|CRISPRCasFinder 1570502-1570523 22 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 380879-380900 3 0.864
NC_021740_11 11.5|2083080|24|NC_021740|CRT 2083080-2083103 24 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1555522-1555545 3 0.875
NC_021740_11 11.5|2083080|24|NC_021740|CRT 2083080-2083103 24 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1560190-1560213 3 0.875
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_023695 Mycobacterium phage Violet, complete genome 29124-29150 3 0.889
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 338431-338457 3 0.889
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_LR134449 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 7, complete sequence 47169-47195 4 0.852
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NC_023286 Streptomyces sp. F12 plasmid pFRL6, complete sequence 2719-2745 4 0.852
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NC_012520 Rhodococcus opacus B4 plasmid pROB01, complete sequence 437755-437781 4 0.852
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 117320-117346 4 0.852
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP016082 Streptomyces sp. SAT1 plasmid unnamed2, complete sequence 254668-254694 4 0.852
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP046258 Gordonia sp. 135 plasmid pG135, complete sequence 7983-8009 4 0.852
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1914326-1914349 4 0.833
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 64916-64939 4 0.833
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1812923-1812946 4 0.833
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 139550-139573 4 0.833
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 479362-479385 4 0.833
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 99221-99244 4 0.833
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 83944-83967 4 0.833
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1883136-1883159 4 0.833
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1811943-1811966 4 0.833
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1812933-1812956 4 0.833
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1812317-1812340 4 0.833
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1812903-1812926 4 0.833
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 214761-214784 4 0.833
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1914518-1914541 4 0.833
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 106186-106209 4 0.833
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 25287-25310 4 0.833
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1914515-1914538 4 0.833
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1914479-1914502 4 0.833
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 496942-496965 4 0.833
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 1018619-1018642 4 0.833
NC_021740_2 2.8|335814|24|NC_021740|CRT 335814-335837 24 NZ_CP040937 Hymenobacter sp. DG01 plasmid unnamed, complete sequence 138246-138269 4 0.833
NC_021740_3 3.1|366505|27|NC_021740|CRISPRCasFinder 366505-366531 27 NC_023591 Mycobacterium phage Adler, complete genome 61249-61275 4 0.852
NC_021740_3 3.1|366505|27|NC_021740|CRISPRCasFinder 366505-366531 27 KF981876 UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome 61247-61273 4 0.852
NC_021740_3 3.7|366901|27|NC_021740|CRISPRCasFinder 366901-366927 27 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 10066-10092 4 0.852
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 460464-460490 4 0.852
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NC_016652 Rhodococcus phage REQ2, complete genome 36035-36061 4 0.852
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 603744-603773 4 0.867
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010326 Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence 242875-242901 4 0.852
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP021045 Phaeobacter gallaeciensis strain P129 plasmid pP129_e, complete sequence 30409-30435 4 0.852
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010678 Phaeobacter gallaeciensis strain P75 plasmid pP75_e, complete sequence 30478-30504 4 0.852
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NC_023142 Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence 30507-30533 4 0.852
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010789 Phaeobacter gallaeciensis strain P63 plasmid pP63_e, complete sequence 30472-30498 4 0.852
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010642 Phaeobacter gallaeciensis strain P73 plasmid pP73_f, complete sequence 30478-30504 4 0.852
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010593 Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence 30504-30530 4 0.852
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 AM419438 Archaeal BJ1 virus complete genome 36975-37001 4 0.852
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NC_008695 Archaeal BJ1 virus, complete genome 36975-37001 4 0.852
NC_021740_6 6.10|925729|27|NC_021740|CRT 925729-925755 27 KY945355 Mycobacterium phage Shandong1, complete genome 25634-25660 4 0.852
NC_021740_6 6.10|925729|27|NC_021740|CRT 925729-925755 27 NZ_CP015095 Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence 106725-106751 4 0.852
NC_021740_6 6.10|925729|27|NC_021740|CRT 925729-925755 27 NC_041888 Mycobacterium phage Tortellini, complete genome 37216-37242 4 0.852
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1096460-1096489 4 0.867
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1898211-1898234 4 0.833
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NZ_CP025431 Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence 261506-261529 4 0.833
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 673134-673157 4 0.833
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NZ_CP016822 Rhodococcus sp. p52 plasmid pDF03, complete sequence 60076-60099 4 0.833
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 MN582086 Siphoviridae sp. ctdEk19, complete genome 33324-33347 4 0.833
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 MF919502 Mycobacterium phage Demsculpinboyz, complete genome 21980-22003 4 0.833
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 MT889380 Mycobacterium phage Coco12, complete genome 22623-22646 4 0.833
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NC_023698 Mycobacterium phage Avani, complete genome 21987-22010 4 0.833
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 MT114167 Mycobacterium phage Phanphagia, complete genome 22278-22301 4 0.833
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 558871-558894 4 0.833
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1500559-1500582 4 0.833
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 295932-295955 4 0.833
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 1116335-1116358 4 0.833
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 MN096355 Mycobacterium phage Purky, complete genome 48975-48998 4 0.833
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 MK279853 Gordonia phage Gray, complete genome 68404-68427 4 0.833
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 9745-9769 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1906386-1906410 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 794756-794780 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 CP003956 Rhodococcus opacus PD630 plasmid 7, complete sequence 34847-34871 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1665271-1665295 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NC_012723 Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence 15832-15856 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 348896-348920 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 406425-406449 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 CP054917 Streptomyces sp. NA02950 plasmid unnamed, complete sequence 26065-26089 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 450297-450321 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NC_022437 Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence 16147-16171 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1382131-1382155 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1418915-1418939 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_CP051294 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence 118938-118962 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1711697-1711721 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 722328-722352 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_CP010858 Marinovum algicola DG 898 plasmid pMaD3 67000-67024 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_CP033363 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence 118938-118962 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1149411-1149435 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 438623-438647 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_CP014580 Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence 243636-243660 4 0.84
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1410063-1410087 4 0.84
NC_021740_9 9.1|1569515|28|NC_021740|CRISPRCasFinder 1569515-1569542 28 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 818773-818800 4 0.857
NC_021740_9 9.1|1569515|28|NC_021740|CRISPRCasFinder 1569515-1569542 28 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 420542-420569 4 0.857
NC_021740_9 9.1|1569515|28|NC_021740|CRISPRCasFinder 1569515-1569542 28 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 77799-77826 4 0.857
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 176640-176664 4 0.84
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 29428-29452 4 0.84
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 38191-38215 4 0.84
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 MT553342 Microbacterium phage Kelcole, complete genome 51573-51597 4 0.84
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 NC_048068 Microbacterium phage OneinaGillian, complete genome 50894-50918 4 0.84
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 MT310894 Microbacterium phage Tempo, complete genome 51697-51721 4 0.84
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 NZ_CP047175 Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence 42080-42104 4 0.84
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 67777-67801 4 0.84
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 MN034284 Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence 624-648 4 0.84
NC_021740_9 9.14|1570445|25|NC_021740|CRISPRCasFinder 1570445-1570469 25 MN582064 Podoviridae sp. ctka020, complete genome 29274-29298 4 0.84
NC_021740_11 11.5|2083080|24|NC_021740|CRT 2083080-2083103 24 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 680430-680453 4 0.833
NC_021740_11 11.5|2083080|24|NC_021740|CRT 2083080-2083103 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5913119-5913142 4 0.833
NC_021740_11 11.5|2083080|24|NC_021740|CRT 2083080-2083103 24 NZ_CP015007 Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence 143186-143209 4 0.833
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MH001451 Mycobacterium phage Nairb, complete genome 13341-13367 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MF155936 Mycobacterium phage ZenTime222, complete genome 13341-13367 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MK494089 Mycobacterium phage Ibrahim, complete genome 13341-13367 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_024135 Mycobacterium phage Bernal13, complete genome 13341-13367 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 KM591905 Mycobacterium phage RonRayGun, complete genome 13341-13367 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN735432 Mycobacteriophage Whitty, complete genome 13341-13367 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 184795-184821 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP041048 Citrobacter sp. CF971 plasmid pBM527-2, complete sequence 23670-23696 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KX832927 Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence 78774-78800 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KX786648 Enterobacter cloacae strain B557 plasmid pB557-NDM, complete sequence 116361-116387 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KY399975 Enterobacter cloacae strain EClY2403 plasmid pNDM1_EClY2403, complete sequence 106587-106613 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KY399974 Enterobacter cloacae strain EClY2402 plasmid pNDM1_EClY2402, complete sequence 106623-106649 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP053895 Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence 61494-61520 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_AP023051 Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence 125780-125806 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP034756 Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p2, complete sequence 86196-86222 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KX636095 Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence 7181-7207 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KU302802 Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence 61265-61291 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KU302801 Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence 61265-61291 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KJ588779 Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US-2, complete sequence 113433-113459 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KR351290 Klebsiella pneumoniae subsp. pneumoniae strain K351 plasmid pK351, complete sequence 102253-102279 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KJ802405 Providencia stuartii isolate GN576 plasmid pNDM-PstGN576, complete sequence 122600-122626 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KJ812998 Enterobacter cloacae isolate GN574 plasmid pNDM-Ec1GN574, complete sequence 106278-106304 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KP900016 Leclercia adecarboxylata strain P10164 plasmid pP10164-NDM, complete sequence 16154-16180 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KP765744 Enterobacter cloacae strain ECN49 plasmid pNDM-ECN49, complete sequence 51110-51136 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KP868647 Enterobacter cloacae strain WCHECl-14653 plasmid pNDM1_EC14653, complete sequence 106615-106641 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KJ802404 Escherichia coli isolate GN568 plasmid pNDM-EcoGN568, complete sequence 122580-122606 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KT965092 Acinetobacter towneri strain G165 plasmid pNDM-GJ01, complete sequence 19594-19620 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KT965093 Acinetobacter towneri strain G295 plasmid pNDM-GJ02, complete sequence 10570-10596 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_023322 Acinetobacter bereziniae strain CHI-40-1 plasmid pNDM-40-1, complete sequence 12853-12879 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP029731 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence 103664-103690 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KC887916 Escherichia coli strain ARL10/167 isolate EC4 plasmid pEC4-NDM-6, complete sequence 106278-106304 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KC887917 Enterobacter cloacae isolate ECL3 plasmid pECL3-NDM-1, complete sequence 16380-16406 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP020524 Escherichia coli strain 190 plasmid unnamed1, complete sequence 57697-57723 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP010370 Acinetobacter nosocomialis strain 6411 plasmid p6411-9.012kb, complete sequence 21771-21797 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN061454 Enterobacter cloacae strain EC-14-60 plasmid pECL-14-60-NDM-1, complete sequence 15891-15917 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP032278 Acinetobacter sp. WCHAc010034 plasmid pNDM1_010034, complete sequence 32489-32515 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP045561 Acinetobacter nosocomialis strain AC1530 plasmid pAC1530, complete sequence 76076-76102 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_019045 Escherichia coli strain N10-2337 plasmid pNDM102337, complete sequence 122941-122967 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_025130 Raoultella planticola strain RJA274 plasmid NDM-1, complete sequence 47556-47582 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_019158 Klebsiella pneumoniae plasmid pNDM10469, complete sequence 113656-113682 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN310375 Klebsiella quasipneumoniae strain QD1501 plasmid pQD1501-Ct1, complete sequence 107121-107147 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN310377 Klebsiella pneumoniae strain 12085 plasmid p12085-Ct1, complete sequence 64966-64992 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 13111-13137 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 68887-68913 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP037965 Klebsiella pneumoniae strain SCKP020135 plasmid pNDM1_020135, complete sequence 32642-32668 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_025184 Klebsiella pneumoniae strain RJF866 plasmid pRJF866, complete sequence 76625-76651 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 753040-753066 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP011518 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence 469281-469307 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 44665-44691 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP021962 Klebsiella pneumoniae strain AR_0139 plasmid tig00000008, complete sequence 109286-109312 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP022350 Klebsiella michiganensis strain K516 plasmid pK516_NDM1, complete sequence 44827-44853 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP046274 Enterobacter hormaechei strain E70 plasmid pE70-NDM1, complete sequence 34562-34588 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP039811 Klebsiella pneumoniae strain C2660 plasmid pC2660-4-NDM, complete sequence 25489-25515 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 452130-452156 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_025000 Acinetobacter lwoffii strain Iz4b plasmid pNDM-Iz4b, complete sequence 14409-14435 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_024959 Acinetobacter calcoaceticus strain NDM-WS2 plasmid pNDM-WS2, complete sequence 13846-13872 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP014276 Martelella sp. AD-3 plasmid unnamed1, complete sequence 27958-27984 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP021536 Escherichia coli strain AR_0119 plasmid unitig_2, complete sequence 31200-31226 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP010399 Acinetobacter baumannii strain 6200 plasmid p6200-47.274kb, complete sequence 4576-4602 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP035935 Acinetobacter cumulans strain WCHAc060092 plasmid pNDM1_060092, complete sequence 39092-39118 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP006661 Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US, complete sequence 127532-127558 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 CP050164 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence 112307-112333 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MK933278 Enterobacter hormaechei strain SCNJ07 plasmid pNDM-SCNJ07, complete sequence 76625-76651 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 142737-142763 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_019069 Escherichia coli plasmid pNDM10505, complete sequence 123718-123744 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 AMXH01000087 Acinetobacter pittii strain XM1570 plasmid pXM1, complete sequence, whole genome shotgun sequence 14409-14435 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_JQ739158 Acinetobacter lwoffii strain ABZ78 plasmid pABZ78, complete sequence 4497-4523 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP043383 Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence 15205-15231 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_019985 Acinetobacter baumannii ZW85-1 plasmid pAbNDM-1, complete sequence 14409-14435 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP053365 Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence 79689-79715 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP018366 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-2, complete sequence 72160-72186 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP023187 Klebsiella michiganensis strain K518 plasmid pK518_NDM1, complete sequence 83388-83414 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP028786 Klebsiella pneumoniae strain SCKP020049 plasmid pNDM1_020049, complete sequence 16815-16841 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP021936 Escherichia coli strain AR_0055 plasmid unitig_2, complete sequence 63970-63996 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 13111-13137 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP023948 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence 191373-191399 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP041938 Klebsiella pneumoniae strain KP14003 plasmid pNDM-KP14003, complete sequence 29964-29990 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_022589 Providencia rettgeri strain 09ACRGNY2001 plasmid pPrY2001, complete sequence 69940-69966 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP015835 Escherichia coli strain MS6198 plasmid pMS6198A, complete sequence 112277-112303 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 39159-39185 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP014478 Acinetobacter pittii strain AP_882 plasmid pNDM-AP_882, complete sequence 75132-75158 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_023908 Klebsiella pneumoniae strain KP1 plasmid pKP1-NDM-1, complete sequence 113390-113416 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 44920-44946 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_019268 Acinetobacter lwoffii plasmid pNDM-BJ01, complete sequence 14409-14435 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_019281 Acinetobacter lwoffii plasmid pNDM-BJ02, complete sequence 14409-14435 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_025116 Acinetobacter sp. M131 plasmid pM131_NDM1, complete sequence 23010-23036 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP040884 Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence 92178-92204 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP026015 Klebsiella variicola strain 13450 plasmid p13450-3, complete sequence 53095-53121 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_AP018143 Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence 138568-138594 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 625394-625420 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP048797 Providencia vermicola strain P8538 plasmid p8538-NDM-1, complete sequence 112267-112293 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN937240 Enterobacter cloacae strain BSI034 plasmid pBSI034-NDM1, complete sequence 32344-32370 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN603981 Klebsiella aerogenes strain 1564 plasmid p1564, complete sequence 111616-111642 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN604268 Escherichia coli strain J53 plasmid pJ53_SAL-19-0623_NDM, complete sequence 25309-25335 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_LN833432 Acinetobacter baumannii isolate CHI-32 plasmid pNDM-32, complete sequence 52027-52053 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MK123268 Serratia marcescens strain M17468 plasmid pSMA17468, complete sequence 114849-114875 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP053897 Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence 64736-64762 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP032132 Acinetobacter chinensis strain WCHAc010005 plasmid pNDM1_010005, complete sequence 26234-26260 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MH995508 Enterobacter cloacae strain ECL17464 plasmid pECL17464, complete sequence 114850-114876 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MH995506 Citrobacter freundii strain CFR17394 plasmid pCFR17394, complete sequence 114850-114876 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MH917283 Klebsiella pneumoniae strain A575 plasmid pA575-NDM, complete sequence 48495-48521 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MH909345 Klebsiella pneumoniae strain N201205880 plasmid p205880-NDM, complete sequence 27418-27444 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MH105050 Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncA/C-IncX3, complete sequence 214657-214683 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MH909343 Klebsiella pneumoniae strain 1012018 plasmid p12018-NDM, complete sequence 47649-47675 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MH909347 Klebsiella pneumoniae strain 362713 plasmid p362713-NDM, complete sequence 45513-45539 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MH263652 Providencia rettgeri strain QD51 plasmid pNDM-QD51, complete sequence 109516-109542 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MH917281 Klebsiella pneumoniae strain 14504 plasmid p14504-NDM, complete sequence 30627-30653 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MK101346 Citrobacter freundii strain CRE3 plasmid pCRE7-NDM, complete sequence 104043-104069 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MK757441 Alcaligenes faecalis strain AN70 plasmid pAN70-1, complete sequence 49777-49803 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP020090 Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-1, complete sequence 36146-36172 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN657245 Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence 20013-20039 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN657246 Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence 25005-25031 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MF344560 Enterobacter hormaechei strain 128379 plasmid p128379-NDM, complete sequence 51237-51263 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MG462729 Escherichia coli strain AMA1742 plasmid pAMA1742, complete sequence 106279-106305 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP035537 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-2, complete sequence 103992-104018 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 229929-229955 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 229960-229986 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 255318-255344 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KX470734 Escherichia coli strain Ecoli14-55 plasmid pEC55-NDM4, complete sequence 13272-13298 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KY296103 Enterobacter cloacae strain 13E169 plasmid pHN84NDM, complete sequence 2266-2292 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KY978629 Cronobacter sakazakii strain 505108 plasmid p505108-NDM, complete sequence 13374-13400 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MF072961 Citrobacter freundii strain P10159 plasmid pP10159-1, complete sequence 13272-13298 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MF042356 Enterobacter cloacae strain 20ES plasmid pNDM_20ES, complete sequence 34140-34166 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MF042359 Serratia marcescens strain 7209 plasmid pNDM_7209, complete sequence 21406-21432 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KU726616 Salmonella enterica subsp. enterica serovar Stanley strain LS001 plasmid pHS36-NDM, complete sequence 24123-24149 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KU314941 Klebsiella pneumoniae isolate KP04 plasmid pKP04NDM, complete sequence 13271-13297 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KX094555 Escherichia coli strain ZHDC33 plasmid pZHDC33, complete sequence 47455-47481 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KR059864 Klebsiella pneumoniae strain KP-YQ13450 plasmid pYQ12450, complete sequence 2286-2312 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_KP987216 Citrobacter freundii strain 112298 plasmid p112298-NDM, complete sequence 12726-12752 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP022126 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752AC2, complete sequence 136378-136404 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP010373 Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence 3544-3570 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP010373 Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence 179432-179458 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP010373 Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence 188444-188470 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP028588 Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence 33846-33872 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP041930 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence 29605-29631 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP028560 Acinetobacter sp. WCHA45 plasmid pNDM1_010045, complete sequence 52815-52841 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_018994 Escherichia coli plasmid pNDM-1_Dok01, complete sequence 135270-135296 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 68922-68948 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_019153 Klebsiella pneumoniae plasmid pNDM-KN, complete sequence 103553-103579 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_019162 Klebsiella pneumoniae strain CRE380 plasmid pNDM-HN380, complete sequence 13272-13298 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP032878 Escherichia coli strain WCHEC000837 plasmid pNDM4_000837, complete sequence 33327-33353 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP018817 Klebsiella pneumoniae strain AR_0049 plasmid unitig_1, complete sequence 42648-42674 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 495552-495578 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 551870-551896 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 56767-56793 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP048828 Acinetobacter baumannii strain ABF9692 plasmid pABF9692, complete sequence 197048-197074 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP021206 Escherichia coli strain Z1002 plasmid p1002-NDM1, complete sequence 7496-7522 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP050416 Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence 53320-53346 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP032284 Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence 50298-50324 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_020811 Klebsiella pneumoniae strain KPN5047 plasmid pKPN5047, complete sequence 13272-13298 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP050426 Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence 53320-53346 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_023914 Enterobacter cloacae strain CRE727 plasmid pNDM-HF727, complete sequence 13272-13298 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP044035 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence 12359-12385 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP029118 Escherichia coli strain AR435 plasmid unnamed5, complete sequence 105092-105118 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 248919-248945 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN178638 Kluyvera cryocrescens strain SCW13 plasmid pNDM1_SCW13, complete sequence 13049-13075 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP038280 Raoultella ornithinolytica strain WLK218 plasmid pWLK-NDM, complete sequence 29501-29527 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 163996-164022 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 CP050158 Enterobacter cloacae plasmid Carbapenemase(NDM-1)_IncX3, complete sequence 23151-23177 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 47983-48009 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 CP050161 Escherichia coli plasmid Carbapenemase(NDM-1)_IncX3, complete sequence 51656-51682 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 226890-226916 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_021501 Klebsiella michiganensis E718 plasmid pKOX_NDM1, complete sequence 34134-34160 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP017672 Providencia rettgeri strain RB151 plasmid pRB151-NDM, complete sequence 49428-49454 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP023914 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed3, complete sequence 80289-80315 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP029386 Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pNDM6_040074, complete sequence 24220-24246 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP022226 Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence 33319-33345 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 105230-105256 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_020552 Citrobacter freundii plasmid pYE315203, complete sequence 13275-13301 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP040598 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15_NDM-1, complete sequence 87825-87851 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP014297 Klebsiella pneumoniae strain KP38731 plasmid unnamed13 sequence 47173-47199 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP020056 Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence 35229-35255 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP031884 Klebsiella pneumoniae strain WCHKP095845 plasmid pNDM1_095845, complete sequence 53720-53746 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP031297 Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence 122282-122308 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP041229 Acinetobacter haemolyticus strain AN54 plasmid pAhaeAN54e, complete sequence 39040-39066 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN604267 Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence 208327-208353 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MK372385 Morganella morganii strain ABC140 plasmid pABC140-NDM-1, complete sequence 12840-12866 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MK372381 Klebsiella pneumoniae strain ABC52 plasmid pABC52-NDM-1, complete sequence 13272-13298 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP053899 Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence 127861-127887 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN657249 Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence 116167-116193 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN657250 Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence 116203-116229 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MH909333 Klebsiella pneumoniae strain 7-SP plasmid p7SP-NDM, complete sequence 13272-13298 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MH909346 Klebsiella pneumoniae strain 20130907-4 plasmid p309074-NDM, complete sequence 13272-13298 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MH909335 Klebsiella pneumoniae strain 11-SP plasmid p11SP-NDM, complete sequence 13271-13297 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MH234505 Escherichia coli strain CRE3694 plasmid pNDM-HK3694, complete sequence 13272-13298 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MH917282 Klebsiella pneumoniae strain A457 plasmid pA457-NDA, complete sequence 13269-13295 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MH349095 Escherichia coli strain 948 plasmid pMTC948, complete sequence 2266-2292 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MK372386 Klebsiella pneumoniae strain BC700 plasmid pBC700-NDM-1, complete sequence 13272-13298 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MK372380 Enterobacter cloacae strain ABC40 plasmid pABC40-NDM-1, complete sequence 13272-13298 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MK372382 Escherichia coli strain ABC54 plasmid pABC54-NDM-1, complete sequence 13272-13298 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN657241 Enterobacteriaceae bacterium strain 20-16 plasmid pCF104a-T3, complete sequence 137520-137546 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN657242 Enterobacteriaceae bacterium strain 128-16 plasmid pEC405a-T3, complete sequence 49557-49583 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN657243 Enterobacteriaceae bacterium strain 24-16 plasmid pEC744-T5, complete sequence 109132-109158 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN657244 Enterobacteriaceae bacterium strain 690-16 plasmid pEC6332-T3, complete sequence 76292-76318 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN657247 Enterobacteriaceae bacterium strain 460-16 plasmid pECl-T3, complete sequence 55946-55972 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MG462728 Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence 107928-107954 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MH457126 Vibrio alginolyticus strain Vb1394 plasmid pC1394, complete sequence 118250-118276 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MH105052 Escherichia coli strain EC600 plasmid pSL131T_IncX3, complete sequence 11302-11328 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP044464 Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-1, complete sequence 94334-94360 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MF042350 Klebsiella pneumoniae strain 18ES plasmid pNDM_18ES, complete sequence 33810-33836 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MF042354 Klebsiella pneumoniae strain 6TM plasmid pNDM_6TM, complete sequence 34092-34118 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MF042353 Klebsiella pneumoniae strain 1TM plasmid pNDM_1TM, complete sequence 33557-33583 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MF042351 Serratia marcescens strain 12TM plasmid pNDM_12TM, complete sequence 33543-33569 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MF042358 Enterobacter cloacae strain 22ES plasmid pNDM_22ES, complete sequence 23756-23782 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MF415608 Enterobacter cloacae strain hhy03 plasmid pNDM-BJ03, complete sequence 13272-13298 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MF042352 Serratia marcescens strain 4TM plasmid pNDM_4TM, complete sequence 33557-33583 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MF042357 Serratia marcescens strain 9580 plasmid pNDM_9580, complete sequence 28922-28948 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_MG252893 Raoultella ornithinolytica strain pRor-30818cz plasmid Ror-30818cz, complete sequence 46124-46150 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 928967-928993 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP011481 Hoeflea sp. IMCC20628 plasmid, complete sequence 91924-91950 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 530727-530753 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 187983-188009 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2133260-2133286 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 369098-369124 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN694268 Marine virus AFVG_250M110, complete genome 12878-12904 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN694268 Marine virus AFVG_250M110, complete genome 12887-12913 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN694268 Marine virus AFVG_250M110, complete genome 12896-12922 4 0.852
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 422918-422944 4 0.852
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NC_014811 Mycolicibacterium gilvum Spyr1 plasmid pMSPYR101, complete sequence 128463-128489 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NC_019847 Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence 105554-105580 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 1261477-1261503 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 11886-11912 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP018865 Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence 61148-61174 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP021796 Sinorhizobium meliloti strain USDA1157 plasmid accessoryA, complete sequence 160520-160546 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2508229-2508255 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1611128-1611154 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 93204-93230 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NC_009717 Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence 255394-255420 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 96504-96530 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 92145-92171 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 93613-93639 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 90700-90726 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 96481-96507 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 92145-92171 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 96504-96530 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 84863-84889 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1809239-1809265 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1711620-1711646 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 363402-363428 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 KM659098 Sinorhizobium sp. LM21 plasmid pLM21S1, complete sequence 95760-95786 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1781836-1781862 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1710642-1710668 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1711613-1711639 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1710934-1710960 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1711602-1711628 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1809418-1809444 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 1217170-1217196 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1809416-1809442 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1809385-1809411 5 0.815
NC_021740_2 2.6|335718|24|NC_021740|CRT 335718-335741 24 NZ_CP030829 Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence 94125-94148 5 0.792
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 214915-214947 5 0.848
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 206654-206686 5 0.848
NC_021740_3 3.1|366505|27|NC_021740|CRISPRCasFinder 366505-366531 27 LR794124 Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1 34861-34887 5 0.815
NC_021740_3 3.1|366505|27|NC_021740|CRISPRCasFinder 366505-366531 27 NC_012662 Vibrio phage VP93, complete genome 35301-35327 5 0.815
NC_021740_3 3.7|366901|27|NC_021740|CRISPRCasFinder 366901-366927 27 NZ_CP016084 Streptomyces sp. SAT1 plasmid unnamed4, complete sequence 2189-2215 5 0.815
NC_021740_3 3.7|366901|27|NC_021740|CRISPRCasFinder 366901-366927 27 MN693945 Marine virus AFVG_250M952, complete genome 34909-34935 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 369429-369455 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 338832-338858 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 363377-363403 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP015368 Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence 104717-104743 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 338543-338569 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 340811-340837 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 342690-342716 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 343060-343086 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 355714-355740 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 343060-343086 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 348335-348361 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 343052-343078 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP020444 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence 69464-69490 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 363377-363403 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 355714-355740 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 342690-342716 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP044078 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence 10340-10366 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP031081 Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence 19365-19391 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 MN586031 Gordonia phage Gambino, complete genome 3053-3079 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 KU998236 Gordonia phage Blueberry, complete genome 3053-3079 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 MN062704 Gordonia phage JuJu, complete genome 3063-3089 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 MK501729 Gordonia phage Walrus, complete genome 3053-3079 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NC_031226 Gordonia phage BaxterFox, complete genome 2982-3008 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 MK967393 Rhodococcus phage Whack, complete genome 3063-3089 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 MT723935 Gordonia phage Azula, complete genome 3053-3079 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 KU963249 Gordonia phage Yeezy, complete genome 2982-3008 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 MH153808 Gordonia phage Petra, complete genome 3053-3079 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 MT639650 Gordonia phage Ohgeesy, complete genome 2982-3008 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 MH536818 Gordonia phage Frokostdame, complete genome 3055-3081 5 0.815
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 KX557275 Gordonia phage CarolAnn, complete genome 3052-3078 5 0.815
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 CP009871 Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence 29372-29398 5 0.815
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 406756-406782 5 0.815
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP045223 Achromobacter xylosoxidans strain DN002 plasmid unnamed 110954-110980 5 0.815
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 274700-274726 5 0.815
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1370465-1370491 5 0.815
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 761910-761936 5 0.815
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1027970-1027996 5 0.815
NC_021740_6 6.10|925729|27|NC_021740|CRT 925729-925755 27 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 1800-1826 5 0.815
NC_021740_6 6.10|925729|27|NC_021740|CRT 925729-925755 27 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 136919-136945 5 0.815
NC_021740_6 6.10|925729|27|NC_021740|CRT 925729-925755 27 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 658056-658082 5 0.815
NC_021740_6 6.10|925729|27|NC_021740|CRT 925729-925755 27 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1514868-1514894 5 0.815
NC_021740_6 6.10|925729|27|NC_021740|CRT 925729-925755 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5852040-5852066 5 0.815
NC_021740_6 6.10|925729|27|NC_021740|CRT 925729-925755 27 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 235006-235032 5 0.815
NC_021740_6 6.10|925729|27|NC_021740|CRT 925729-925755 27 NZ_CP049700 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence 263243-263269 5 0.815
NC_021740_6 6.10|925729|27|NC_021740|CRT 925729-925755 27 MH576962 Streptomyces phage Satis, complete genome 95306-95332 5 0.815
NC_021740_6 6.10|925729|27|NC_021740|CRT 925729-925755 27 MK620894 Streptomyces phage Kradal, complete genome 95310-95336 5 0.815
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1068923-1068952 5 0.833
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1739900-1739929 5 0.833
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 233389-233418 5 0.833
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP031193 Humibacter sp. BT305 plasmid unnamed1 44938-44967 5 0.833
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 137673-137702 5 0.833
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 984252-984281 5 0.833
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1598936-1598965 5 0.833
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 233398-233427 5 0.833
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP046705 Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence 292905-292934 5 0.833
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 AY950802 Haloarcula phage SH1, complete genome 16104-16133 5 0.833
NC_021740_6 6.16|926014|24|NC_021740|CRT 926014-926037 24 NC_006911 Streptomyces sp. F11 plasmid pFP11, complete sequence 11649-11672 5 0.792
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MG925349 Mycobacterium phage Mendokysei, complete genome 21052-21085 5 0.853
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3841167-3841191 5 0.8
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NC_015178 Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence 157500-157524 5 0.8
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NZ_CP035002 Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence 179155-179179 5 0.8
NC_021740_8 8.4|1210802|25|NC_021740|CRISPRCasFinder 1210802-1210826 25 NC_009469 Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence 67026-67050 5 0.8
NC_021740_9 9.1|1569515|28|NC_021740|CRISPRCasFinder 1569515-1569542 28 NZ_LN907828 Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence 94483-94510 5 0.821
NC_021740_9 9.1|1569515|28|NC_021740|CRISPRCasFinder 1569515-1569542 28 KU728633 Mycobacterium phage Bipper, complete genome 41992-42019 5 0.821
NC_021740_9 9.1|1569515|28|NC_021740|CRISPRCasFinder 1569515-1569542 28 MK977701 Mycobacterium phage Cracklewink, complete genome 41985-42012 5 0.821
NC_021740_9 9.1|1569515|28|NC_021740|CRISPRCasFinder 1569515-1569542 28 NZ_CP016354 Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence 100320-100347 5 0.821
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 614111-614135 5 0.8
NC_021740_9 9.5|1569737|25|NC_021740|CRISPRCasFinder 1569737-1569761 25 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 92705-92729 5 0.8
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NC_018746 Pseudomonas putida ND6 plasmid pND6-2, complete sequence 45440-45470 5 0.839
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 MN961671 Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence 123562-123592 5 0.839
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 MN961672 Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence 72551-72581 5 0.839
NC_021740_9 9.13|1570379|34|NC_021740|CRISPRCasFinder 1570379-1570412 34 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 89410-89443 5 0.853
NC_021740_10 10.2|1634254|27|NC_021740|CRT 1634254-1634280 27 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 614863-614889 5 0.815
NC_021740_10 10.2|1634254|27|NC_021740|CRT 1634254-1634280 27 NZ_CP030832 Neorhizobium sp. NCHU2750 plasmid pNCHU2750d, complete sequence 190341-190367 5 0.815
NC_021740_10 10.2|1634254|27|NC_021740|CRT 1634254-1634280 27 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 433676-433702 5 0.815
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 NC_010850 Rhodococcus sp. NS1 plasmid pNSL1, complete sequence 92901-92931 5 0.839
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 261362-261388 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP053729 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence 70396-70422 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP053737 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence 7087-7113 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MT077883 Escherichia coli plasmid p23, complete sequence 17924-17950 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_009838 Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence 100658-100684 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP013221 Salmonella enterica subsp. enterica serovar Anatum strain GT-01 plasmid PDM02, complete sequence 80483-80509 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP024285 Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence 63441-63467 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 413350-413376 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 CP049307 Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N58631 plasmid p58631, complete sequence 190886-190912 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_009140 Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence 130142-130168 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP012168 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-239.973kb, complete sequence 148533-148559 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 1809833-1809859 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_012690 Escherichia coli plasmid peH4H, complete sequence 95723-95749 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 865254-865280 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 CP048298 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-1, complete sequence 86449-86475 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_019066 Escherichia coli plasmid pAPEC1990_61, complete sequence 114748-114774 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_021813 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_01, complete sequence 86572-86598 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_012692 Escherichia coli plasmid pAR060302, complete sequence 120198-120224 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 595762-595788 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP037904 Escherichia coli strain LHM10-1 plasmid unnamed1, complete sequence 31972-31998 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MK994522 Methanobacterium virus PhiF1, complete genome 30763-30789 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP013224 Salmonella enterica subsp. enterica serovar Anatum strain GT-38 plasmid PDM04, complete sequence 31668-31694 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP009413 Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence 32263-32289 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP048296 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence 87780-87806 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1292790-1292816 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 CP049311 Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N53023 plasmid pN53023, complete sequence 310424-310450 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP030191 Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence 10321-10347 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_019123 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH1148_107, complete sequence 14493-14519 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 65696-65722 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 168895-168921 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 299551-299577 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 132825-132851 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 651243-651269 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP027409 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence 111083-111109 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP027409 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence 217269-217295 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_LT985293 Escherichia coli strain 4410-1 plasmid RCS79_p, complete sequence 17773-17799 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_LT985268 Escherichia coli strain 699 plasmid RCS58_p, complete sequence 20078-20104 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP046705 Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence 292866-292892 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 97020-97046 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1118329-1118355 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP023072 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence 181401-181427 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 1018658-1018684 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 JN698993 Mycobacterium phage Firecracker, complete genome 29206-29232 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP010957 Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence 302850-302876 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 39713-39739 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 809205-809231 5 0.815
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP021821 Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence 339366-339392 5 0.815
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NC_012520 Rhodococcus opacus B4 plasmid pROB01, complete sequence 436739-436765 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 540591-540617 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 655808-655834 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1811844-1811870 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 2049443-2049469 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1981994-1982020 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1983962-1983988 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 242852-242878 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 2003562-2003588 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 271563-271589 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP024582 Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence 341357-341383 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022365 Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence 174892-174918 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 2046790-2046816 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 1037652-1037678 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013108 Sinorhizobium americanum strain CFNEI 73 plasmid A, complete sequence 178980-179006 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 2077882-2077908 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1983971-1983997 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 143577-143603 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1697178-1697204 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1983960-1983986 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1984252-1984278 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 578190-578216 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1018924-1018950 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 213542-213568 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 2055120-2055146 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1764746-1764772 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1989804-1989830 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 2118383-2118409 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP028919 Gemmobacter sp. HYN0069 plasmid unnamed1, complete sequence 214234-214260 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1985494-1985520 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 2058242-2058268 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1932725-1932751 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1921115-1921141 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1985315-1985341 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 2066590-2066616 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 2058167-2058193 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1959014-1959040 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 2037255-2037281 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 2058950-2058976 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1932669-1932695 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 60210-60236 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 462412-462438 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 2077892-2077918 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1964789-1964815 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1959327-1959353 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 2037255-2037281 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 2059070-2059096 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1959015-1959041 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP033323 Azospirillum brasilense strain Cd plasmid p5, complete sequence 24210-24236 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1965437-1965463 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1958218-1958244 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 2037255-2037281 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 2037255-2037281 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 2037255-2037281 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 2059045-2059071 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 2118441-2118467 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP012919 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence 62999-63025 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 2059076-2059102 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1964813-1964839 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1972690-1972716 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1953322-1953348 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 2017399-2017425 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 2045520-2045546 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 2034570-2034596 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 2059076-2059102 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1964813-1964839 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1959326-1959352 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1992962-1992988 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 2058032-2058058 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1964813-1964839 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1964813-1964839 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 2059066-2059092 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 2037260-2037286 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 2117391-2117417 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 2059098-2059124 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 2058899-2058925 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 2117391-2117417 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 KY555145 Caulobacter phage Ccr29, complete genome 2421-2447 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 KY555145 Caulobacter phage Ccr29, complete genome 218448-218474 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 KY555143 Caulobacter phage Ccr2, complete genome 2433-2459 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 KY555143 Caulobacter phage Ccr2, complete genome 211607-211633 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 KY555142 Caulobacter phage Ccr10, complete genome 2421-2447 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 KY555142 Caulobacter phage Ccr10, complete genome 211120-211146 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 646666-646692 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 668290-668316 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1951844-1951870 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 313703-313729 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 507931-507957 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 934827-934853 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 87548-87574 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 2019366-2019392 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 449766-449792 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 463742-463768 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 414879-414905 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 161505-161531 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1104222-1104248 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1333567-1333593 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP032344 Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence 120446-120472 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 1074107-1074133 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 168613-168639 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 87299-87325 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 157699-157725 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP033317 Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence 44020-44046 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP023738 Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence 117441-117467 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP025188 Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence 85937-85963 6 0.778
NC_021740_2 2.7|335763|30|NC_021740|CRT 335763-335792 30 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 1092456-1092485 6 0.8
NC_021740_2 2.7|335763|30|NC_021740|CRT 335763-335792 30 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 550210-550239 6 0.8
NC_021740_2 2.7|335763|30|NC_021740|CRT 335763-335792 30 KC292025 Halovirus HHTV-1, complete genome 36019-36048 6 0.8
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 449569-449601 6 0.818
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 19750-19782 6 0.818
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1238001-1238033 6 0.818
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1242682-1242714 6 0.818
NC_021740_3 3.1|366505|27|NC_021740|CRISPRCasFinder 366505-366531 27 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 207335-207361 6 0.778
NC_021740_3 3.6|366835|33|NC_021740|CRISPRCasFinder 366835-366867 33 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 435770-435802 6 0.818
NC_021740_3 3.7|366901|27|NC_021740|CRISPRCasFinder 366901-366927 27 NZ_CP022542 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence 32942-32968 6 0.778
NC_021740_3 3.9|367051|27|NC_021740|CRISPRCasFinder 367051-367077 27 NC_009959 Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence 50750-50776 6 0.778
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_CP009112 Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence 179708-179734 6 0.778
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4846911-4846937 6 0.778
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 78863-78889 6 0.778
NC_021740_3 3.10|367111|27|NC_021740|CRISPRCasFinder 367111-367137 27 MK494099 Mycobacterium phage Typha, complete genome 33831-33857 6 0.778
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1565268-1565297 6 0.8
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 KX620751 Propionibacterium phage Doucette, complete genome 8876-8905 6 0.8
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NC_041891 Propionibacterium phage B22, complete genome 8817-8846 6 0.8
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NC_041894 Propionibacterium phage E6, complete genome 8927-8956 6 0.8
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 KX620754 Propionibacterium phage G4, complete genome 8865-8894 6 0.8
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 575683-575712 6 0.8
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1829167-1829196 6 0.8
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 MT818419 Mycobacterium phage Lolalove, complete genome 27446-27475 6 0.8
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 MN428050 Mycobacterium phage Apex, complete genome 27615-27644 6 0.8
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 MN234171 Mycobacterium phage Magpie, complete genome 27275-27304 6 0.8
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 KX589269 Mycobacterium phage Fortunato, complete genome 27431-27460 6 0.8
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NC_042035 Mycobacterium phage Zemanar, complete sequence 27435-27464 6 0.8
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NC_022331 Mycobacterium phage Bane1, complete genome 27108-27137 6 0.8
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 KF279413 Mycobacterium phage Bane2, complete genome 27087-27116 6 0.8
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 MT310870 Mycobacterium phage RawrgerThat, complete genome 27434-27463 6 0.8
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 GQ141189 Bifidobacterium phage Bbif-1, complete sequence 38062-38092 6 0.806
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_LN907829 Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence 65197-65223 6 0.778
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP041653 Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence 99569-99595 6 0.778
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010826 Thermus aquaticus Y51MC23 plasmid pTA78, complete sequence 43689-43715 6 0.778
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 122394-122420 6 0.778
NC_021740_6 6.10|925729|27|NC_021740|CRT 925729-925755 27 NZ_AP021845 Azospira sp. I09 plasmid pAZI09, complete sequence 147990-148016 6 0.778
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 508-537 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 280809-280838 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 561652-561681 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 554428-554457 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 542116-542145 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 610786-610815 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 571170-571199 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1563589-1563618 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 421135-421164 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1217050-1217079 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1265979-1266008 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1135414-1135443 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP037868 Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence 5790-5819 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1195134-1195163 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1134511-1134540 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 762260-762289 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1168711-1168740 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1168700-1168729 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1135406-1135435 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1134762-1134791 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1135397-1135426 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1217165-1217194 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1217149-1217178 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1217142-1217171 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NC_019408 Caulobacter phage CcrRogue, complete genome 180466-180495 6 0.8
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 174181-174210 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP017941 Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence 270228-270257 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 MK937608 Microbacterium phage Cressida, complete genome 54022-54051 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 554437-554466 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 542125-542154 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP017592 Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence 7337-7366 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP008898 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence 43955-43984 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP023489 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence 73653-73682 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP043515 Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence 36331-36360 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 571179-571208 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 317155-317184 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 116386-116415 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP050069 Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence 79588-79617 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP039425 Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence 132572-132601 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP009856 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence 26128-26157 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP039430 Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence 132570-132599 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP040937 Hymenobacter sp. DG01 plasmid unnamed, complete sequence 32030-32059 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 14031-14060 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 17715-17744 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP006588 Hymenobacter sp. APR13 plasmid pHA, complete sequence 19031-19060 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1930897-1930926 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190353-190382 6 0.8
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 MH029534 Myoviridae environmental samples clone NHS-Seq2, complete sequence 34123-34152 6 0.8
NC_021740_6 6.17|926056|36|NC_021740|CRT 926056-926091 36 MT723940 Mycobacterium phage Ellie, complete genome 24126-24161 6 0.833
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3466597-3466630 6 0.824
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210883-2210916 6 0.824
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 283764-283797 6 0.824
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 445248-445281 6 0.824
NC_021740_9 9.1|1569515|28|NC_021740|CRISPRCasFinder 1569515-1569542 28 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 39276-39303 6 0.786
NC_021740_9 9.1|1569515|28|NC_021740|CRISPRCasFinder 1569515-1569542 28 NC_008703 Mycobacterium sp. KMS plasmid pMKMS01, complete sequence 76834-76861 6 0.786
NC_021740_9 9.1|1569515|28|NC_021740|CRISPRCasFinder 1569515-1569542 28 NZ_LR594663 Variovorax sp. RA8 plasmid 2 131793-131820 6 0.786
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 27764-27794 6 0.806
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 438646-438676 6 0.806
NC_021740_9 9.13|1570379|34|NC_021740|CRISPRCasFinder 1570379-1570412 34 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 28989-29022 6 0.824
NC_021740_10 10.2|1634254|27|NC_021740|CRT 1634254-1634280 27 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 85851-85877 6 0.778
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 NC_009478 Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence 8328-8358 6 0.806
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 56814-56846 6 0.818
NC_021740_16 16.8|3928590|36|NC_021740|CRT 3928590-3928625 36 NZ_CP054842 Acidovorax sp. 16-35-5 plasmid unnamed2, complete sequence 107094-107129 6 0.833
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 246478-246504 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 CP047389 Agrobacterium sp. CGMCC 11546 plasmid pA 17057-17083 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 262599-262625 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 508037-508063 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 258384-258410 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1105171-1105197 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP010860 Marinovum algicola DG 898 plasmid pMaD5, complete sequence 5768-5794 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2674981-2675007 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 382698-382724 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 AY129335 Mycobacterium virus Corndog, complete genome 30053-30079 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_004685 Mycobacterium phage Corndog, complete genome 30053-30079 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MG099943 Mycobacterium phage Familton, complete genome 28995-29021 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN585964 Mycobacterium phage Blessica, complete genome 29302-29328 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 KJ829260 Mycobacterium phage YungJamal, complete genome 29901-29927 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_022057 Mycobacterium phage Catdawg, complete genome 28991-29017 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 MN428052 Mycobacterium phage Smooch, complete genome 30724-30750 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_048047 Caulobacter phage CcrBL9, complete genome 102704-102730 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1227209-1227235 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_007713 Sodalis glossinidius str. 'morsitans' plasmid pSG1, complete sequence 40332-40358 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_014840 Pantoea sp. At-9b plasmid pPAT9B03, complete sequence 185222-185248 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP032313 Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence 273411-273437 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_LN854558 Sodalis glossinidius str. 'morsitans' isolate B4 plasmid pSG1, complete sequence 47773-47799 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1227216-1227242 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP013528 Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence 328914-328940 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_LT960615 Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence 107625-107651 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP033036 Agrobacterium fabrum strain 12D13 plasmid pAt12D13a, complete sequence 164344-164370 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1814495-1814521 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP013581 Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence 328917-328943 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 534058-534084 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_007182 Sodalis glossinidius pSG1 plasmid from Glossina austeni 10951-10977 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_007183 Sodalis glossinidius pSG1 plasmid from Glossina palpalis palpalis 10951-10977 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP053024 Sphingobium yanoikuyae strain YC-XJ2 plasmid p-C-Sy, complete sequence 38777-38803 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_003064 Agrobacterium fabrum str. C58 plasmid At, complete sequence 78562-78588 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_AP022338 Mameliella alba strain KU6B plasmid pKUB257, complete sequence 78756-78782 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP021816 Sinorhizobium meliloti strain M270 plasmid accessoryB, complete sequence 86331-86357 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1154136-1154162 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1100732-1100758 6 0.778
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NZ_CP033024 Agrobacterium fabrum strain 1D132 plasmid pAt1D132a, complete sequence 150808-150834 6 0.778
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 204550-204576 7 0.741
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 201917-201943 7 0.741
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 895354-895380 7 0.741
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 204547-204573 7 0.741
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 204450-204476 7 0.741
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 203023-203049 7 0.741
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 698548-698574 7 0.741
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 208481-208507 7 0.741
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 215230-215256 7 0.741
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 203023-203049 7 0.741
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 204450-204476 7 0.741
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 514068-514094 7 0.741
NC_021740_2 2.4|335619|27|NC_021740|CRT 335619-335645 27 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 986924-986950 7 0.741
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1247285-1247317 7 0.788
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 646877-646909 7 0.788
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 240410-240442 7 0.788
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 382783-382815 7 0.788
NC_021740_3 3.4|366700|27|NC_021740|CRISPRCasFinder 366700-366726 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 48081-48107 7 0.741
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2600082-2600111 7 0.767
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2593965-2593994 7 0.767
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 110413-110442 7 0.767
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 444400-444429 7 0.767
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 741115-741144 7 0.767
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NZ_CP012478 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence 144936-144965 7 0.767
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 444383-444412 7 0.767
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 66483-66512 7 0.767
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 320484-320513 7 0.767
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NC_042034 Mycobacterium phage ChrisnMich, complete sequence 26400-26429 7 0.767
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 MK977708 Mycobacterium phage Fulbright, complete genome 10281-10311 7 0.774
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 MG099948 Mycobacterium phage Philonius, complete genome 10281-10311 7 0.774
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 MH926055 Mycobacterium phage Chewbacca, complete genome 10281-10311 7 0.774
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 MT723932 Mycobacterium phage Schnauzer, complete genome 10281-10311 7 0.774
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 KU935726 Mycobacterium phage Xerxes, complete genome 10281-10311 7 0.774
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 KU935730 Mycobacterium phage Pipsqueaks, complete genome 10281-10311 7 0.774
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 MH316570 Mycobacterium phage Silvafighter, complete genome 10281-10311 7 0.774
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 MK524518 Mycobacterium phage Smurph, complete genome 10281-10311 7 0.774
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 MK524515 Mycobacterium phage Parmesanjohn, complete genome 10281-10311 7 0.774
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 MH697585 Mycobacterium phage Gex, complete genome 10280-10310 7 0.774
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 KM588359 Mycobacterium phage Carcharodon, complete genome 10281-10311 7 0.774
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 MH697576 Mycobacterium phage Aggie, complete genome 10282-10312 7 0.774
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 MH697593 Mycobacterium phage Tapioca, complete genome 10281-10311 7 0.774
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 MG099936 Mycobacterium phage Andies, complete genome 10281-10311 7 0.774
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 NC_031243 Mycobacterium phage Xeno, complete genome 10281-10311 7 0.774
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 JN256079 Mycobacterium phage Charlie, complete genome 10281-10311 7 0.774
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010614 Phaeobacter inhibens strain P92 plasmid pP92_d, complete sequence 8847-8873 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010626 Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence 8847-8873 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010671 Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence 8847-8873 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 191833-191859 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010598 Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence 8865-8891 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NC_018288 Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence 57481-57507 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP031955 Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence 62982-63008 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP016368 Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence 8876-8902 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NC_018422 Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence 62746-62772 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 195710-195736 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 195702-195728 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010605 Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence 8848-8874 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010744 Phaeobacter inhibens strain P59 plasmid pP59_c, complete sequence 8847-8873 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010622 Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence 8847-8873 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010732 Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence 8836-8862 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010655 Phaeobacter inhibens strain P54 plasmid pP54_e, complete sequence 8835-8861 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010711 Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence 8848-8874 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010702 Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence 8847-8873 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010748 Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence 8847-8873 7 0.741
NC_021740_6 6.6|925573|27|NC_021740|CRT 925573-925599 27 NZ_CP010739 Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence 8824-8850 7 0.741
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 943873-943902 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 392100-392129 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1838430-1838459 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 616186-616215 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 397449-397478 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1703655-1703684 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 212329-212358 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 679499-679528 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1744018-1744047 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1760732-1760761 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 178925-178954 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 75369-75398 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 153012-153041 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 589998-590027 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 81538-81567 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 845884-845913 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 258296-258325 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1723933-1723962 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1859622-1859651 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1841724-1841753 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1841724-1841753 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 137321-137350 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 258496-258525 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 257917-257946 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 234345-234374 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 461507-461536 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 254201-254230 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 236985-237014 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 298368-298397 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 258487-258516 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 461579-461608 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 390422-390451 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1964821-1964850 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 461516-461545 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 237930-237959 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 849014-849043 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1227007-1227036 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 238244-238273 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 245279-245308 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 235437-235466 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 126762-126791 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 234570-234599 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 258309-258338 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 231309-231338 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 235690-235719 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 238261-238290 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 251052-251081 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 298440-298469 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 230351-230380 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 461938-461967 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 438995-439024 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 245262-245291 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 245236-245265 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 241864-241893 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 240004-240033 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 235466-235495 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 280525-280554 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 251050-251079 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 HM560026 Uncultured bacterium plasmid pTRACA45, complete sequence 1764-1793 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NC_010867 Neisseria lactamica plasmid pNL3.1, complete sequence 3216-3245 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP020471 Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence 121720-121749 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 535160-535189 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 326858-326887 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 121664-121693 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 KT997827 Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome 28429-28458 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 235977-236006 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1424992-1425021 7 0.767
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 KT997829 Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome 24686-24715 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 278785-278814 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 113824-113853 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 158849-158878 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 384914-384943 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 317121-317150 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP020909 Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence 385410-385439 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP024423 Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence 260932-260961 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 329309-329338 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NC_021908 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence 391416-391445 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP020441 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence 243975-244004 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 301676-301705 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 201076-201105 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 635292-635321 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 422833-422862 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 494408-494437 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 MN582086 Siphoviridae sp. ctdEk19, complete genome 33318-33347 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 864583-864612 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP022700 Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence 61493-61522 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 1238691-1238720 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1484042-1484071 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 1466967-1466996 7 0.767
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP031082 Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence 119508-119537 7 0.767
NC_021740_6 6.17|926056|36|NC_021740|CRT 926056-926091 36 NC_022087 Mycobacterium phage AnnaL29, complete genome 5558-5593 7 0.806
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210628-2210661 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2209827-2209860 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP025548 Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence 24930-24963 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2133215-2133248 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MT889380 Mycobacterium phage Coco12, complete genome 22836-22869 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MT114167 Mycobacterium phage Phanphagia, complete genome 22491-22524 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 531146-531179 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 117310-117343 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 254574-254607 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP039641 Azospirillum sp. TSH100 plasmid p2, complete sequence 30914-30947 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MH697583 Mycobacterium phage EricMillard, complete genome 32257-32290 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MH727551 Mycobacterium phage Kalah2, complete genome 32307-32340 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MH077579 Mycobacterium phage Halley, complete genome 31970-32003 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MH669017 Mycobacterium phage Zelink, complete genome 33051-33084 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MN062701 Mycobacterium phage Dallas, complete genome 31496-31529 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MK524527 Mycobacterium phage ThreeRngTarjay, complete genome 32107-32140 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MK524529 Mycobacterium phage Phoebus, complete genome 32257-32290 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MF919512 Mycobacterium phage Klein, complete genome 31531-31564 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 KF114875 Mycobacterium phage Redno2, complete genome 31720-31753 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MK967379 Mycobacterium phage HokkenD, complete genome 31519-31552 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 307986-308019 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 178492-178525 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 275379-275412 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 445383-445416 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 275378-275411 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MN813686 Mycobacterium phage BirdsNest, complete genome 30327-30360 7 0.794
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_042035 Mycobacterium phage Zemanar, complete sequence 31516-31549 7 0.794
NC_021740_8 8.9|1211066|37|NC_021740|CRISPRCasFinder 1211066-1211102 37 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 136890-136926 7 0.811
NC_021740_9 9.1|1569515|28|NC_021740|CRISPRCasFinder 1569515-1569542 28 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 259627-259654 7 0.75
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 281800-281830 7 0.774
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 CP017041 Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence 68407-68437 7 0.774
NC_021740_10 10.2|1634254|27|NC_021740|CRT 1634254-1634280 27 NZ_CP048637 Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence 280931-280957 7 0.741
NC_021740_11 11.3|2082990|30|NC_021740|CRT 2082990-2083019 30 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 52187-52216 7 0.767
NC_021740_11 11.3|2082990|30|NC_021740|CRT 2082990-2083019 30 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 75140-75169 7 0.767
NC_021740_11 11.3|2082990|30|NC_021740|CRT 2082990-2083019 30 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 376489-376518 7 0.767
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 147567-147597 7 0.774
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 NZ_CP012186 Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence 36995-37025 7 0.774
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 NZ_CP042263 Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence 372247-372277 7 0.774
NC_021740_16 16.3|3928209|36|NC_021740|CRT 3928209-3928244 36 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261173-261208 7 0.806
NC_021740_16 16.3|3928209|36|NC_021740|CRT 3928209-3928244 36 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 306649-306684 7 0.806
NC_021740_16 16.3|3928209|36|NC_021740|CRT 3928209-3928244 36 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1085515-1085550 7 0.806
NC_021740_16 16.3|3928209|36|NC_021740|CRT 3928209-3928244 36 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1151737-1151772 7 0.806
NC_021740_16 16.3|3928209|36|NC_021740|CRT 3928209-3928244 36 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 373507-373542 7 0.806
NC_021740_16 16.3|3928209|36|NC_021740|CRT 3928209-3928244 36 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1085520-1085555 7 0.806
NC_021740_16 16.3|3928209|36|NC_021740|CRT 3928209-3928244 36 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 634105-634140 7 0.806
NC_021740_16 16.3|3928209|36|NC_021740|CRT 3928209-3928244 36 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1302033-1302068 7 0.806
NC_021740_16 16.3|3928209|36|NC_021740|CRT 3928209-3928244 36 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 895529-895564 7 0.806
NC_021740_16 16.3|3928209|36|NC_021740|CRT 3928209-3928244 36 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1422896-1422931 7 0.806
NC_021740_16 16.3|3928209|36|NC_021740|CRT 3928209-3928244 36 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 794837-794872 7 0.806
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 CP006582 Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence 64257-64289 7 0.788
NC_021740_16 16.17|3929409|36|NC_021740|CRT 3929409-3929444 36 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261173-261208 7 0.806
NC_021740_16 16.17|3929409|36|NC_021740|CRT 3929409-3929444 36 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 306649-306684 7 0.806
NC_021740_16 16.17|3929409|36|NC_021740|CRT 3929409-3929444 36 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1085515-1085550 7 0.806
NC_021740_16 16.17|3929409|36|NC_021740|CRT 3929409-3929444 36 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1151737-1151772 7 0.806
NC_021740_16 16.17|3929409|36|NC_021740|CRT 3929409-3929444 36 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 373507-373542 7 0.806
NC_021740_16 16.17|3929409|36|NC_021740|CRT 3929409-3929444 36 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1085520-1085555 7 0.806
NC_021740_16 16.17|3929409|36|NC_021740|CRT 3929409-3929444 36 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 634105-634140 7 0.806
NC_021740_16 16.17|3929409|36|NC_021740|CRT 3929409-3929444 36 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1302033-1302068 7 0.806
NC_021740_16 16.17|3929409|36|NC_021740|CRT 3929409-3929444 36 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 895529-895564 7 0.806
NC_021740_16 16.17|3929409|36|NC_021740|CRT 3929409-3929444 36 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1422896-1422931 7 0.806
NC_021740_16 16.17|3929409|36|NC_021740|CRT 3929409-3929444 36 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 794837-794872 7 0.806
NC_021740_16 16.18|3929481|27|NC_021740|CRT 3929481-3929507 27 NC_008271 Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence 99581-99607 7 0.741
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MG925349 Mycobacterium phage Mendokysei, complete genome 21043-21075 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 117028-117060 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 178231-178263 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 117028-117060 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 36596-36628 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 177107-177139 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 383420-383452 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 313182-313214 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 997279-997311 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 268642-268674 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 464957-464989 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 65849-65881 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KY555145 Caulobacter phage Ccr29, complete genome 44715-44747 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KY555143 Caulobacter phage Ccr2, complete genome 42548-42580 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 AY369265 Burkholderia cenocepacia phage Bcep1, complete genome 23297-23329 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MK524485 Mycobacterium phage MissDaisy, complete genome 6563-6595 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MH926058 Mycobacterium phage Reptar3000, complete genome 6538-6570 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MK524488 Mycobacterium phage Patt, complete genome 6539-6571 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NC_005263 Burkholderia phage Bcep1, complete genome 23297-23329 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KY555142 Caulobacter phage Ccr10, complete genome 42073-42105 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 178483-178515 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP026546 Cupriavidus metallidurans strain Ni-2 plasmid unnamed2 154233-154265 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 117070-117102 8 0.758
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MH271296 Gordonia phage Emperor, complete genome 13014-13046 8 0.758
NC_021740_3 3.6|366835|33|NC_021740|CRISPRCasFinder 366835-366867 33 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1386736-1386768 8 0.758
NC_021740_3 3.6|366835|33|NC_021740|CRISPRCasFinder 366835-366867 33 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 35126-35158 8 0.758
NC_021740_3 3.6|366835|33|NC_021740|CRISPRCasFinder 366835-366867 33 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1241611-1241643 8 0.758
NC_021740_3 3.6|366835|33|NC_021740|CRISPRCasFinder 366835-366867 33 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 275839-275871 8 0.758
NC_021740_3 3.6|366835|33|NC_021740|CRISPRCasFinder 366835-366867 33 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 310597-310629 8 0.758
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 437642-437671 8 0.733
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NZ_CP015269 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence 9052-9081 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2714450-2714479 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 837910-837939 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 424702-424731 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 975216-975245 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1013021-1013050 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_KY126370 Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence 93253-93282 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP054625 Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence 22400-22429 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1889334-1889363 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_LT960615 Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence 21202-21231 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP046347 Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence 30108-30137 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP044100 Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence 32856-32885 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP032156 Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence 111116-111145 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 KY555144 Caulobacter phage Ccr5, complete genome 178242-178271 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_KP873172 Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence 21059-21088 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 159096-159125 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NC_021492 Enterobacter sp. R4-368 plasmid pENT01, complete sequence 50097-50126 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP022156 Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence 15249-15278 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP024682 Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence 41943-41972 8 0.733
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 242723-242752 8 0.733
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 28649-28678 8 0.733
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 310870-310899 8 0.733
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 462801-462830 8 0.733
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 292109-292138 8 0.733
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 287383-287412 8 0.733
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 292305-292334 8 0.733
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 292675-292704 8 0.733
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 306458-306487 8 0.733
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 292675-292704 8 0.733
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 295900-295929 8 0.733
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 292670-292699 8 0.733
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 306458-306487 8 0.733
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 292305-292334 8 0.733
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 298287-298316 8 0.733
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1682210-1682239 8 0.733
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 294530-294559 8 0.733
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 375826-375855 8 0.733
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 112972-113001 8 0.733
NC_021740_6 6.17|926056|36|NC_021740|CRT 926056-926091 36 MG770216 Mycobacterium phage Rem711, complete genome 26292-26327 8 0.778
NC_021740_6 6.17|926056|36|NC_021740|CRT 926056-926091 36 KY087993 Mycobacterium phage Hammy, complete genome 24359-24394 8 0.778
NC_021740_6 6.17|926056|36|NC_021740|CRT 926056-926091 36 MF140406 Mycobacterium phage DarthP, complete genome 24368-24403 8 0.778
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3466471-3466504 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350662-350695 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350530-350563 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3051061-3051094 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 36586-36619 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_047958 Burkholderia phage vB_BmuP_KL4, complete genome 28566-28599 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 117037-117070 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 928385-928418 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 131278-131311 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 117079-117112 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 117037-117070 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 670302-670335 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1123064-1123097 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 530145-530178 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 187401-187434 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MN234223 Mycobacterium phage Philly, complete genome 30948-30981 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 KJ194581 Mycobacterium phage Audrey, complete genome 31094-31127 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MH051265 Mycobacterium phage Yahalom, complete genome 31107-31140 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MH316565 Mycobacterium phage Mortcellus, complete genome 31732-31765 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MT310871 Mycobacterium phage Jackstina, complete genome 31017-31050 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 EU816589 Mycobacterium phage Phaedrus, complete genome 31013-31046 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MT952851 Mycobacterium phage Gervas, complete genome 31075-31108 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MG920059 Mycobacterium phage Baloo, complete genome 31097-31130 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_023686 Mycobacterium phage Gadjet, complete genome 31104-31137 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_041965 Mycobacterium phage Athena, complete genome 31845-31878 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 DQ398049 Mycobacterium phage Pipefish, complete genome 32489-32522 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MT310892 Mycobacterium phage Compostia, complete genome 31524-31557 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 JN699018 Mycobacterium phage Kamiyu, complete genome 31063-31096 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 687345-687378 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 118498-118531 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 539300-539333 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MK814754 Mycobacterium phage Sumter, complete genome 28141-28174 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MK814754 Mycobacterium phage Sumter, complete genome 28639-28672 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MN369739 Mycobacterium phage Kenuha5, complete genome 22588-22621 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MK967397 Mycobacterium phage Mahavrat, complete genome 24814-24847 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MT522000 Mycobacterium phage Soul22, complete genome 22192-22225 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 KY348865 Mycobacterium phage Bubbles123, complete genome 25540-25573 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MN428047 Mycobacterium phage Doomphist, complete genome 24962-24995 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MF919502 Mycobacterium phage Demsculpinboyz, complete genome 22190-22223 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 AY129336 Mycobacteriophage Che9d, complete genome 22205-22238 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MT771340 Mycobacterium phage Jorgensen, complete genome 28476-28509 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MK359343 Mycobacterium phage Pollywog, complete genome 23655-23688 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_042030 Mycobacterium phage Yoshi, complete sequence 22193-22226 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_048729 Mycobacterium phage Renaud18, complete genome 22865-22898 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_026585 Mycobacteriophage Estave1, complete genome 22558-22591 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MK305886 Mycobacterium phage Poenanya, complete genome 24962-24995 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 JN859129 Mycobacterium virus DotProduct, complete genome 24829-24862 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MG925354 Mycobacterium phage Ogopogo, complete genome 22785-22818 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 JN698995 Mycobacterium phage Dori, complete genome 28163-28196 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_023698 Mycobacterium phage Avani, complete genome 22197-22230 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_011054 Mycobacterium phage Boomer, complete genome 24637-24670 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MN234184 Mycobacterium phage IdentityCrisis, complete genome 19984-20017 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MH077585 Mycobacterium phage TChen, complete genome 22970-23003 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_048788 Mycobacterium phage ThetaBob, complete genome 22783-22816 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 125963-125996 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP015733 Arthrobacter sp. U41 plasmid unnamed1, complete sequence 138036-138069 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MN096355 Mycobacterium phage Purky, complete genome 13505-13538 8 0.765
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MN234183 Mycobacterium phage Antsirabe, complete genome 23060-23093 8 0.765
NC_021740_8 8.9|1211066|37|NC_021740|CRISPRCasFinder 1211066-1211102 37 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 683728-683764 8 0.784
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 349053-349083 8 0.742
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_CP039899 Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence 336247-336277 8 0.742
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_CP039913 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence 262996-263026 8 0.742
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_CP039890 Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence 336247-336277 8 0.742
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_CP018001 Rhizobium sp. Y9 plasmid pY9, complete sequence 264529-264559 8 0.742
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NC_022536 Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence 458177-458207 8 0.742
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 311056-311086 8 0.742
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence 88587-88617 8 0.742
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 CP036360 Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence 284157-284187 8 0.742
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 300067-300097 8 0.742
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1510497-1510527 8 0.742
NC_021740_11 11.3|2082990|30|NC_021740|CRT 2082990-2083019 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 9194-9223 8 0.733
NC_021740_11 11.3|2082990|30|NC_021740|CRT 2082990-2083019 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 983284-983313 8 0.733
NC_021740_14 14.24|3108841|29|NC_021740|PILER-CR 3108841-3108869 29 MK599315 Pseudomonas phage PA1C, complete genome 299172-299200 8 0.724
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 CP033373 Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence 12237-12267 8 0.742
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1260343-1260373 8 0.742
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1009358-1009388 8 0.742
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1260501-1260531 8 0.742
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1009351-1009381 8 0.742
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 756669-756699 8 0.742
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1137767-1137797 8 0.742
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1009365-1009395 8 0.742
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1260057-1260087 8 0.742
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1260001-1260031 8 0.742
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 981946-981976 8 0.742
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 938267-938297 8 0.742
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 748414-748444 8 0.742
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 896022-896052 8 0.742
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 215713-215743 8 0.742
NC_021740_15 15.7|3723528|31|NC_021740|CRT 3723528-3723558 31 NC_014213 Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence 111748-111778 8 0.742
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_LR134468 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence 39373-39405 8 0.758
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP053714 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence 10206-10238 8 0.758
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP033508 Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence 6416-6448 8 0.758
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP033369 Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence 6416-6448 8 0.758
NC_021740_16 16.8|3928590|36|NC_021740|CRT 3928590-3928625 36 NZ_CP026546 Cupriavidus metallidurans strain Ni-2 plasmid unnamed2 51548-51583 8 0.778
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1945948-1945980 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NC_010399 Clavibacter michiganensis subsp. sepedonicus plasmid pCS1, complete sequence 30939-30971 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1848043-1848075 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1848045-1848077 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MN369761 Mycobacterium phage Malthus, complete genome 6607-6639 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MK224497 Mycobacterium phage Henu3, complete genome 52357-52389 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KJ944841 Mycobacterium phage Cheetobro, complete genome 6617-6649 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 AP018469 Mycobacterium phage Y10 DNA, complete genome, note: sample1 6607-6639 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KY087992 Mycobacterium phage Mitti, complete genome 6620-6652 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 EF602154 Burkholderia phage BcepNY3, complete genome 21515-21547 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MF140402 Mycobacterium phage Chancellor, complete genome 6617-6649 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 AP018470 Mycobacterium phage Y2 DNA, complete genome 6607-6639 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KT361920 Mycobacterium phage Slarp, complete genome 6617-6649 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MT310882 Mycobacterium phage JF1, complete genome 6607-6639 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 AP018471 Mycobacterium phage Y10 DNA, complete genome, note: sample2 6607-6639 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KX621007 Mycobacterium phage Taquito, complete genome 6218-6250 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MH051258 Mycobacterium phage SamScheppers, complete genome 6214-6246 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP036221 Mycobacterium avium subsp. hominissuis strain mc2 2500 plasmid unnamed1, complete sequence 13425-13457 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP040251 Mycobacterium avium subsp. hominissuis strain 101115 plasmid unnamed1 19841-19873 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP040252 Mycobacterium avium subsp. hominissuis strain 101115 plasmid unnamed2 9841-9873 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 989188-989220 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP029334 Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109b, complete sequence 8781-8813 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KY555147 Caulobacter phage Ccr34, complete genome 42046-42078 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KY555146 Caulobacter phage Ccr32, complete genome 42080-42112 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NC_047975 Microbacterium phage Squash, complete genome 20717-20749 9 0.727
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 JX163858 Caulobacter phage phiCbK, complete genome 165745-165777 9 0.727
NC_021740_3 3.6|366835|33|NC_021740|CRISPRCasFinder 366835-366867 33 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 91175-91207 9 0.727
NC_021740_3 3.6|366835|33|NC_021740|CRISPRCasFinder 366835-366867 33 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 668963-668995 9 0.727
NC_021740_3 3.6|366835|33|NC_021740|CRISPRCasFinder 366835-366867 33 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 789706-789738 9 0.727
NC_021740_3 3.6|366835|33|NC_021740|CRISPRCasFinder 366835-366867 33 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 625853-625885 9 0.727
NC_021740_4 4.2|631344|30|NC_021740|CRT 631344-631373 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1695112-1695141 9 0.7
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 NZ_CP014964 Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence 13698-13728 9 0.71
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 NC_015974 Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence 20960-20990 9 0.71
NC_021740_5 5.1|692058|31|NC_021740|CRISPRCasFinder 692058-692088 31 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 15390-15420 9 0.71
NC_021740_6 6.13|925870|30|NC_021740|CRT 925870-925899 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5046041-5046070 9 0.7
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 65937-65966 9 0.7
NC_021740_6 6.15|925966|30|NC_021740|CRT 925966-925995 30 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 65937-65966 9 0.7
NC_021740_6 6.17|926056|36|NC_021740|CRT 926056-926091 36 MF140398 Mycobacterium phage Amohnition, complete genome 24446-24481 9 0.75
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350101-350134 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210928-2210961 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 231456-231489 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 306612-306645 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 283233-283266 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 EF602154 Burkholderia phage BcepNY3, complete genome 21505-21538 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 AY369265 Burkholderia cenocepacia phage Bcep1, complete genome 23287-23320 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_005263 Burkholderia phage Bcep1, complete genome 23287-23320 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 307143-307176 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 298112-298145 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 723127-723160 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP053906 Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence 19270-19303 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 KC170279 Uncultured bacterium plasmid pMBUI8, complete sequence 15929-15962 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 652970-653003 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 490801-490834 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 637964-637997 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 235008-235041 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 646029-646062 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 635838-635871 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 684904-684937 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1303766-1303799 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 897262-897295 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 233325-233358 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 560015-560048 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1424629-1424662 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 796570-796603 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 659643-659676 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1083784-1083817 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1052610-1052643 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1150006-1150039 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 654523-654556 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 771404-771437 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 290861-290894 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 371773-371806 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1224363-1224396 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 997046-997079 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1083789-1083822 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MH001451 Mycobacterium phage Nairb, complete genome 21242-21275 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MF155936 Mycobacterium phage ZenTime222, complete genome 21242-21275 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MH588544 Caulobacter phage CcrBL10, complete genome 39042-39075 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MK494089 Mycobacterium phage Ibrahim, complete genome 21242-21275 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_024135 Mycobacterium phage Bernal13, complete genome 21242-21275 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 KM591905 Mycobacterium phage RonRayGun, complete genome 21242-21275 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MN735432 Mycobacteriophage Whitty, complete genome 21242-21275 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_KX443399 Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence 82507-82540 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_KX443400 Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence 82532-82565 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_KX443398 Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence 82528-82561 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 90688-90721 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_KP851975 Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence 82645-82678 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 55533-55566 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 318448-318481 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_KF439868 Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence 81659-81692 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 84861-84894 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP021025 Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence 135548-135581 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 498515-498548 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 927230-927263 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 241368-241401 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_019789 Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence 455289-455322 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 241368-241401 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 239809-239842 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 244056-244089 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 238174-238207 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP013512 Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence 131481-131514 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 241368-241401 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 747004-747037 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 KC736071 Mycobacterium phage WIVsmall, complete genome 29683-29716 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 171949-171982 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_LR134446 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence 52095-52128 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP041653 Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence 129601-129634 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 301604-301637 9 0.735
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 779027-779060 9 0.735
NC_021740_8 8.9|1211066|37|NC_021740|CRISPRCasFinder 1211066-1211102 37 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 686592-686628 9 0.757
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 345043-345073 9 0.71
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 245050-245080 9 0.71
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 194387-194417 9 0.71
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 MN234199 Mycobacterium phage Ekdilam, complete genome 24235-24265 9 0.71
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1145162-1145192 9 0.71
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 453136-453166 9 0.71
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_CP013740 Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence 2806-2836 9 0.71
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1908459-1908489 9 0.71
NC_021740_15 15.5|3723387|34|NC_021740|CRT 3723387-3723420 34 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 922290-922323 9 0.735
NC_021740_15 15.5|3723387|34|NC_021740|CRT 3723387-3723420 34 MG812496 Gordonia phage SallySpecial, complete genome 7675-7708 9 0.735
NC_021740_16 16.3|3928209|36|NC_021740|CRT 3928209-3928244 36 NZ_CP046906 Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence 61960-61995 9 0.75
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 288011-288043 9 0.727
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 232975-233007 9 0.727
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 580620-580652 9 0.727
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 569016-569048 9 0.727
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 466175-466207 9 0.727
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 535556-535588 9 0.727
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 466175-466207 9 0.727
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 472219-472251 9 0.727
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 472209-472241 9 0.727
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 466187-466219 9 0.727
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 466207-466239 9 0.727
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 466161-466193 9 0.727
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 15179-15211 9 0.727
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 580663-580695 9 0.727
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 580663-580695 9 0.727
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_AP022611 Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574 1232-1264 9 0.727
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_AP022611 Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574 207743-207775 9 0.727
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 580654-580686 9 0.727
NC_021740_16 16.11|3928818|36|NC_021740|CRT 3928818-3928853 36 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 2357906-2357941 9 0.75
NC_021740_16 16.11|3928818|36|NC_021740|CRT 3928818-3928853 36 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1269394-1269429 9 0.75
NC_021740_16 16.17|3929409|36|NC_021740|CRT 3929409-3929444 36 NZ_CP046906 Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence 61960-61995 9 0.75
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 576171-576203 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP018080 Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence 103033-103065 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MH371116 Mycobacterium phage DMoney, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MH045569 Mycobacterium phage Schiebel, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MH371119 Mycobacterium phage OctaviousRex, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MF919497 Mycobacterium phage Chance64, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MH001456 Mycobacterium phage CLED96, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 GQ303261 Mycobacterium phage Hope, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MG099946 Mycobacterium phage LouisV14, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KC787112 Mycobacterium phage Clark, partial genome 6593-6625 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MH779513 Mycobacterium phage Olga, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MK919475 Mycobacterium phage Camri, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MK310146 Mycobacterium phage Crespo, complete genome 6589-6621 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MK524493 Mycobacterium phage Darionha, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MH779505 Mycobacterium phage Grizzly, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 EU568876 Mycobacterium phage BPs, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KC787107 Mycobacterium phage Bo4, complete genome 32703-32735 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MF668268 Mycobacterium phage Aroostook, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MK524494 Mycobacterium phage Rabbs, complete genome 6589-6621 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KX588251 Mycobacterium phage Jane, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KC787103 Mycobacterium phage Chy2, partial genome 5353-5385 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MH001455 Mycobacterium phage Remy19, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KT355472 Mycobacterium phage Cedasite, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KX664455 Mycobacterium phage Zombie, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MH077584 Mycobacterium phage Phish, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KC787108 Mycobacterium phage DNAIII, complete genome 6597-6629 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MN444875 Mycobacterium phage Jonghyun, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MK433279 Mycobacterium phage Kareem, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KJ725374 Mycobacterium phage Guo1, complete genome 27230-27262 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NC_031102 Mycobacterium phage Sneeze, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MT818422 Mycobacterium phage Periodt, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MK305884 Mycobacterium phage BQuat, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MF668272 Mycobacterium phage Gideon, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KC787111 Mycobacterium phage Sedge, partial genome 6528-6560 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KC787104 Mycobacterium phage Chy3, partial genome 6968-7000 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NC_012788 Mycobacterium phage Angel, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KX443326 Mycobacterium phage BruceB, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MK433277 Mycobacterium phage Renaissance, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MH590605 Mycobacterium phage Cherrybomb426, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MH779509 Mycobacterium phage Kasen3, complete genome 6589-6621 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 JN699002 Mycobacterium phage Avrafan, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MH779507 Mycobacterium phage Hotshotbaby7, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KT355474 Mycobacterium phage Frosty24, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KC787109 Mycobacterium phage Legendre, partial genome 34119-34151 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 JN412593 Mycobacterium phage Liefie, complete genome 6587-6619 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MH479920 Mycobacterium phage Mowgli, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KM923970 Mycobacterium phage Gomashi, complete genome 6589-6621 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 MH450127 Mycobacterium phage Plagueis, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KT347314 Mycobacterium phage Phreak, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KT365399 Mycobacterium phage Annihilator, complete genome 6588-6620 10 0.697
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 KC787110 Mycobacterium phage Leo, complete genome 6605-6637 10 0.697
NC_021740_3 3.6|366835|33|NC_021740|CRISPRCasFinder 366835-366867 33 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 91179-91211 10 0.697
NC_021740_3 3.6|366835|33|NC_021740|CRISPRCasFinder 366835-366867 33 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 90245-90277 10 0.697
NC_021740_3 3.6|366835|33|NC_021740|CRISPRCasFinder 366835-366867 33 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 99166-99198 10 0.697
NC_021740_6 6.2|925366|39|NC_021740|CRT 925366-925404 39 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 107058-107096 10 0.744
NC_021740_6 6.5|925519|36|NC_021740|CRT 925519-925554 36 KX683875 Mycobacterium phage Baehexic, complete genome 12172-12207 10 0.722
NC_021740_6 6.5|925519|36|NC_021740|CRT 925519-925554 36 KM197169 Mycobacterium phage Piro94, complete genome 12169-12204 10 0.722
NC_021740_6 6.5|925519|36|NC_021740|CRT 925519-925554 36 MF668269 Mycobacterium phage Drake55, complete genome 12168-12203 10 0.722
NC_021740_6 6.5|925519|36|NC_021740|CRT 925519-925554 36 MK284522 Mycobacterium phage Malec, complete genome 11941-11976 10 0.722
NC_021740_6 6.5|925519|36|NC_021740|CRT 925519-925554 36 KM677210 Mycobacterium phage Larenn, complete genome 11936-11971 10 0.722
NC_021740_6 6.17|926056|36|NC_021740|CRT 926056-926091 36 MN369764 Mycobacterium phage Rahalelujah, complete genome 24340-24375 10 0.722
NC_021740_6 6.17|926056|36|NC_021740|CRT 926056-926091 36 NZ_CP025548 Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence 25147-25182 10 0.722
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210946-2210979 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1732364-1732397 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP034352 Streptomyces sp. W1SF4 plasmid p2, complete sequence 21676-21709 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 CP000620 Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence 96060-96093 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP020810 Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence 93944-93977 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 98684-98717 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MK524490 Mycobacterium phage Donny, complete genome 33811-33844 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MK494095 Mycobacterium phage Daegal, complete genome 5959-5992 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 JN699007 Mycobacterium phage Acadian, complete genome 33806-33839 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MT889381 Mycobacterium phage Suigeneris, complete genome 33811-33844 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP015373 Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence 47518-47551 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 AP018709 Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence 27460-27493 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 194712-194745 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 362178-362211 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_008766 Acidovorax sp. JS42 plasmid pAOVO02, complete sequence 10252-10285 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 677361-677394 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP019238 Rhodoferax koreense strain DCY-110 plasmid unnamed2 8446-8479 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP019238 Rhodoferax koreense strain DCY-110 plasmid unnamed2 65893-65926 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 640930-640963 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_021077 Comamonas sp. 7D-2 plasmid pBHB, complete sequence 104485-104518 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_024998 Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83 31366-31399 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_008385 Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence 29995-30028 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP018471 Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence 16577-16610 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_KJ588780 Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence 15929-15962 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_MN366359 Bacterium plasmid pALTS31, complete sequence 15929-15962 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 100724-100757 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_001735 Enterobacter aerogenes plasmid R751, complete sequence 31148-31181 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 AGRM01000006 Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence 12357-12390 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 AJ863570 Uncultured bacterium IncP-1beta multiresistance plasmid pB8 25168-25201 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP034651 Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence 17683-17716 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1350942-1350975 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 136497-136530 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_021492 Enterobacter sp. R4-368 plasmid pENT01, complete sequence 46815-46848 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 JX469828 Uncultured bacterium plasmid pRSB223, complete sequence 25131-25164 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 JX469829 Uncultured bacterium plasmid pB1, complete sequence 16215-16248 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 JX469831 Uncultured bacterium plasmid pKSP212, complete sequence 15929-15962 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 JN106172 Uncultured bacterium plasmid pAKD29, complete sequence 15931-15964 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 JN106173 Uncultured bacterium plasmid pAKD31, complete sequence 15929-15962 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 JN106174 Uncultured bacterium plasmid pAKD33, complete sequence 15932-15965 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 JN106164 Uncultured bacterium plasmid pAKD1, complete sequence 15939-15972 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 JN106165 Uncultured bacterium plasmid pAKD14, complete sequence 15929-15962 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 JN106166 Uncultured bacterium plasmid pAKD15, complete sequence 15929-15962 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 JN106168 Uncultured bacterium plasmid pAKD17, complete sequence 15929-15962 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 JN106169 Uncultured bacterium plasmid pAKD18, complete sequence 15929-15962 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MN386974 Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence 16066-16099 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_001381 Mycobacterium fortuitum plasmid pAL5000, complete sequence 2682-2715 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MG879028 Uncultured bacterium plasmid pEG1-1, complete sequence 31441-31474 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP021650 Acidovorax sp. T1 plasmid p2-T1, complete sequence 40579-40612 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 JX486125 Uncultured bacterium plasmid pRWC72a, complete sequence 15940-15973 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP038640 Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence 50284-50317 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 AJ639924 Uncultured bacterium plasmid pB3 complete genome 17431-17464 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 KU356987 Variovorax paradoxus plasmid pBS64, complete sequence 15928-15961 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 KU356988 Variovorax paradoxus plasmid pHB44, complete sequence 15930-15963 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 155712-155745 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP009797 Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence 16433-16466 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_013176 Pseudomonas putida plasmid pW2, complete sequence 10533-10566 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_019320 Variovorax sp. DB1 plasmid pDB1, complete sequence 49358-49391 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP017455 Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence 23524-23557 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NC_007337 Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence 71777-71810 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_MN366358 Bacterium plasmid pALTS29, complete sequence 15940-15973 10 0.706
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MN234219 Mycobacterium phage Mercurio, complete genome 23308-23341 10 0.706
NC_021740_8 8.9|1211066|37|NC_021740|CRISPRCasFinder 1211066-1211102 37 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 331923-331959 10 0.73
NC_021740_8 8.9|1211066|37|NC_021740|CRISPRCasFinder 1211066-1211102 37 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 716620-716656 10 0.73
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NC_017273 Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence 425898-425928 10 0.677
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 344090-344120 10 0.677
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 68383-68413 10 0.677
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NC_017590 Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence 16322-16352 10 0.677
NC_021740_9 9.10|1570130|31|NC_021740|CRISPRCasFinder 1570130-1570160 31 NZ_AP014581 Burkholderia sp. RPE67 plasmid p3, complete sequence 131907-131937 10 0.677
NC_021740_9 9.13|1570379|34|NC_021740|CRISPRCasFinder 1570379-1570412 34 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 1081518-1081551 10 0.706
NC_021740_13 13.9|3106243|35|NC_021740|PILER-CR,CRISPRCasFinder,CRT 3106243-3106277 35 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 414652-414686 10 0.714
NC_021740_14 14.20|3109714|34|NC_021740|CRISPRCasFinder,CRT 3109714-3109747 34 NZ_AP022335 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence 171698-171731 10 0.706
NC_021740_14 14.36|3109718|34|NC_021740|PILER-CR 3109718-3109751 34 NZ_AP022335 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence 171698-171731 10 0.706
NC_021740_15 15.5|3723387|34|NC_021740|CRT 3723387-3723420 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 470079-470112 10 0.706
NC_021740_15 15.5|3723387|34|NC_021740|CRT 3723387-3723420 34 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 68774-68807 10 0.706
NC_021740_15 15.5|3723387|34|NC_021740|CRT 3723387-3723420 34 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 172270-172303 10 0.706
NC_021740_15 15.5|3723387|34|NC_021740|CRT 3723387-3723420 34 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 172270-172303 10 0.706
NC_021740_16 16.3|3928209|36|NC_021740|CRT 3928209-3928244 36 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 182018-182053 10 0.722
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_LR594668 Variovorax sp. SRS16 plasmid 3 37758-37790 10 0.697
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 315511-315543 10 0.697
NC_021740_16 16.17|3929409|36|NC_021740|CRT 3929409-3929444 36 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 182018-182053 10 0.722
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NZ_CP032676 Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence 384747-384779 11 0.667
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350092-350125 11 0.676
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 239254-239287 11 0.676
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MH051334 Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome 23136-23169 11 0.676
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 MG852086 Escherichia phage vB_EcoS-Ro145clw, complete genome 41310-41343 11 0.676
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261086-261119 11 0.676
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 584732-584765 11 0.676
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 70292-70325 11 0.676
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 507461-507494 11 0.676
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 155836-155869 11 0.676
NC_021740_8 8.5|1210850|40|NC_021740|CRISPRCasFinder 1210850-1210889 40 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261884-261923 11 0.725
NC_021740_15 15.5|3723387|34|NC_021740|CRT 3723387-3723420 34 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 326578-326611 11 0.676
NC_021740_16 16.3|3928209|36|NC_021740|CRT 3928209-3928244 36 MT498048 Mycobacterium phage Raymond7, complete genome 21146-21181 11 0.694
NC_021740_16 16.3|3928209|36|NC_021740|CRT 3928209-3928244 36 KF986246 Mycobacterium phage MichelleMyBell, complete genome 20760-20795 11 0.694
NC_021740_16 16.5|3928353|33|NC_021740|CRT 3928353-3928385 33 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 197504-197536 11 0.667
NC_021740_16 16.17|3929409|36|NC_021740|CRT 3929409-3929444 36 MT498048 Mycobacterium phage Raymond7, complete genome 21146-21181 11 0.694
NC_021740_16 16.17|3929409|36|NC_021740|CRT 3929409-3929444 36 KF986246 Mycobacterium phage MichelleMyBell, complete genome 20760-20795 11 0.694
NC_021740_2 2.9|335859|33|NC_021740|CRT 335859-335891 33 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 324416-324448 12 0.636
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190139-190172 12 0.647
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_CP026703 Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence 14966-14999 12 0.647
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 302491-302524 14 0.588
NC_021740_8 8.3|1210745|34|NC_021740|CRISPRCasFinder 1210745-1210778 34 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 282346-282379 15 0.559

1. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 1, identity: 0.955

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggcggtgcc	Protospacer
********************.*

2. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcggcc	Protospacer
********************* 

3. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcggcc	Protospacer
********************* 

4. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcgggccggcggca	Protospacer
**********.***********

5. spacer 9.15|1570502|22|NC_021740|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

6. spacer 9.15|1570502|22|NC_021740|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

7. spacer 9.15|1570502|22|NC_021740|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

8. spacer 9.15|1570502|22|NC_021740|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

9. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 2, identity: 0.917

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgcgggacagcatggcgttg	Protospacer
******* *.**************

10. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 2, identity: 0.917

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgcgggacagcatggcgttg	Protospacer
******* *.**************

11. spacer 2.6|335718|24|NC_021740|CRT matches to NC_028947 (Mycobacterium phage Kratio, complete genome) position: , mismatch: 2, identity: 0.917

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgccaaacggcatggcgttg	Protospacer
********.***.***********

12. spacer 2.8|335814|24|NC_021740|CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 2, identity: 0.917

atgagcccgccggcgccgccgttg	CRISPR spacer
aagagcacgccggcgccgccgttg	Protospacer
* **** *****************

13. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.917

atgagcccgccggcgccgccgttg	CRISPR spacer
atgaggacgccggcgccgccgttg	Protospacer
*****  *****************

14. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggcggtggg	Protospacer
********************  

15. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
agtcggcggtgccgacggtgtc	Protospacer
 *************.*******

16. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggcgtc	Protospacer
.*****************.***

17. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgtcggcggtgtc	Protospacer
.**********.**********

18. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
ggtcggcggtgccggcggcgtc	Protospacer
 *****************.***

19. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggccgtgta	Protospacer
**************** **** 

20. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggccgtgta	Protospacer
**************** **** 

21. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
ggtcggcggtgccggccgtgtc	Protospacer
 *************** *****

22. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NC_047977 (Microbacterium phage Hendrix, complete genome) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgacggcggtgccggcggtgtg	Protospacer
** ****************** 

23. spacer 8.15|1211366|22|NC_021740|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 2, identity: 0.909

ggacggtggtaccggcggtcag	CRISPR spacer
tgacggtggtgccggcggtcag	Protospacer
 *********.***********

24. spacer 9.2|1569575|22|NC_021740|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

25. spacer 9.2|1569575|22|NC_021740|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

26. spacer 9.2|1569575|22|NC_021740|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

27. spacer 9.2|1569575|22|NC_021740|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

28. spacer 9.2|1569575|22|NC_021740|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

29. spacer 9.3|1569629|22|NC_021740|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909

ggtaccgtcctcgccggcggtg	CRISPR spacer
ggcaccgtcctcgccggcggtt	Protospacer
**.****************** 

30. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcc	Protospacer
.******************** 

31. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

32. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

33. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcc	Protospacer
.******************** 

34. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

35. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

36. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

37. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

38. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

39. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgggg	Protospacer
******************** .

40. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
accgccgatcaggccggcggca	Protospacer
..********************

41. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
ctcggcgatcaggccggcggca	Protospacer
 *** *****************

42. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

43. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

44. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

45. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

46. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcg	Protospacer
***************** ***.

47. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
ggcgccgatcaggccggcggcc	Protospacer
* ******************* 

48. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggcctgcggcg	Protospacer
*************** *****.

49. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

50. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgccg	Protospacer
******************* *.

51. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgagcaggccggcggcc	Protospacer
******** ************ 

52. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

53. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

54. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

55. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

56. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 3, identity: 0.889

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
acggcggcgaggagcaggccggcgttg	Protospacer
.***** ***.****************

57. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

58. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP026559 (Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p2_tig3, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
gcggcgctgaacagcatgccgttg	Protospacer
 ******.********** *****

59. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

60. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

61. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP019872 (Pseudomonas syringae pv. tomato strain B13-200 plasmid pB13-200A, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
gcggcgctgaacagcatgccgttg	Protospacer
 ******.********** *****

62. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

63. spacer 2.6|335718|24|NC_021740|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

64. spacer 2.6|335718|24|NC_021740|CRT matches to NC_017385 (Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
gcggcgccgagcagcatggcgctg	Protospacer
 *********.**********.**

65. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

66. spacer 2.6|335718|24|NC_021740|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

67. spacer 2.6|335718|24|NC_021740|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
acggcgccgaacaggatggcgtcg	Protospacer
 ************* *******.*

68. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgcagaacagcatggcgcag	Protospacer
******* *************. *

69. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP012910 (Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
gcggcgccgagcagcatggcgctg	Protospacer
 *********.**********.**

70. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

71. spacer 2.6|335718|24|NC_021740|CRT matches to CP054316 (Escherichia coli strain SCU-483 plasmid pSCU-483-1) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgcagaacagcatggcggtt	Protospacer
******* ************* * 

72. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

73. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

74. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

75. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_LR723679 (Arsenite-oxidising bacterium NT-25 plasmid 3) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
acggcgccgaacagcatgccgtcg	Protospacer
 ***************** ***.*

76. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

77. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcggtgaacagcatggcgttc	Protospacer
****** .*************** 

78. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

79. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP029986 (Sphingomonas sp. FARSPH plasmid p01, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
gcagcgccgaacagcatggcgtcg	Protospacer
 *.*******************.*

80. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

81. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

82. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

83. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

84. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

85. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

86. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

87. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

88. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

89. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

90. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgccgatcagcatggcggcg	Protospacer
********** ********** .*

91. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

92. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

93. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

94. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

95. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

96. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP031228 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pPla107-2) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
gcggcgctgaacagcatgccgttg	Protospacer
 ******.********** *****

97. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

98. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

99. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

100. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

101. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

102. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
acggcgccgaacaggatggcgtcg	Protospacer
 ************* *******.*

103. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

104. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
acggcgccgaacaggatggcgtcg	Protospacer
 ************* *******.*

105. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

106. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

107. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP044960 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.3, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgcagaacagcatggcggtt	Protospacer
******* ************* * 

108. spacer 2.6|335718|24|NC_021740|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

109. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

110. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

111. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

112. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

113. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052880 (Escherichia coli strain C21 plasmid pC21-3, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgcagaacagcatggcggtt	Protospacer
******* ************* * 

114. spacer 2.6|335718|24|NC_021740|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgccggacagcatggcgagg	Protospacer
*********.***********  *

115. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP044333 (Methylocystis parvus strain BRCS2 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
gcggcgccgaacaggatggcgatg	Protospacer
 ************* ****** **

116. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

117. spacer 2.6|335718|24|NC_021740|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

118. spacer 2.6|335718|24|NC_021740|CRT matches to NC_014626 (Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
gcggcgccgagcagcatggcgctg	Protospacer
 *********.**********.**

119. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

120. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP019215 (Escherichia coli strain WCHEC050613 plasmid pI_050613, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgcagaacagcatggcggtt	Protospacer
******* ************* * 

121. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

122. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

123. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

124. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

125. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

126. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

127. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

128. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

129. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

130. spacer 2.6|335718|24|NC_021740|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

131. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

132. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

133. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

134. spacer 2.6|335718|24|NC_021740|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

135. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

136. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_LN890525 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgcagaacagcatggcggtt	Protospacer
******* ************* * 

137. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

138. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

139. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

140. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

141. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

142. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

143. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_LT963412 (Pseudomonas syringae isolate CFBP3840 plasmid PP3, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
gcggcgctgaacagcatgccgttg	Protospacer
 ******.********** *****

144. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

145. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

146. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

147. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

148. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

149. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

150. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

151. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

152. spacer 2.6|335718|24|NC_021740|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcggcgaacagcatggcgatc	Protospacer
****** ************** * 

153. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

154. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

155. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

156. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

157. spacer 2.6|335718|24|NC_021740|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

158. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

159. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

160. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

161. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

162. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

163. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

164. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

165. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

166. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgtgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

167. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP047261 (Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326F, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
gcggcgctgaacagcatgccgttg	Protospacer
 ******.********** *****

168. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgaacagcatggcgttg	CRISPR spacer
cgcgcgccgaacagcatggcgatg	Protospacer
*  ****************** **

169. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
ttgagccagccggcgccgccgttc	Protospacer
 ****** *************** 

170. spacer 2.8|335814|24|NC_021740|CRT matches to MN010758 (Gordonia phage Dardanus, complete genome) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
gtgaacccgccggcgccgccgttc	Protospacer
.***.****************** 

171. spacer 2.8|335814|24|NC_021740|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
gtcagcgcgccggcgccgccgttg	Protospacer
.* *** *****************

172. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
gtcagcgcgccggcgccgccgttg	Protospacer
.* *** *****************

173. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP044330 (Methylocystis rosea strain BRCS1 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
ctgacgccgccggcgccgccgttg	Protospacer
 ***  ******************

174. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
atcagcccgccggcgccgccgaag	Protospacer
** ******************  *

175. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
gtcagcgcgccggcgccgccgttg	Protospacer
.* *** *****************

176. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
gtcagcgcgccggcgccgccgttg	Protospacer
.* *** *****************

177. spacer 2.8|335814|24|NC_021740|CRT matches to MT740732 (Ralstonia phage Darius, complete genome) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
ctgagcccgccggcgccgccatag	Protospacer
 *******************.* *

178. spacer 2.8|335814|24|NC_021740|CRT matches to MH638294 (Ralstonia phage GP4, complete genome) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
ctgagcccgccggcgccgccatag	Protospacer
 *******************.* *

179. spacer 2.8|335814|24|NC_021740|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
gtcagcgcgccggcgccgccgttg	Protospacer
.* *** *****************

180. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP025550 (Mycobacterium paragordonae strain 49061 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
atgagcccgccagcgccgccgcgg	Protospacer
***********.*********. *

181. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP034088 (Methylocystis rosea strain GW6 plasmid pGW6_2, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
ctgacgccgccggcgccgccgttg	Protospacer
 ***  ******************

182. spacer 2.8|335814|24|NC_021740|CRT matches to MT740740 (Ralstonia phage Gervaise, complete genome) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
ctgagcccgccggcgccgccatag	Protospacer
 *******************.* *

183. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgacctcggcggcgcgggcga	Protospacer
.***************** ****.

184. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccggcctgggcggcgctggcgg	Protospacer
 ****.*** **************

185. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

186. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
agccgacctcggcggcgatggcgc	Protospacer
*.*************** ***** 

187. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

188. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

189. spacer 6.16|926014|24|NC_021740|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

190. spacer 6.16|926014|24|NC_021740|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

191. spacer 6.16|926014|24|NC_021740|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

192. spacer 6.16|926014|24|NC_021740|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

193. spacer 6.16|926014|24|NC_021740|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

194. spacer 6.16|926014|24|NC_021740|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

195. spacer 6.16|926014|24|NC_021740|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
aaccggcctcggcggcgctgccgc	Protospacer
*****.************** ** 

196. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccgagctcggcggcgctgccgg	Protospacer
 ***** ************* ***

197. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccggcctcggcggcgcgggcgg	Protospacer
 ****.************ *****

198. spacer 6.16|926014|24|NC_021740|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
aacccacctcggcggcgatggcgc	Protospacer
**** ************ ***** 

199. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 3, identity: 0.88

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgcgggcggcctcggcgtagcgctt	Protospacer
*** *******************..

200. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 3, identity: 0.88

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgcgggcggcctcggcgtagcgctt	Protospacer
*** *******************..

201. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggtgag	Protospacer
.*******************  

202. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
gtgcggcggtgccggcggtgtc	Protospacer
   *******************

203. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
gtgcggcggtgccggcggtgtc	Protospacer
   *******************

204. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggtgag	Protospacer
.*******************  

205. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggtggt	Protospacer
.******************* .

206. spacer 8.7|1210982|22|NC_021740|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
catcggcggtgccggcggtgtg	Protospacer
..******************* 

207. spacer 8.11|1211165|22|NC_021740|CRISPRCasFinder matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.864

gctgtggggcggcggtggtgcc	CRISPR spacer
cgtgtggggcggcggtggtgca	Protospacer
  ******************* 

208. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgcgg	Protospacer
*******************  .

209. spacer 9.4|1569683|22|NC_021740|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864

gtcgccgatcaggccggcggca	CRISPR spacer
ttcgccgatcaggccggcggtg	Protospacer
 *******************..

210. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
ctcgccgaacacgcggaagccgtct	Protospacer
**.*********** ********* 

211. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
attgtcgaacacgcggaagccgtcg	Protospacer
 ***.********* **********

212. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

213. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

214. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

215. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
catgcggaacacgccgaatccgtcg	Protospacer
* *** ************ ******

216. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgatcacgccgtagccgttg	Protospacer
******** ******* ******.*

217. spacer 9.15|1570502|22|NC_021740|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864

caatccggcggcgccgccggca	CRISPR spacer
gaatccggcggcgccgccgggc	Protospacer
 *******************  

218. spacer 11.5|2083080|24|NC_021740|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

219. spacer 11.5|2083080|24|NC_021740|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

220. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_023695 (Mycobacterium phage Violet, complete genome) position: , mismatch: 3, identity: 0.889

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
taccggcggcaaaggcggcaacggcgg	Protospacer
.*******************  *****

221. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 3, identity: 0.889

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cctcggcggcaaaggcggcattggcgg	Protospacer
* .****************** *****

222. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_LR134449 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 7, complete sequence) position: , mismatch: 4, identity: 0.852

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcgccggcgaagagcaggccggcggcg	Protospacer
*** ** ***************** .*

223. spacer 2.4|335619|27|NC_021740|CRT matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 4, identity: 0.852

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcggcgccgaggagccggccggcgacg	Protospacer
**********.**** ******** .*

224. spacer 2.4|335619|27|NC_021740|CRT matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 4, identity: 0.852

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcggcgccgaggagccggccggcggtc	Protospacer
**********.**** ******** * 

225. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
acggcgcagaagagcgggccggcgtgg	Protospacer
.****** *******.********* *

226. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gccgcgccgaagagcagggcggcactg	Protospacer
** *************** ****..**

227. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP046258 (Gordonia sp. 135 plasmid pG135, complete sequence) position: , mismatch: 4, identity: 0.852

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gagacgccgaagaacgggccggcgttg	Protospacer
* *.*********.*.***********

228. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
acggcgccgaacagaatggcgtcc	Protospacer
 ************* *******. 

229. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgctgaacagcatggcgaac	Protospacer
*******.*************   

230. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
acggcgccgaacagaatggcgtcc	Protospacer
 ************* *******. 

231. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgctgaacagcatggcgaac	Protospacer
*******.*************   

232. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgccgaacagcatcgcgaac	Protospacer
***************** ***   

233. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgctgaacagcatggcgaac	Protospacer
*******.*************   

234. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgctgaacagcatggcgaac	Protospacer
*******.*************   

235. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
acggcgccgaacagaatggcgtcc	Protospacer
 ************* *******. 

236. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
acggcgccgaacagaatggcgtcc	Protospacer
 ************* *******. 

237. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
acggcgccgaacagaatggcgtcc	Protospacer
 ************* *******. 

238. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
acggcgccgaacagaatggcgtcc	Protospacer
 ************* *******. 

239. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
acggcgccgaacagaatggcgtcc	Protospacer
 ************* *******. 

240. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgctgaacagcatggcgaac	Protospacer
*******.*************   

241. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
acggcgccgaacagaatggcgtcc	Protospacer
 ************* *******. 

242. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgctgaacagcatggcgaac	Protospacer
*******.*************   

243. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgctgaacagcatggcgaac	Protospacer
*******.*************   

244. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
acggcgccgaacagaatggcgtcc	Protospacer
 ************* *******. 

245. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
acggcgccgaacagaatggcgtcc	Protospacer
 ************* *******. 

246. spacer 2.6|335718|24|NC_021740|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgaacagcatggcgttg	CRISPR spacer
ccggcgctgaacagcatggcgaac	Protospacer
*******.*************   

247. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.833

atgagcccgccggcgccgccgttg	CRISPR spacer
tcgagcccgccggcgccgccattc	Protospacer
 .******************.** 

248. spacer 2.8|335814|24|NC_021740|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833

atgagcccgccggcgccgccgttg	CRISPR spacer
tccagcccgccggcgccggcgttg	Protospacer
 . *************** *****

249. spacer 3.1|366505|27|NC_021740|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

250. spacer 3.1|366505|27|NC_021740|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

251. spacer 3.7|366901|27|NC_021740|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ccgaagccgatgtcgtagcggccggcg	Protospacer
 ************.***** *****.*

252. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg	Protospacer
.* ********* ***********.**

253. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
acggcgccgaagttgaggccgccgacg	Protospacer
**  **************.****** *

254. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.867

accacgccggtgaccacgccg-ccaacgacg	CRISPR spacer
accacgccggtggccacgccgaccagcggc-	Protospacer
************.******** ***.**.* 

255. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010326 (Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggctgggctggcggggatat	Protospacer
********** ************* . 

256. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP021045 (Phaeobacter gallaeciensis strain P129 plasmid pP129_e, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

257. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010678 (Phaeobacter gallaeciensis strain P75 plasmid pP75_e, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

258. spacer 6.6|925573|27|NC_021740|CRT matches to NC_023142 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

259. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010789 (Phaeobacter gallaeciensis strain P63 plasmid pP63_e, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

260. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010642 (Phaeobacter gallaeciensis strain P73 plasmid pP73_f, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

261. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010593 (Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

262. spacer 6.6|925573|27|NC_021740|CRT matches to AM419438 (Archaeal BJ1 virus complete genome) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcggcggcgggggtggcgggggcgg	Protospacer
****.********* ********. **

263. spacer 6.6|925573|27|NC_021740|CRT matches to NC_008695 (Archaeal BJ1 virus, complete genome) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcggcggcgggggtggcgggggcgg	Protospacer
****.********* ********. **

264. spacer 6.10|925729|27|NC_021740|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgcatccggcggcggcggttgcgttct	Protospacer
** **************** ***** .

265. spacer 6.10|925729|27|NC_021740|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggcctcggcggcggcggtggcgttgc	Protospacer
*** ..*************.*******

266. spacer 6.10|925729|27|NC_021740|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggccgcggcggcggcggtagcggtgc	Protospacer
*** . ***************** ***

267. spacer 6.15|925966|30|NC_021740|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867

cctgctgttcggctccggcggcgctggcgg-	CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc	Protospacer
 ************ ********* ***.** 

268. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ctacgaccacggcggcgctggcgg	Protospacer
   ***** ***************

269. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
gcccgatctcggcggcgctggcgt	Protospacer
. ****.**************** 

270. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tcccgacctcggcggtgctggcgc	Protospacer
  *************.******* 

271. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cgtcgacgtcggcggcgctggcgg	Protospacer
 ..**** ****************

272. spacer 6.16|926014|24|NC_021740|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cttcgacttcggcggcgctggcgg	Protospacer
  .****.****************

273. spacer 6.16|926014|24|NC_021740|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

274. spacer 6.16|926014|24|NC_021740|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

275. spacer 6.16|926014|24|NC_021740|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

276. spacer 6.16|926014|24|NC_021740|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

277. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cgccgacctcggcggcggtggcga	Protospacer
 .*************** *****.

278. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tcccgacctcggcggtgctggcgc	Protospacer
  *************.******* 

279. spacer 6.16|926014|24|NC_021740|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ctacgaccacggcggcgctggcgg	Protospacer
   ***** ***************

280. spacer 6.16|926014|24|NC_021740|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tctcgacctcggcggcgatggcgg	Protospacer
  .************** ******

281. spacer 6.16|926014|24|NC_021740|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tgccgacctcggctgcgctggcgc	Protospacer
 .*********** ********* 

282. spacer 6.16|926014|24|NC_021740|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ggtcgacctcgacggcgctggcgg	Protospacer
...********.************

283. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
ggccggcggcctcggcggagcgctg	Protospacer
 **************** *****. 

284. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
ggccggcggcctcggcggagcgctg	Protospacer
 **************** *****. 

285. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

286. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to CP003956 (Rhodococcus opacus PD630 plasmid 7, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
gtccggcggccttggcgtagcgcct	Protospacer
  **********.***********.

287. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

288. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggccccggcgtcgcgcga	Protospacer
***********.****** ****  

289. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctcggcgtaatggtc	Protospacer
*******************..* .*

290. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggcggcatcggcgtagcggcg	Protospacer
.********* *********** * 

291. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggcggcctccgcgtcgcgcct	Protospacer
.************ **** *****.

292. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgtcggcggcctcggcgtagcgggc	Protospacer
.*.*******************  *

293. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NC_022437 (Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggcggccgcgtcgtagcgcca	Protospacer
.********** ** ********* 

294. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

295. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggtgtcctcggcgtagcgcga	Protospacer
******.* **************  

296. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctccgcgaagcgctt	Protospacer
************* *** *****..

297. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
ggccggctgcctcggcatagcgccg	Protospacer
 ****** ********.******* 

298. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

299. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggtggcctcggcgtagccccg	Protospacer
.*****.************** ** 

300. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctccgcgaagcgctt	Protospacer
************* *** *****..

301. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tggcggcggcctcgccgtagcgctt	Protospacer
** *********** ********..

302. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgtcggcggcctcggcgtagcggac	Protospacer
.*.*******************  *

303. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
agccggcggcctcggcctcgcgccg	Protospacer
 *************** * ***** 

304. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

305. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

306. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

307. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

308. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
tccgccgaacgcgccgaagccgtcg	Protospacer
...*******.**************

309. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gctgccgaacacgccgatgccgacg	Protospacer
 .*************** **** **

310. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gctgccgaacacgccgatgccgacg	Protospacer
 .*************** **** **

311. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

312. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

313. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

314. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacacgccgatgccctgc	Protospacer
***************** *** *  

315. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
aatgccgaattcgccgaagccgtcg	Protospacer
  *******. **************

316. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cccgtagaacacgccgaagccgtcg	Protospacer
*..*. *******************

317. spacer 9.14|1570445|25|NC_021740|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgccaccgacccccccttgc	CRISPR spacer
ttttccgacaccgacccccccttga	Protospacer
.** *** **************** 

318. spacer 11.5|2083080|24|NC_021740|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcgaagaagctgaacacgcccgc	Protospacer
**************** ****  .

319. spacer 11.5|2083080|24|NC_021740|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
gtcgatgaagctgaacccgccgaa	Protospacer
.**** ****************  

320. spacer 11.5|2083080|24|NC_021740|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcggagaagctgaacccgcccgg	Protospacer
****.****************   

321. spacer 16.18|3929481|27|NC_021740|CRT matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cccgggcggcaagggcggcaagggcgg	Protospacer
* * ********.******* ******

322. spacer 16.18|3929481|27|NC_021740|CRT matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cccgggcggcaagggcggcaagggcgg	Protospacer
* * ********.******* ******

323. spacer 16.18|3929481|27|NC_021740|CRT matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cccgggcggcaagggcggcaagggcgg	Protospacer
* * ********.******* ******

324. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cccgggcggcaagggcggcaagggcgg	Protospacer
* * ********.******* ******

325. spacer 16.18|3929481|27|NC_021740|CRT matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cccgggcggcaagggcggcaagggcgg	Protospacer
* * ********.******* ******

326. spacer 16.18|3929481|27|NC_021740|CRT matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cccgggcggcaagggcggcaagggcgg	Protospacer
* * ********.******* ******

327. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
acccggcggcaaaggcgcaatgggcgg	Protospacer
  ***************  ********

328. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP041048 (Citrobacter sp. CF971 plasmid pBM527-2, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

329. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KX832927 (Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

330. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KX786648 (Enterobacter cloacae strain B557 plasmid pB557-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

331. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KY399975 (Enterobacter cloacae strain EClY2403 plasmid pNDM1_EClY2403, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

332. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KY399974 (Enterobacter cloacae strain EClY2402 plasmid pNDM1_EClY2402, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

333. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP053895 (Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

334. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_AP023051 (Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

335. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP034756 (Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

336. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

337. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KU302802 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

338. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KU302801 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

339. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KJ588779 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US-2, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

340. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KR351290 (Klebsiella pneumoniae subsp. pneumoniae strain K351 plasmid pK351, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

341. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KJ802405 (Providencia stuartii isolate GN576 plasmid pNDM-PstGN576, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

342. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KJ812998 (Enterobacter cloacae isolate GN574 plasmid pNDM-Ec1GN574, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

343. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KP900016 (Leclercia adecarboxylata strain P10164 plasmid pP10164-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

344. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KP765744 (Enterobacter cloacae strain ECN49 plasmid pNDM-ECN49, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

345. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KP868647 (Enterobacter cloacae strain WCHECl-14653 plasmid pNDM1_EC14653, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

346. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KJ802404 (Escherichia coli isolate GN568 plasmid pNDM-EcoGN568, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

347. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KT965092 (Acinetobacter towneri strain G165 plasmid pNDM-GJ01, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

348. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KT965093 (Acinetobacter towneri strain G295 plasmid pNDM-GJ02, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

349. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_023322 (Acinetobacter bereziniae strain CHI-40-1 plasmid pNDM-40-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

350. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP029731 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

351. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KC887916 (Escherichia coli strain ARL10/167 isolate EC4 plasmid pEC4-NDM-6, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

352. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KC887917 (Enterobacter cloacae isolate ECL3 plasmid pECL3-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

353. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP020524 (Escherichia coli strain 190 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

354. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP010370 (Acinetobacter nosocomialis strain 6411 plasmid p6411-9.012kb, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

355. spacer 16.18|3929481|27|NC_021740|CRT matches to MN061454 (Enterobacter cloacae strain EC-14-60 plasmid pECL-14-60-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

356. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP032278 (Acinetobacter sp. WCHAc010034 plasmid pNDM1_010034, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

357. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP045561 (Acinetobacter nosocomialis strain AC1530 plasmid pAC1530, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

358. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019045 (Escherichia coli strain N10-2337 plasmid pNDM102337, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

359. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_025130 (Raoultella planticola strain RJA274 plasmid NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

360. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019158 (Klebsiella pneumoniae plasmid pNDM10469, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

361. spacer 16.18|3929481|27|NC_021740|CRT matches to MN310375 (Klebsiella quasipneumoniae strain QD1501 plasmid pQD1501-Ct1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

362. spacer 16.18|3929481|27|NC_021740|CRT matches to MN310377 (Klebsiella pneumoniae strain 12085 plasmid p12085-Ct1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

363. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

364. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

365. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP037965 (Klebsiella pneumoniae strain SCKP020135 plasmid pNDM1_020135, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

366. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_025184 (Klebsiella pneumoniae strain RJF866 plasmid pRJF866, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

367. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcgg-catgggcgg	CRISPR spacer
caccggcggcaaaggcggccatcgaca-	Protospacer
****************** *** *.*. 

368. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcagaggcggcaagggcgg	Protospacer
*. ********.******** ******

369. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

370. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP021962 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000008, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

371. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP022350 (Klebsiella michiganensis strain K516 plasmid pK516_NDM1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

372. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP046274 (Enterobacter hormaechei strain E70 plasmid pE70-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

373. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP039811 (Klebsiella pneumoniae strain C2660 plasmid pC2660-4-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

374. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cctcggccgcaaaggcggcattggcgg	Protospacer
* .**** ************* *****

375. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_025000 (Acinetobacter lwoffii strain Iz4b plasmid pNDM-Iz4b, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

376. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_024959 (Acinetobacter calcoaceticus strain NDM-WS2 plasmid pNDM-WS2, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

377. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gatcggcggcaagggcggcatggccgg	Protospacer
 *.*********.********** ***

378. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP021536 (Escherichia coli strain AR_0119 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

379. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP010399 (Acinetobacter baumannii strain 6200 plasmid p6200-47.274kb, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

380. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP035935 (Acinetobacter cumulans strain WCHAc060092 plasmid pNDM1_060092, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

381. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP006661 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

382. spacer 16.18|3929481|27|NC_021740|CRT matches to CP050164 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

383. spacer 16.18|3929481|27|NC_021740|CRT matches to MK933278 (Enterobacter hormaechei strain SCNJ07 plasmid pNDM-SCNJ07, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

384. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

385. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019069 (Escherichia coli plasmid pNDM10505, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

386. spacer 16.18|3929481|27|NC_021740|CRT matches to AMXH01000087 (Acinetobacter pittii strain XM1570 plasmid pXM1, complete sequence, whole genome shotgun sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

387. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_JQ739158 (Acinetobacter lwoffii strain ABZ78 plasmid pABZ78, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

388. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP043383 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

389. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019985 (Acinetobacter baumannii ZW85-1 plasmid pAbNDM-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

390. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

391. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP018366 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-2, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

392. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP023187 (Klebsiella michiganensis strain K518 plasmid pK518_NDM1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

393. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP028786 (Klebsiella pneumoniae strain SCKP020049 plasmid pNDM1_020049, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

394. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP021936 (Escherichia coli strain AR_0055 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

395. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

396. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

397. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP041938 (Klebsiella pneumoniae strain KP14003 plasmid pNDM-KP14003, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

398. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_022589 (Providencia rettgeri strain 09ACRGNY2001 plasmid pPrY2001, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

399. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP015835 (Escherichia coli strain MS6198 plasmid pMS6198A, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

400. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

401. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP014478 (Acinetobacter pittii strain AP_882 plasmid pNDM-AP_882, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

402. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_023908 (Klebsiella pneumoniae strain KP1 plasmid pKP1-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

403. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

404. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019268 (Acinetobacter lwoffii plasmid pNDM-BJ01, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

405. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019281 (Acinetobacter lwoffii plasmid pNDM-BJ02, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

406. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_025116 (Acinetobacter sp. M131 plasmid pM131_NDM1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

407. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP040884 (Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

408. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP026015 (Klebsiella variicola strain 13450 plasmid p13450-3, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

409. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_AP018143 (Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

410. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cctcggccgcaaaggcggcattggcgg	Protospacer
* .**** ************* *****

411. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP048797 (Providencia vermicola strain P8538 plasmid p8538-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

412. spacer 16.18|3929481|27|NC_021740|CRT matches to MN937240 (Enterobacter cloacae strain BSI034 plasmid pBSI034-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

413. spacer 16.18|3929481|27|NC_021740|CRT matches to MN603981 (Klebsiella aerogenes strain 1564 plasmid p1564, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

414. spacer 16.18|3929481|27|NC_021740|CRT matches to MN604268 (Escherichia coli strain J53 plasmid pJ53_SAL-19-0623_NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

415. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_LN833432 (Acinetobacter baumannii isolate CHI-32 plasmid pNDM-32, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

416. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MK123268 (Serratia marcescens strain M17468 plasmid pSMA17468, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

417. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP053897 (Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

418. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP032132 (Acinetobacter chinensis strain WCHAc010005 plasmid pNDM1_010005, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

419. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH995508 (Enterobacter cloacae strain ECL17464 plasmid pECL17464, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

420. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH995506 (Citrobacter freundii strain CFR17394 plasmid pCFR17394, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

421. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH917283 (Klebsiella pneumoniae strain A575 plasmid pA575-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

422. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH909345 (Klebsiella pneumoniae strain N201205880 plasmid p205880-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

423. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH105050 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncA/C-IncX3, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

424. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH909343 (Klebsiella pneumoniae strain 1012018 plasmid p12018-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

425. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH909347 (Klebsiella pneumoniae strain 362713 plasmid p362713-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

426. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH263652 (Providencia rettgeri strain QD51 plasmid pNDM-QD51, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

427. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH917281 (Klebsiella pneumoniae strain 14504 plasmid p14504-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

428. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MK101346 (Citrobacter freundii strain CRE3 plasmid pCRE7-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

429. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MK757441 (Alcaligenes faecalis strain AN70 plasmid pAN70-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

430. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP020090 (Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

431. spacer 16.18|3929481|27|NC_021740|CRT matches to MN657245 (Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

432. spacer 16.18|3929481|27|NC_021740|CRT matches to MN657246 (Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

433. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF344560 (Enterobacter hormaechei strain 128379 plasmid p128379-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

434. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MG462729 (Escherichia coli strain AMA1742 plasmid pAMA1742, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

435. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP035537 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-2, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

436. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

437. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

438. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

439. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KX470734 (Escherichia coli strain Ecoli14-55 plasmid pEC55-NDM4, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

440. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KY296103 (Enterobacter cloacae strain 13E169 plasmid pHN84NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

441. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KY978629 (Cronobacter sakazakii strain 505108 plasmid p505108-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

442. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF072961 (Citrobacter freundii strain P10159 plasmid pP10159-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

443. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF042356 (Enterobacter cloacae strain 20ES plasmid pNDM_20ES, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

444. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF042359 (Serratia marcescens strain 7209 plasmid pNDM_7209, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

445. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KU726616 (Salmonella enterica subsp. enterica serovar Stanley strain LS001 plasmid pHS36-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

446. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KU314941 (Klebsiella pneumoniae isolate KP04 plasmid pKP04NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

447. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KX094555 (Escherichia coli strain ZHDC33 plasmid pZHDC33, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

448. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KR059864 (Klebsiella pneumoniae strain KP-YQ13450 plasmid pYQ12450, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

449. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_KP987216 (Citrobacter freundii strain 112298 plasmid p112298-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

450. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP022126 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752AC2, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

451. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

452. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

453. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

454. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP028588 (Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

455. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP041930 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

456. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP028560 (Acinetobacter sp. WCHA45 plasmid pNDM1_010045, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

457. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_018994 (Escherichia coli plasmid pNDM-1_Dok01, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

458. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

459. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019153 (Klebsiella pneumoniae plasmid pNDM-KN, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

460. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019162 (Klebsiella pneumoniae strain CRE380 plasmid pNDM-HN380, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

461. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP032878 (Escherichia coli strain WCHEC000837 plasmid pNDM4_000837, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

462. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP018817 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

463. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cctcggccgcaaaggcggcattggcgg	Protospacer
* .**** ************* *****

464. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cctcggccgcaaaggcggcattggcgg	Protospacer
* .**** ************* *****

465. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

466. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP048828 (Acinetobacter baumannii strain ABF9692 plasmid pABF9692, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

467. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP021206 (Escherichia coli strain Z1002 plasmid p1002-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

468. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP050416 (Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

469. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP032284 (Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

470. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_020811 (Klebsiella pneumoniae strain KPN5047 plasmid pKPN5047, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

471. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP050426 (Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

472. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_023914 (Enterobacter cloacae strain CRE727 plasmid pNDM-HF727, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

473. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP044035 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

474. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP029118 (Escherichia coli strain AR435 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

475. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

476. spacer 16.18|3929481|27|NC_021740|CRT matches to MN178638 (Kluyvera cryocrescens strain SCW13 plasmid pNDM1_SCW13, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

477. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP038280 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

478. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

479. spacer 16.18|3929481|27|NC_021740|CRT matches to CP050158 (Enterobacter cloacae plasmid Carbapenemase(NDM-1)_IncX3, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

480. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

481. spacer 16.18|3929481|27|NC_021740|CRT matches to CP050161 (Escherichia coli plasmid Carbapenemase(NDM-1)_IncX3, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

482. spacer 16.18|3929481|27|NC_021740|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

483. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_021501 (Klebsiella michiganensis E718 plasmid pKOX_NDM1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

484. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP017672 (Providencia rettgeri strain RB151 plasmid pRB151-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

485. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP023914 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

486. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP029386 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pNDM6_040074, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

487. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP022226 (Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

488. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

489. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_020552 (Citrobacter freundii plasmid pYE315203, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

490. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP040598 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15_NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

491. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP014297 (Klebsiella pneumoniae strain KP38731 plasmid unnamed13 sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

492. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP020056 (Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

493. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP031884 (Klebsiella pneumoniae strain WCHKP095845 plasmid pNDM1_095845, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

494. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP031297 (Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

495. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP041229 (Acinetobacter haemolyticus strain AN54 plasmid pAhaeAN54e, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

496. spacer 16.18|3929481|27|NC_021740|CRT matches to MN604267 (Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

497. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MK372385 (Morganella morganii strain ABC140 plasmid pABC140-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

498. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MK372381 (Klebsiella pneumoniae strain ABC52 plasmid pABC52-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

499. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP053899 (Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

500. spacer 16.18|3929481|27|NC_021740|CRT matches to MN657249 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

501. spacer 16.18|3929481|27|NC_021740|CRT matches to MN657250 (Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

502. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH909333 (Klebsiella pneumoniae strain 7-SP plasmid p7SP-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

503. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH909346 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

504. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH909335 (Klebsiella pneumoniae strain 11-SP plasmid p11SP-NDM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

505. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH234505 (Escherichia coli strain CRE3694 plasmid pNDM-HK3694, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

506. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH917282 (Klebsiella pneumoniae strain A457 plasmid pA457-NDA, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

507. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH349095 (Escherichia coli strain 948 plasmid pMTC948, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

508. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MK372386 (Klebsiella pneumoniae strain BC700 plasmid pBC700-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

509. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MK372380 (Enterobacter cloacae strain ABC40 plasmid pABC40-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

510. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MK372382 (Escherichia coli strain ABC54 plasmid pABC54-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

511. spacer 16.18|3929481|27|NC_021740|CRT matches to MN657241 (Enterobacteriaceae bacterium strain 20-16 plasmid pCF104a-T3, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

512. spacer 16.18|3929481|27|NC_021740|CRT matches to MN657242 (Enterobacteriaceae bacterium strain 128-16 plasmid pEC405a-T3, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

513. spacer 16.18|3929481|27|NC_021740|CRT matches to MN657243 (Enterobacteriaceae bacterium strain 24-16 plasmid pEC744-T5, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

514. spacer 16.18|3929481|27|NC_021740|CRT matches to MN657244 (Enterobacteriaceae bacterium strain 690-16 plasmid pEC6332-T3, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

515. spacer 16.18|3929481|27|NC_021740|CRT matches to MN657247 (Enterobacteriaceae bacterium strain 460-16 plasmid pECl-T3, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

516. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

517. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH457126 (Vibrio alginolyticus strain Vb1394 plasmid pC1394, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

518. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MH105052 (Escherichia coli strain EC600 plasmid pSL131T_IncX3, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

519. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP044464 (Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

520. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF042350 (Klebsiella pneumoniae strain 18ES plasmid pNDM_18ES, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

521. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF042354 (Klebsiella pneumoniae strain 6TM plasmid pNDM_6TM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

522. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF042353 (Klebsiella pneumoniae strain 1TM plasmid pNDM_1TM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

523. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF042351 (Serratia marcescens strain 12TM plasmid pNDM_12TM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

524. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF042358 (Enterobacter cloacae strain 22ES plasmid pNDM_22ES, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

525. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF415608 (Enterobacter cloacae strain hhy03 plasmid pNDM-BJ03, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

526. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF042352 (Serratia marcescens strain 4TM plasmid pNDM_4TM, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

527. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MF042357 (Serratia marcescens strain 9580 plasmid pNDM_9580, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

528. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_MG252893 (Raoultella ornithinolytica strain pRor-30818cz plasmid Ror-30818cz, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cggcggcggcatgggcggcatgggcgg	Protospacer
*. ******** .**************

529. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
ctcaggcggcaaaggcggcagcggcgg	Protospacer
* * ****************  *****

530. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cgcgggcggcacagccggcatgggcgg	Protospacer
*.* ******* ** ************

531. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
ctcaggcggcaaaggcggcagcggcgg	Protospacer
* * ****************  *****

532. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
ctcaggcggcaaaggcggcagcggcgg	Protospacer
* * ****************  *****

533. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cgcgggcggcaacggcggcaggggcgg	Protospacer
*.* ******** ******* ******

534. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
catgggcggcatgggcggcatgggcgg	Protospacer
**. ******* .**************

535. spacer 16.18|3929481|27|NC_021740|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
catgggcggcatgggcggcatgggcgg	Protospacer
**. ******* .**************

536. spacer 16.18|3929481|27|NC_021740|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
catgggcggcatgggcggcatgggcgg	Protospacer
**. ******* .**************

537. spacer 16.18|3929481|27|NC_021740|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
catgggcggcatgggcggcatgggcgg	Protospacer
**. ******* .**************

538. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 4, identity: 0.852

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caagggcggcaagggcggcatcggcgg	Protospacer
**  ********.******** *****

539. spacer 2.4|335619|27|NC_021740|CRT matches to NC_014811 (Mycolicibacterium gilvum Spyr1 plasmid pMSPYR101, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
acggcgccgatgagcaggccggcgagc	Protospacer
.********* *************   

540. spacer 2.4|335619|27|NC_021740|CRT matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
attgcgccgaagagcaggccggagatg	Protospacer
.. ******************* * **

541. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
attgcgccgaagagcaggccggagatg	Protospacer
.. ******************* * **

542. spacer 2.4|335619|27|NC_021740|CRT matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcgccgccgacgagcaggccggcgagc	Protospacer
*** ****** *************   

543. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP018865 (Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcggcgccgaagatcaggccggtgcgc	Protospacer
************* ********.*.  

544. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021796 (Sinorhizobium meliloti strain USDA1157 plasmid accessoryA, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
attgcgccgaagagcaggccggagatg	Protospacer
.. ******************* * **

545. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcggcgccgcagcgcaggccggcggcc	Protospacer
********* ** *********** . 

546. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tcggcgccgaagaacaggcccgcgatc	Protospacer
 ************.****** *** * 

547. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcgccgccgaagagcagggcggcaagg	Protospacer
*** ************** ****.  *

548. spacer 2.4|335619|27|NC_021740|CRT matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ccggcgccgatgagcaggccgccgacg	Protospacer
 ********* ********** ** .*

549. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcgccgccgaagagcagggcggcaagg	Protospacer
*** ************** ****.  *

550. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcgccgccgaagagcagggcggcaagg	Protospacer
*** ************** ****.  *

551. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcgccgccgaagagcagggcggcaagg	Protospacer
*** ************** ****.  *

552. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcgccgccgaagagcagggcggcaagg	Protospacer
*** ************** ****.  *

553. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcgccgccgaagagcagggcggcaagg	Protospacer
*** ************** ****.  *

554. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcgccgccgaagagcagggcggcaagg	Protospacer
*** ************** ****.  *

555. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcgccgccgaagagcagggcggcaagg	Protospacer
*** ************** ****.  *

556. spacer 2.4|335619|27|NC_021740|CRT matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcgccgccgaagagcagggcggcaagg	Protospacer
*** ************** ****.  *

557. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ttggcgccgaacagcaggtcggcgtag	Protospacer
 .********* ******.****** *

558. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ttggcgccgaacagcaggtcggcgtag	Protospacer
 .********* ******.****** *

559. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcgccgccgaagagcagggcggcaagg	Protospacer
*** ************** ****.  *

560. spacer 2.4|335619|27|NC_021740|CRT matches to KM659098 (Sinorhizobium sp. LM21 plasmid pLM21S1, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ctgtcgccgatgagcaggccggcgtgg	Protospacer
 .* ****** ************** *

561. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ttggcgccgaacagcaggtcggcgtag	Protospacer
 .********* ******.****** *

562. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ttggcgccgaacagcaggtcggcgtag	Protospacer
 .********* ******.****** *

563. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ttggcgccgaacagcaggtcggcgtag	Protospacer
 .********* ******.****** *

564. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ttggcgccgaacagcaggtcggcgtag	Protospacer
 .********* ******.****** *

565. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ttggcgccgaacagcaggtcggcgtag	Protospacer
 .********* ******.****** *

566. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ttggcgccgaacagcaggtcggcgtag	Protospacer
 .********* ******.****** *

567. spacer 2.4|335619|27|NC_021740|CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
atgtcgccgaagagcaggccggcttcg	Protospacer
..* ******************* *.*

568. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ttggcgccgaacagcaggtcggcgtag	Protospacer
 .********* ******.****** *

569. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ttggcgccgaacagcaggtcggcgtag	Protospacer
 .********* ******.****** *

570. spacer 2.6|335718|24|NC_021740|CRT matches to NZ_CP030829 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence) position: , mismatch: 5, identity: 0.792

ccggcgccgaacagcatggcgttg	CRISPR spacer
atggcgccgaacagcatggcgcga	Protospacer
 .*******************. .

571. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 5, identity: 0.848

-ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gtcggcg-tgccgatgacgccggccgggccggat	Protospacer
 .***** .**** ************ *******

572. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 5, identity: 0.848

-ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gtcggcg-tgccgatgacgccggccgggccggat	Protospacer
 .***** .**** ************ *******

573. spacer 3.1|366505|27|NC_021740|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

574. spacer 3.1|366505|27|NC_021740|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

575. spacer 3.7|366901|27|NC_021740|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
gcgaagccgaagttgtagctgcgctcg	Protospacer
********** ***********   .*

576. spacer 3.7|366901|27|NC_021740|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
atgaagccgatgttgtcgctaccgggg	Protospacer
..************** ***.**** *

577. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

578. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

579. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

580. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccccgcggaagttgaggtcgcgggtg	Protospacer
 ****** ************** *. *

581. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

582. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

583. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

584. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

585. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

586. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

587. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

588. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

589. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

590. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

591. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

592. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

593. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

594. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

595. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

596. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

597. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

598. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

599. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

600. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccttaccgaagttgaggtcgacgagg	Protospacer
 **...*************** *****

601. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

602. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

603. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

604. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

605. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

606. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

607. spacer 6.6|925573|27|NC_021740|CRT matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggctgggcaggcggggatat	Protospacer
********** **** ******** . 

608. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcaccggcggggctggcggcatcgg	Protospacer
***** *************** .  **

609. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP045223 (Achromobacter xylosoxidans strain DN002 plasmid unnamed) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
ccaaagcggcgagactggcggggaggg	Protospacer
*   *******.*.*************

610. spacer 6.6|925573|27|NC_021740|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
tgttcacggcggggctggcggggacgg	Protospacer
.**. .****************** **

611. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cggcagcggcggggctggcggagccgc	Protospacer
** ******************.*  * 

612. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cggcagcggcggggctggcggagccgc	Protospacer
** ******************.*  * 

613. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
actcgccggcgcggctggcggggaggg	Protospacer
  **. ***** ***************

614. spacer 6.10|925729|27|NC_021740|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
ggcaggcggcggcggcggtagcgttgg	Protospacer
 * *  ******************** 

615. spacer 6.10|925729|27|NC_021740|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
ggcaggcggcggcggcggtagcgttgg	Protospacer
 * *  ******************** 

616. spacer 6.10|925729|27|NC_021740|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
aggatccggccgcggcggtagcgctcg	Protospacer
 ********* ************.*  

617. spacer 6.10|925729|27|NC_021740|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
aggatccggccgcggcggtagcgctcg	Protospacer
 ********* ************.*  

618. spacer 6.10|925729|27|NC_021740|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgggtccggcggcggcggtggcggttt	Protospacer
***.***************.*** * .

619. spacer 6.10|925729|27|NC_021740|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgactccggcggcgggggtagcgttcg	Protospacer
**. *********** *********  

620. spacer 6.10|925729|27|NC_021740|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgccgccggcggcggcggtggcgttgg	Protospacer
**   **************.****** 

621. spacer 6.10|925729|27|NC_021740|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
tgactccggcggcggccgtggcgttgc	Protospacer
.*. ************ **.*******

622. spacer 6.10|925729|27|NC_021740|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
tgactccggcggcggccgtggcgttgc	Protospacer
.*. ************ **.*******

623. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgaggccggcctgctggtcgtctccgggct	Protospacer
*** **************** ******   

624. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
agattccggcctgttcgtcggctccggcgg	Protospacer
 **. ********.* **************

625. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg	Protospacer
** *..********** ***** *******

626. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg	Protospacer
** ******************* * *  **

627. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggc-tccggcgg	CRISPR spacer
cgacgccggcatgccggtcggcttcctgct-	Protospacer
********** ***.******* *** **  

628. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc	Protospacer
 .************ ********* **** 

629. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc	Protospacer
 .************ ********* **** 

630. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg	Protospacer
*******.***** **********   ***

631. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctg--ttcggctccggcggcgctggcgg	CRISPR spacer
--tactgattacggctccggcggtgctggcgg	Protospacer
  *.***  * ************.********

632. spacer 6.15|925966|30|NC_021740|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833

--cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg	Protospacer
  ***.*  *************** *.*****

633. spacer 6.16|926014|24|NC_021740|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792

aaccgacctcggcggcgctggcgg	CRISPR spacer
gggcgacctcggcggcgctggcct	Protospacer
.. *******************  

634. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 5, identity: 0.853

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggcgacggcgggttcccc	Protospacer
******************** ********  *. 

635. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
gcgcggcggcctcggcgtagagccg	Protospacer
   ***************** *** 

636. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctcggcgtggccgag	Protospacer
******************.**    

637. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
caccggcggcctcggcgtagcttgc	Protospacer
..******************* . *

638. spacer 8.4|1210802|25|NC_021740|CRISPRCasFinder matches to NC_009469 (Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctcggcgtggccgag	Protospacer
******************.**    

639. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gctgccgtgggtgccatcgttgccgagt	Protospacer
*.***** *****************. .

640. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc	Protospacer
*.  ***********.********* **

641. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc	Protospacer
*.  ***********.********* **

642. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gttgccgcgggtgccctcgttgcggacg	Protospacer
******* ******* ******* *.* 

643. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gccgccgaacacgccgaagccgttt	Protospacer
 ..********************. 

644. spacer 9.5|1569737|25|NC_021740|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaacacgccgacgccgcgc	Protospacer
 **************** ****.  

645. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

646. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

647. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

648. spacer 9.13|1570379|34|NC_021740|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853

gtcgccgtgcagccagccaccaccgcca-ccggcg	CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc-	Protospacer
 *************.********* *** ** ** 

649. spacer 10.2|1634254|27|NC_021740|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 5, identity: 0.815

acctgcgttgaaggcctggttgccggg	CRISPR spacer
aagagcgctgagggcctggttgccggg	Protospacer
*   ***.***.***************

650. spacer 10.2|1634254|27|NC_021740|CRT matches to NZ_CP030832 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750d, complete sequence) position: , mismatch: 5, identity: 0.815

acctgcgttgaaggcctggttgccggg	CRISPR spacer
tgcggcgatgaaggccgggttgccggg	Protospacer
  * *** ******** **********

651. spacer 10.2|1634254|27|NC_021740|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 5, identity: 0.815

acctgcgttgaaggcctggttgccggg	CRISPR spacer
aagagcgctgagggcctggttgccggg	Protospacer
*   ***.***.***************

652. spacer 15.7|3723528|31|NC_021740|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.839

aacgccc-acttcaccgccgttgccgccgtca	CRISPR spacer
-acacccgacttcaccgccgctgccgccgaga	Protospacer
 **.*** ************.********  *

653. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caccggcggcaacggcggcatcgggca	Protospacer
************ ******** **  .

654. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

655. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP053737 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

656. spacer 16.18|3929481|27|NC_021740|CRT matches to MT077883 (Escherichia coli plasmid p23, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

657. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

658. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP013221 (Salmonella enterica subsp. enterica serovar Anatum strain GT-01 plasmid PDM02, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

659. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP024285 (Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

660. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caccggcggcaacggcggcatcgggca	Protospacer
************ ******** **  .

661. spacer 16.18|3929481|27|NC_021740|CRT matches to CP049307 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N58631 plasmid p58631, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

662. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_009140 (Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

663. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP012168 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-239.973kb, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

664. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcaaaggcggcaagagcgg	Protospacer
 . ***************** *.****

665. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_012690 (Escherichia coli plasmid peH4H, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

666. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcaaacgcggcctgggcgg	Protospacer
 . ********** ***** *******

667. spacer 16.18|3929481|27|NC_021740|CRT matches to CP048298 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-1, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

668. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019066 (Escherichia coli plasmid pAPEC1990_61, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

669. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_021813 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_01, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

670. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_012692 (Escherichia coli plasmid pAR060302, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

671. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caccggcggcaacggcggcatcgggca	Protospacer
************ ******** **  .

672. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP037904 (Escherichia coli strain LHM10-1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

673. spacer 16.18|3929481|27|NC_021740|CRT matches to MK994522 (Methanobacterium virus PhiF1, complete genome) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
aggcggcggcaaaggcggcaagggagg	Protospacer
 . ***************** *** **

674. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP013224 (Salmonella enterica subsp. enterica serovar Anatum strain GT-38 plasmid PDM04, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

675. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP009413 (Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

676. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP048296 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

677. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gccgggccggaaaggcggcatgggcgg	Protospacer
  * *** * *****************

678. spacer 16.18|3929481|27|NC_021740|CRT matches to CP049311 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N53023 plasmid pN53023, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

679. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP030191 (Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

680. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_019123 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH1148_107, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

681. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcaaaagcggcctgggcgg	Protospacer
 . **********.***** *******

682. spacer 16.18|3929481|27|NC_021740|CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
tggcggcggcatgggcggcatgggcgg	Protospacer
.. ******** .**************

683. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
tgtcggcggcaatggcggcgtgggcgg	Protospacer
...********* ******.*******

684. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caccggcggcaacggcggcatcgggca	Protospacer
************ ******** **  .

685. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gaccggcggcaatggcggcattggcct	Protospacer
 *********** ******** ***  

686. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

687. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

688. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_LT985293 (Escherichia coli strain 4410-1 plasmid RCS79_p, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

689. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_LT985268 (Escherichia coli strain 699 plasmid RCS58_p, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcatgggcggcatgggcgg	Protospacer
 . ******** .**************

690. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gaagggcggcaatggcggcatcggcgg	Protospacer
 *  ******** ******** *****

691. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cgccggcggcaagggcggcacgggcct	Protospacer
*.**********.*******.****  

692. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gccgggccggaaaggcggcatgggcgg	Protospacer
  * *** * *****************

693. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gccgggcggcatgggcggcatgggcgg	Protospacer
  * ******* .**************

694. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gcctggcggcatgggcggcatgggcgg	Protospacer
  *.******* .**************

695. spacer 16.18|3929481|27|NC_021740|CRT matches to JN698993 (Mycobacterium phage Firecracker, complete genome) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gatgggcggcaagggcggcaagggcgg	Protospacer
 *. ********.******* ******

696. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cgacggcggcgaaggcggcacgggcgc	Protospacer
*. *******.*********.***** 

697. spacer 16.18|3929481|27|NC_021740|CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
tatgggcggcatgggcggcatgggcgg	Protospacer
.*. ******* .**************

698. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gccgggccggaaaggcggcatgggcgg	Protospacer
  * *** * *****************

699. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 5, identity: 0.815

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gcctggcggcatgggcggcatgggcgg	Protospacer
  *.******* .**************

700. spacer 2.4|335619|27|NC_021740|CRT matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcggcgccgacgagcaggcccgccagc	Protospacer
********** ********* **    

701. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
agtgcgccgaagagcagggcggcgtaa	Protospacer
.  *************** ****** .

702. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tcgccgccggagagcaggccggcgcgc	Protospacer
 ** *****.**************.  

703. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
acggcggcgatgagcaggccggcgacc	Protospacer
.***** *** ************* . 

704. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

705. spacer 2.4|335619|27|NC_021740|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

706. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgttcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

707. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ccggcgccgacgagcaggtcggcgacc	Protospacer
 ********* *******.***** . 

708. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

709. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcggcgacgaagagcaggccgtccgca	Protospacer
****** ************** *  ..

710. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ccggcgccgaagagcagggcggagaac	Protospacer
 ***************** *** *   

711. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcggcggcgaacagcaggccggccacc	Protospacer
****** **** ***********  . 

712. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

713. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
acggcgccgatgagcaggccgccgaac	Protospacer
.********* ********** **   

714. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013108 (Sinorhizobium americanum strain CFNEI 73 plasmid A, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
agttcgccgaagagcacgccggcgatg	Protospacer
.   ************ ******* **

715. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

716. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgttcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

717. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

718. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

719. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgttcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

720. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

721. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

722. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

723. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

724. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

725. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

726. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

727. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

728. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP028919 (Gemmobacter sp. HYN0069 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tcggcgccgaagatcaggcgggcgact	Protospacer
 ************ ***** **** . 

729. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

730. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

731. spacer 2.4|335619|27|NC_021740|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgttcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

732. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

733. spacer 2.4|335619|27|NC_021740|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

734. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

735. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

736. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

737. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

738. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

739. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgttcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

740. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ccggcgccgaagagccgtccggcgcgc	Protospacer
 ************** * ******.  

741. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tcggcgccgaacatcaggccggcgcaa	Protospacer
 ********** * **********. .

742. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgttcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

743. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

744. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

745. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

746. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

747. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

748. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ccggcggcgaacagcaggccggcgacc	Protospacer
 ***** **** ************ . 

749. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

750. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

751. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

752. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

753. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

754. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

755. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

756. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ccggcggcgaacagcaggccggcgacc	Protospacer
 ***** **** ************ . 

757. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

758. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

759. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

760. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

761. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

762. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

763. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

764. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

765. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

766. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

767. spacer 2.4|335619|27|NC_021740|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

768. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

769. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

770. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

771. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

772. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

773. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

774. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

775. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

776. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

777. spacer 2.4|335619|27|NC_021740|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
accgcgccgaagagaaggccggcgcgt	Protospacer
.* *********** *********.  

778. spacer 2.4|335619|27|NC_021740|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
accgcgccgaagagaaggccggcgcgt	Protospacer
.* *********** *********.  

779. spacer 2.4|335619|27|NC_021740|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
accgcgccgaagagaaggccggcgcgt	Protospacer
.* *********** *********.  

780. spacer 2.4|335619|27|NC_021740|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
accgcgccgaagagaaggccggcgcgt	Protospacer
.* *********** *********.  

781. spacer 2.4|335619|27|NC_021740|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
accgcgccgaagagaaggccggcgcgt	Protospacer
.* *********** *********.  

782. spacer 2.4|335619|27|NC_021740|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
accgcgccgaagagaaggccggcgcgt	Protospacer
.* *********** *********.  

783. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

784. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

785. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

786. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
acggcgccgatgagcaggcgggcgaca	Protospacer
.********* ******** **** ..

787. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tcggcgccgaacatcaggccggcgcaa	Protospacer
 ********** * **********. .

788. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

789. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgttcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

790. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgttcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

791. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

792. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcggcgccgaagaacagggcggccagc	Protospacer
*************.**** ****    

793. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

794. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
gcggcgccgtcgagcaggccggccgcc	Protospacer
*********  ************  . 

795. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgctcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

796. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
atgtcgccgaagagcaggccggcttca	Protospacer
..* ******************* *..

797. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ccggcggcgaacagcaggccggcgacc	Protospacer
 ***** **** ************ . 

798. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
cttgcgccgaggagcaggccggcgctt	Protospacer
 . *******.*************.* 

799. spacer 2.4|335619|27|NC_021740|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgttcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

800. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgttcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

801. spacer 2.4|335619|27|NC_021740|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
tgttcgccgaagaacaggccggcgatg	Protospacer
    *********.********** **

802. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ccggcggcgaacagcaggccggcgacc	Protospacer
 ***** **** ************ . 

803. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ctcgcgccgaggagcaggcgggcgttc	Protospacer
 . *******.******** ****** 

804. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 6, identity: 0.778

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
ccggcgccgaagagcagggcggagaac	Protospacer
 ***************** *** *   

805. spacer 2.7|335763|30|NC_021740|CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 6, identity: 0.8

ccgatcccactgctggcgaccccgccagcg	CRISPR spacer
ccggcgccactgctggcgtccacgccagcc	Protospacer
***.. ************ ** ******* 

806. spacer 2.7|335763|30|NC_021740|CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 6, identity: 0.8

ccgatcccactgctggcgaccccgccagcg	CRISPR spacer
ccggcgccactgctggcgtccacgccagcc	Protospacer
***.. ************ ** ******* 

807. spacer 2.7|335763|30|NC_021740|CRT matches to KC292025 (Halovirus HHTV-1, complete genome) position: , mismatch: 6, identity: 0.8

ccgatcccactgctggcgaccccgccagcg--	CRISPR spacer
tcgatcccactgctggccaccctg--aacggc	Protospacer
.**************** ****.*  *.**  

808. spacer 2.9|335859|33|NC_021740|CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 6, identity: 0.818

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gcgatgccgccgttgccgccggccccgccgggt	Protospacer
 **..********** ******** ******.*

809. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.818

ccggcgccgccgttgacgccggccgcg--ccggat	CRISPR spacer
tccgcgccgccgtcgacgcccgccgcgacccgg--	Protospacer
.* **********.****** ******  ****  

810. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 6, identity: 0.818

-ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gcaggcg-tgccgttgacgccggtcgcgcaggaa	Protospacer
 * **** .**************.***** *** 

811. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 6, identity: 0.818

-ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gcaggcg-tgccgttgacgccggtcgcgcaggaa	Protospacer
 * **** .**************.***** *** 

812. spacer 3.1|366505|27|NC_021740|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
agttcactggtgtccacatcgcccgaa	Protospacer
*.. ***.***************** .

813. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg	Protospacer
**   *.***** ******************.*

814. spacer 3.7|366901|27|NC_021740|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ggataggcgatgttgtagctgccggaa	Protospacer
* . ** ****************** .

815. spacer 3.9|367051|27|NC_021740|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778

gccaagccgatatcgaagatcccggtg	CRISPR spacer
accatgccgatatcgacgatcccgtcc	Protospacer
.*** *********** ******* . 

816. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tagacgccgaagtcgaggtcggcgagg	Protospacer
    *********.******* *****

817. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
ctcccgccgaagttgagggtgccgaac	Protospacer
 .**************** .*****. 

818. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
aagaagccgaagttgaggtcgccgtag	Protospacer
*    ******************* .*

819. spacer 3.10|367111|27|NC_021740|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg	Protospacer
   .******.**.*************

820. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gcgccgccggtgactacgccgccagcgaca	Protospacer
.*  **********.*********.****.

821. spacer 4.2|631344|30|NC_021740|CRT matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

822. spacer 4.2|631344|30|NC_021740|CRT matches to NC_041891 (Propionibacterium phage B22, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

823. spacer 4.2|631344|30|NC_021740|CRT matches to NC_041894 (Propionibacterium phage E6, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

824. spacer 4.2|631344|30|NC_021740|CRT matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

825. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
tccacgccggtgaccacgccgaccaccttg	Protospacer
 ******************** * **  .*

826. spacer 4.2|631344|30|NC_021740|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
aagaggccggcgagcacgccgccaacgaag	Protospacer
*  * *****.** ************** *

827. spacer 4.2|631344|30|NC_021740|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

828. spacer 4.2|631344|30|NC_021740|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

829. spacer 4.2|631344|30|NC_021740|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

830. spacer 4.2|631344|30|NC_021740|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

831. spacer 4.2|631344|30|NC_021740|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

832. spacer 4.2|631344|30|NC_021740|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

833. spacer 4.2|631344|30|NC_021740|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

834. spacer 4.2|631344|30|NC_021740|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

835. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806

agcgcgaacggcaagccgaac----cgttggaccc	CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg----	Protospacer
************ ********    **.***    

836. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_LN907829 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence) position: , mismatch: 6, identity: 0.778

cgtcagcggcggggctggcggggaggg	CRISPR spacer
tgtaagcggctgggctggcggggatat	Protospacer
.** ****** ************* . 

837. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 6, identity: 0.778

cgtcagcggcggggctggcggggaggg	CRISPR spacer
tgtcagcggcggggctggcgttcatcg	Protospacer
.*******************   *  *

838. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010826 (Thermus aquaticus Y51MC23 plasmid pTA78, complete sequence) position: , mismatch: 6, identity: 0.778

cgtcagcggcggggctggcggggaggg	CRISPR spacer
tagaagcggcggggctggtggagaggg	Protospacer
..  **************.**.*****

839. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.778

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gcgcaccggcggggctggcggggcggc	Protospacer
   ** ***************** ** 

840. spacer 6.10|925729|27|NC_021740|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggatcctgcggcggcggtagaaagcc	Protospacer
******* ************* .   *

841. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc	Protospacer
 ..**.*****************.***** 

842. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc	Protospacer
 ..**.*****************.***** 

843. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgacggcctggtggtcggctacctcga	Protospacer
***** ******* ********* *  **.

844. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

845. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

846. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg	Protospacer
**    **** ***.***************

847. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

848. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg	Protospacer
**    **** ***.***************

849. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac	Protospacer
**  ** ****************.****. 

850. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

851. spacer 6.13|925870|30|NC_021740|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

852. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

853. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcg----gctccggcgg	CRISPR spacer
cgacgccggccggctggtcggagagctgcg----	Protospacer
*********** ********    *** **    

854. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

855. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

856. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg	Protospacer
** *************.******.*  * *

857. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

858. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

859. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

860. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

861. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

862. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

863. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

864. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

865. spacer 6.13|925870|30|NC_021740|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc	Protospacer
** *..************** * ****** 

866. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgccgacctgctggtcggggcggactg	Protospacer
********.************  * *.* *

867. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
caagctggtcggccccggcggcgctggcaa	Protospacer
*  **** *****.**************..

868. spacer 6.15|925966|30|NC_021740|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tcacctgtccggctccggcggcggtggcga	Protospacer
.*  ****.************** *****.

869. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

870. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

871. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg--	CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg	Protospacer
.************* ********  .**.*  

872. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

873. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

874. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

875. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

876. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg	Protospacer
* *  .*.******.***************

877. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

878. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

879. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgttcggcaccgacggcgccctccg	Protospacer
************* ***.******.  * *

880. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

881. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgttcggcaccgacggcgccctccg	Protospacer
************* ***.******.  * *

882. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgt-tcggctccggcggcgctggcgg	CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg	Protospacer
 *.**.*. .********** **********

883. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt	Protospacer
* * * *.***** *************** 

884. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt	Protospacer
* * * *.***** *************** 

885. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgt-tcggctccggcggcgctggcgg	CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg	Protospacer
 *.**.*. .********** **********

886. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgtt--cggctccggcggcgctggcgg	CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg	Protospacer
  .**.*.*  **** ****************

887. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgtt----cggctccggcggcgctggcgg	CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg	Protospacer
    * ***    *************** *****

888. spacer 6.15|925966|30|NC_021740|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8

-cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg	Protospacer
 ..** * ****** *.**************

889. spacer 6.17|926056|36|NC_021740|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 6, identity: 0.833

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
cgttgtcggcaacggcggtaacggcgggggtggcgg	Protospacer
  * .************************ .*****

890. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
ggccggcggcaagggcggcgacggcggcgccggc--	Protospacer
************ ******* *****  * .***  

891. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcgggt--ggcta	CRISPR spacer
caccggcggcaacggcggcggcggcggcttcggc--	Protospacer
 .****************** ****** *  ***  

892. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
caccggcggcagcggcggcgccggcggcacggct-	Protospacer
 .*********.*************** ..**** 

893. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
cggcggcggcaacggcggcgctggt-ggtggcaac	Protospacer
 * ******************.**. ****** * 

894. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg	Protospacer
* *********** **.********   

895. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg	Protospacer
* *********** **.********   

896. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccggcggtgccatcggtgccgagg	Protospacer
* ****** ********** *****.  

897. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc	Protospacer
  *****************.****** **  

898. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc	Protospacer
  *****************.****** **  

899. spacer 9.13|1570379|34|NC_021740|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824

--gtcgccgtgcagccagccaccaccgccaccggcg	CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca	Protospacer
  ****.*  *****  ******************.

900. spacer 10.2|1634254|27|NC_021740|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 6, identity: 0.778

acctgcgttgaaggcctggttgccggg	CRISPR spacer
gcgcacgtcgaaggcctggttgccggc	Protospacer
.* ..***.***************** 

901. spacer 15.7|3723528|31|NC_021740|CRT matches to NC_009478 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence) position: , mismatch: 6, identity: 0.806

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgaccacttcaccgccgtcgccgccggcg	Protospacer
. ** ***************.******* *.

902. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 6, identity: 0.818

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gagcagcgccaccggcggggccggcggcgactc	Protospacer
 *. .*** *****************.******

903. spacer 16.8|3928590|36|NC_021740|CRT matches to NZ_CP054842 (Acidovorax sp. 16-35-5 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.833

tagcagcggtgccggcggcaccaacggctccggcgg-	CRISPR spacer
ccgcatcggtgccggcggcaccatcggc-acggcggc	Protospacer
. *** ***************** ****  ****** 

904. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggccaaggcggcatcggcgc	Protospacer
 . ******* ********** **** 

905. spacer 16.18|3929481|27|NC_021740|CRT matches to CP047389 (Agrobacterium sp. CGMCC 11546 plasmid pA) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
taccggcggcaaaggcggcatccacct	Protospacer
.********************  .*  

906. spacer 16.18|3929481|27|NC_021740|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caccggcggcaaaggcggcaacctctt	Protospacer
********************    *  

907. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
ggtgggcggcaagggcggcaagggcgg	Protospacer
 .. ********.******* ******

908. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
tgtgggcggcacaggcggcacgggcgg	Protospacer
... ******* ********.******

909. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
ggccggcggcaatgtcggcatgggcac	Protospacer
 .********** * **********. 

910. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcaaaggcggcgagggcga	Protospacer
 . ****************. *****.

911. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caccggcggcaggggcggcatggcgac	Protospacer
***********..**********  . 

912. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
atccggcggcaccggcggcatgggcaa	Protospacer
  *********  ************..

913. spacer 16.18|3929481|27|NC_021740|CRT matches to AY129335 (Mycobacterium virus Corndog, complete genome) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
ggtgggcggcaagggcggcaagggcgg	Protospacer
 .. ********.******* ******

914. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_004685 (Mycobacterium phage Corndog, complete genome) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
ggtgggcggcaagggcggcaagggcgg	Protospacer
 .. ********.******* ******

915. spacer 16.18|3929481|27|NC_021740|CRT matches to MG099943 (Mycobacterium phage Familton, complete genome) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
ggtgggcggcaagggcggcaagggcgg	Protospacer
 .. ********.******* ******

916. spacer 16.18|3929481|27|NC_021740|CRT matches to MN585964 (Mycobacterium phage Blessica, complete genome) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
ggtgggcggcaagggcggcaagggcgg	Protospacer
 .. ********.******* ******

917. spacer 16.18|3929481|27|NC_021740|CRT matches to KJ829260 (Mycobacterium phage YungJamal, complete genome) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
ggtgggcggcaagggcggcaagggcgg	Protospacer
 .. ********.******* ******

918. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_022057 (Mycobacterium phage Catdawg, complete genome) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
ggtgggcggcaagggcggcaagggcgg	Protospacer
 .. ********.******* ******

919. spacer 16.18|3929481|27|NC_021740|CRT matches to MN428052 (Mycobacterium phage Smooch, complete genome) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
ggtgggcggcaagggcggcaagggcgg	Protospacer
 .. ********.******* ******

920. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
tggtggcggcgcaggcggcatgggcgg	Protospacer
.. .******. ***************

921. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caccggcggcgagggcggcatggtgac	Protospacer
**********.*.**********  . 

922. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_007713 (Sodalis glossinidius str. 'morsitans' plasmid pSG1, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gcccggcggcgaaggcggcctgggcca	Protospacer
  ********.******** ***** .

923. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_014840 (Pantoea sp. At-9b plasmid pPAT9B03, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gatcgtcggcaaaggcggcatggggcc	Protospacer
 *.** ******************   

924. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP032313 (Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gggcggcggcaaaggtggcatcggcga	Protospacer
 . ************.***** ****.

925. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_LN854558 (Sodalis glossinidius str. 'morsitans' isolate B4 plasmid pSG1, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gcccggcggcgaaggcggcctgggcca	Protospacer
  ********.******** ***** .

926. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caccggcggcgagggcggcatggtgac	Protospacer
**********.*.**********  . 

927. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP013528 (Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cgccggcggcaagggcggcatggcgtc	Protospacer
*.**********.**********    

928. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
tgccggcggcaaaggcggcatctgtgt	Protospacer
..*******************  *.* 

929. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP033036 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13a, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caccggcggcaaaggcgacatccttga	Protospacer
*****************.***   .*.

930. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gatcgtcggcaaaggcggcatggggcc	Protospacer
 *.** ******************   

931. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP013581 (Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
cgccggcggcaagggcggcatggcgtc	Protospacer
*.**********.**********    

932. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
tggcggcggcgacggcggcatgggcgt	Protospacer
.. *******.* ************* 

933. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_007182 (Sodalis glossinidius pSG1 plasmid from Glossina austeni) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gcccggcggcgaaggcggcctgggcca	Protospacer
  ********.******** ***** .

934. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_007183 (Sodalis glossinidius pSG1 plasmid from Glossina palpalis palpalis) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gcccggcggcgaaggcggcctgggcca	Protospacer
  ********.******** ***** .

935. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP053024 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-C-Sy, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caccggcggcgagggcggcatggtgac	Protospacer
**********.*.**********  . 

936. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_003064 (Agrobacterium fabrum str. C58 plasmid At, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caccggcggcaaaggcgacatccttga	Protospacer
*****************.***   .*.

937. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_AP022338 (Mameliella alba strain KU6B plasmid pKUB257, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gacaggcggcaagggcggcatgggtca	Protospacer
 ** ********.***********. .

938. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP021816 (Sinorhizobium meliloti strain M270 plasmid accessoryB, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg-	CRISPR spacer
caccggcggcaaaggcggc-cgtctgac	Protospacer
******************* .*  .*. 

939. spacer 16.18|3929481|27|NC_021740|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caccggcggcgagggcggcatggtgac	Protospacer
**********.*.**********  . 

940. spacer 16.18|3929481|27|NC_021740|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caccggcggcgagggcggcatggtgac	Protospacer
**********.*.**********  . 

941. spacer 16.18|3929481|27|NC_021740|CRT matches to NZ_CP033024 (Agrobacterium fabrum strain 1D132 plasmid pAt1D132a, complete sequence) position: , mismatch: 6, identity: 0.778

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
caccggcggcaaaggcgacatccttga	Protospacer
*****************.***   .*.

942. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 7, identity: 0.741

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
cgcgcgccgtagagcaggccggcgagc	Protospacer
   ****** **************   

943. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 7, identity: 0.741

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
cgcgcgccgtagagcaggccggcgagc	Protospacer
   ****** **************   

944. spacer 2.4|335619|27|NC_021740|CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 7, identity: 0.741

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
attgcgccgaagagcaggccggagcct	Protospacer
.. ******************* *.. 

945. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 7, identity: 0.741

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
cgcgcgccgtagagcaggccggcgagc	Protospacer
   ****** **************   

946. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 7, identity: 0.741

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
cgcgcgccgtagagcaggccggcgagc	Protospacer
   ****** **************   

947. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 7, identity: 0.741

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
cgcgcgccgtagagcaggccggcgagc	Protospacer
   ****** **************   

948. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 7, identity: 0.741

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
cgcgcgccgtagagcaggccggcgagc	Protospacer
   ****** **************   

949. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 7, identity: 0.741

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
cgcgcgccgtagagcaggccggcgagc	Protospacer
   ****** **************   

950. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 7, identity: 0.741

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
cgcgcgccgtagagcaggccggcgagc	Protospacer
   ****** **************   

951. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 7, identity: 0.741

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
cgcgcgccgtagagcaggccggcgagc	Protospacer
   ****** **************   

952. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 7, identity: 0.741

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
cgcgcgccgtagagcaggccggcgagc	Protospacer
   ****** **************   

953. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.741

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
attgcgccgaagagcaggccggagcct	Protospacer
.. ******************* *.. 

954. spacer 2.4|335619|27|NC_021740|CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.741

gcggcgccgaagagcaggccggcgttg	CRISPR spacer
attgcgccgaagagcaggccggagcct	Protospacer
.. ******************* *.. 

955. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.788

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
cgggcgccgccgatgacgccggccgcgtggagc	Protospacer
* ********** **************. *...

956. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttgacgccgccgttgccgccgcccgcgccgctt	Protospacer
..*.*********** ***** ********  *

957. spacer 2.9|335859|33|NC_021740|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.788

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttgacgccgccgttgccgccgcccgcgccgctt	Protospacer
..*.*********** ***** ********  *

958. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 7, identity: 0.788

ccggc--gccgccgttgacgccggccgcgccggat	CRISPR spacer
--ggttggccgccgctgccgccggccgcgccgcct	Protospacer
  **.  *******.** **************  *

959. spacer 3.4|366700|27|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741

aagccgcccgagttcgcgagaccgaag	CRISPR spacer
tgaccgcccgagttcgcgagacgttgg	Protospacer
 ..*******************   .*

960. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
taggcgccggtgaccccgccgccgacgatg	Protospacer
   .*********** *******.****.*

961. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
tgcgtggcggtgaccacgccgccaatggcg	Protospacer
  *..* ******************.*.**

962. spacer 4.2|631344|30|NC_021740|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atagcgccggtcaccgcgccgccaacgata	Protospacer
*. .******* ***.************..

963. spacer 4.2|631344|30|NC_021740|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg	Protospacer
*** **.****************.   * *

964. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
accacgccggtgacctcaccgcccgctgtg	Protospacer
*************** *.***** .* ..*

965. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
accacgccggtgacctcaccgcccgctgtg	Protospacer
*************** *.***** .* ..*

966. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg	Protospacer
*** **.****************.   * *

967. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
ccggcgccggtgaccgcgccgccaaggcag	Protospacer
 * .***********.********* *  *

968. spacer 4.2|631344|30|NC_021740|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
ggcccgccgatggccacgccgccaacggca	Protospacer
. * *****.**.**************.*.

969. spacer 4.2|631344|30|NC_021740|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gtcgaggcggtgaccacgccgccgccgacg	Protospacer
..*. * ****************. *****

970. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

971. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

972. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

973. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

974. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

975. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

976. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

977. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

978. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

979. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

980. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

981. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

982. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

983. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

984. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

985. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

986. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010614 (Phaeobacter inhibens strain P92 plasmid pP92_d, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

987. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010626 (Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

988. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010671 (Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

989. spacer 6.6|925573|27|NC_021740|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggcgggggtggcggcacacc	Protospacer
************** ****** . .  

990. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010598 (Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

991. spacer 6.6|925573|27|NC_021740|CRT matches to NC_018288 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

992. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP031955 (Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

993. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP016368 (Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattggcggcggggctggcggggatct	Protospacer
 .*..*******************   

994. spacer 6.6|925573|27|NC_021740|CRT matches to NC_018422 (Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

995. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggcgggggtggcggcacacc	Protospacer
************** ****** . .  

996. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggcgggggtggcggcacacc	Protospacer
************** ****** . .  

997. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010605 (Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

998. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010744 (Phaeobacter inhibens strain P59 plasmid pP59_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

999. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010622 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

1000. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010732 (Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

1001. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010655 (Phaeobacter inhibens strain P54 plasmid pP54_e, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

1002. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010711 (Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

1003. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010702 (Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

1004. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010748 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

1005. spacer 6.6|925573|27|NC_021740|CRT matches to NZ_CP010739 (Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

1006. spacer 6.13|925870|30|NC_021740|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc	Protospacer
 * ****************** *.***   

1007. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1008. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1009. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc	Protospacer
* .*  *.***********.********* 

1010. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1011. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1012. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc	Protospacer
* .*  *.***********.********* 

1013. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1014. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1015. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1016. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1017. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1018. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1019. spacer 6.13|925870|30|NC_021740|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgggaccggcccgctggtcggccccggctt	Protospacer
**. .******.**********.*****  

1020. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gctgggcggcctgctggtcggctggggcgg	Protospacer
    * *****************  *****

1021. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1022. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1023. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1024. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1025. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1026. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1027. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt	Protospacer
 ************* ********.*. *  

1028. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1029. spacer 6.13|925870|30|NC_021740|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1030. spacer 6.13|925870|30|NC_021740|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1031. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1032. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1033. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1034. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1035. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1036. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1037. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1038. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1039. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1040. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1041. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1042. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1043. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1044. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1045. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1046. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1047. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1048. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1049. spacer 6.13|925870|30|NC_021740|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1050. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1051. spacer 6.13|925870|30|NC_021740|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1052. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1053. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1054. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1055. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1056. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1057. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1058. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1059. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1060. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1061. spacer 6.13|925870|30|NC_021740|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1062. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1063. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1064. spacer 6.13|925870|30|NC_021740|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1065. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1066. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1067. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1068. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1069. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1070. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1071. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1072. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1073. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1074. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1075. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1076. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1077. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1078. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1079. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1080. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1081. spacer 6.13|925870|30|NC_021740|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1082. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1083. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1084. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1085. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1086. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1087. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1088. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

1089. spacer 6.13|925870|30|NC_021740|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
acacgccgccctgctggtcggcttaggtcg	Protospacer
  ****** **************. **. *

1090. spacer 6.13|925870|30|NC_021740|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc	Protospacer
 .****** **************. * ** 

1091. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
agacgccggcctgctgttcggcctcgaccc	Protospacer
 *************** *****..**.*  

1092. spacer 6.13|925870|30|NC_021740|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgggctcggcctgctgctcggcttcggcga	Protospacer
**.  .********** ******.*****.

1093. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggc-tccggcgg	CRISPR spacer
gtcggccggcctgctggtcggcgcccggct-	Protospacer
    ****************** .*****  

1094. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgacggcctgctggtcgacttcatccc	Protospacer
***** **************.**.*. *  

1095. spacer 6.13|925870|30|NC_021740|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcgccggcctgctggaccgctccgtggg	Protospacer
   ************** * ******  **

1096. spacer 6.13|925870|30|NC_021740|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac	Protospacer
**   **************** *.****. 

1097. spacer 6.13|925870|30|NC_021740|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga	Protospacer
.******* *************   * **.

1098. spacer 6.13|925870|30|NC_021740|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcgccggcctgctggaccgctccgtggg	Protospacer
   ************** * ******  **

1099. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttcggggtcggctccggcggcgctggcga	Protospacer
..*   * *********************.

1100. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttcggggtcggctccggcggcgctggcga	Protospacer
..*   * *********************.

1101. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg	Protospacer
*..  .*.*************** ******

1102. spacer 6.15|925966|30|NC_021740|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

1103. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

1104. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

1105. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

1106. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

1107. spacer 6.15|925966|30|NC_021740|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

1108. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

1109. spacer 6.15|925966|30|NC_021740|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

1110. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

1111. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

1112. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

1113. spacer 6.15|925966|30|NC_021740|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg-	CRISPR spacer
actgctgtccggctccggcggca-tgatgtc	Protospacer
 *******.*************. **..*  

1114. spacer 6.15|925966|30|NC_021740|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gccggccttcgacttcggcggcgctggcgg	Protospacer
 *.* . ****.**.***************

1115. spacer 6.15|925966|30|NC_021740|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

1116. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gttcctccacggttccggcggcgctggcgg	Protospacer
 .* ** . ***.*****************

1117. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

1118. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

1119. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

1120. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

1121. spacer 6.17|926056|36|NC_021740|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 7, identity: 0.806

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
cgtgatcggcaacggcggaaacggcgggagctgggg	Protospacer
  **************** *********. * * **

1122. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
ggccggaggcaccggcggcgccggcggcacgggc-	Protospacer
****** **** *************** ..** . 

1123. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcggg--tggcta	CRISPR spacer
gaccggcggcagcggcggcgcgggcggagccggc--	Protospacer
*.*********.********* *****.  .***  

1124. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
cgcaggcggcaacggcggccccggcggcgccgcc-	Protospacer
 ** *************** ******* *. **. 

1125. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta----	CRISPR spacer
ggccgggggcaacggcggcgacggc----gtctacgac	Protospacer
****** ************* ****    * ***    

1126. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 ******************. ******  *..**  

1127. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 ******************. ******  *..**  

1128. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcggg--tggcta	CRISPR spacer
tgtcggcggcagcggcggcggcggcggggccggc--	Protospacer
 *.********.******** *******  .***  

1129. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggt--ggcta	CRISPR spacer
ggccggcggcatcggcgacgccggctgcttcagc--	Protospacer
*********** *****.******* * *  .**  

1130. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
caccggcggccacggcggcaccggc-ggcggcgat	Protospacer
 .******** ********.***** **.*** * 

1131. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP039641 (Azospirillum sp. TSH100 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
agacggcggcaccggcggcggcggcggtgaggcc-	Protospacer
.* ******** ******** ****** * ***. 

1132. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

1133. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

1134. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

1135. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

1136. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

1137. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

1138. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

1139. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

1140. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

1141. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

1142. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
agacggtggcagcggcggcgccggcggcggtgct-	Protospacer
.* ***.****.*************** *  *** 

1143. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcggg-tggcta	CRISPR spacer
ggtcggcgccaacggcggcgccggtgaactgggt-	Protospacer
**.***** ***************.*.. *** * 

1144. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggc--gggtggcta	CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc--	Protospacer
 **.********** **********   **.***  

1145. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
tggcggcggcaacggcggcggtggc-ggtggcggt	Protospacer
 * ***************** .*** ****** . 

1146. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggc--gggtggcta	CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc--	Protospacer
 **.********** **********   **.***  

1147. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
tgctggcggcaacggcggcgtcggcatcgctggc--	Protospacer
 **.****************.****.  * ****  

1148. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
cgacggcggcaacggcggcggtggc-ggtggtcac	Protospacer
 * ***************** .*** *****..* 

1149. spacer 8.9|1211066|37|NC_021740|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.811

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
tgtcggcggtgccggcggtgccggcggtgccggcgac	Protospacer
******************..*******  . ***.**

1150. spacer 9.1|1569515|28|NC_021740|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
agcacccggggtgccgtcgttgccggcg	Protospacer
. ..** ********.*********** 

1151. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc	Protospacer
. *  **** *********.********** 

1152. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg	Protospacer
**. ***.************ ******. *.

1153. spacer 10.2|1634254|27|NC_021740|CRT matches to NZ_CP048637 (Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.741

acctgcgttgaaggcctggttgccggg	CRISPR spacer
cggcgcgtagaaggcctggttgccgcc	Protospacer
   .**** ****************  

1154. spacer 11.3|2082990|30|NC_021740|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

1155. spacer 11.3|2082990|30|NC_021740|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

1156. spacer 11.3|2082990|30|NC_021740|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

1157. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg	Protospacer
  *.************ ***.******* *.

1158. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.774

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg	Protospacer
  *.************ ***.******* *.

1159. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
atccgccatttcaccgccgttgccgacgccg	Protospacer
* *  ***.**************** **.*.

1160. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
caacggcggggccggcggtagcggcggcgcaggcgc	Protospacer
**.************************ ** ..* .

1161. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
cagcggcggggacggcggcagcggcggcgggctctt	Protospacer
*********** ******.******** *    ***

1162. spacer 16.3|3928209|36|NC_021740|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

1163. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

1164. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

1165. spacer 16.3|3928209|36|NC_021740|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

1166. spacer 16.3|3928209|36|NC_021740|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

1167. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

1168. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

1169. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

1170. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

1171. spacer 16.5|3928353|33|NC_021740|CRT matches to CP006582 (Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence) position: , mismatch: 7, identity: 0.788

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaagacggcgccggcggggccgggatcggcgc	Protospacer
*****.****.************* . **.* *

1172. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
caacggcggggccggcggtagcggcggcgcaggcgc	Protospacer
**.************************ ** ..* .

1173. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
cagcggcggggacggcggcagcggcggcgggctctt	Protospacer
*********** ******.******** *    ***

1174. spacer 16.17|3929409|36|NC_021740|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

1175. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

1176. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

1177. spacer 16.17|3929409|36|NC_021740|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

1178. spacer 16.17|3929409|36|NC_021740|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

1179. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

1180. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

1181. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

1182. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806

cagcggcggggccggcggtagcggcgg---ggccaactt	CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga---	Protospacer
********* *.***************   **.*.*   

1183. spacer 16.18|3929481|27|NC_021740|CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 7, identity: 0.741

caccggcggcaaaggcggcatgggcgg	CRISPR spacer
gcttctcggcaaaggcggcatgggcga	Protospacer
  ..  ********************.

1184. spacer 2.9|335859|33|NC_021740|CRT matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccgtcgccgccgttgccgccggccgcgatcacc	Protospacer
*** *********** *********** . . .

1185. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta	Protospacer
********* ***** ********  * **   

1186. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
caggcgccgccgtcgacgccggccgccatcgcc	Protospacer
* ***********.************  . * .

1187. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta	Protospacer
********* ***** ********  * **   

1188. spacer 2.9|335859|33|NC_021740|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta	Protospacer
********* ***** ********  * **   

1189. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
caggcgccgccgtcgacgccggccgccatcgcc	Protospacer
* ***********.************  . * .

1190. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
caggcgccgtcgttgacgccggacgcgttgccg	Protospacer
* *******.************ ****..*   

1191. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
acgaagccgccgttgccgccggccgcaccgccg	Protospacer
 **. ********** **********.***   

1192. spacer 2.9|335859|33|NC_021740|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ggggagccgccgttgccgccggccgccgccgac	Protospacer
  ** ********** **********  * **.

1193. spacer 2.9|335859|33|NC_021740|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccacccccgccgttggcgccgcccgcgccgccg	Protospacer
**. * *********.***** ********   

1194. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
acgaagccgccgtcgccgccggccgcgccgccg	Protospacer
 **. ********.* **************   

1195. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
tgatcgccgccgtcgacgccgcccgcgccatat	Protospacer
. . *********.******* *******. **

1196. spacer 2.9|335859|33|NC_021740|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccactgccggcgttgacgccgcccgcgccgccc	Protospacer
**. .**** *********** ********  .

1197. spacer 2.9|335859|33|NC_021740|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccactgccggcgttgacgccgcccgcgccgccc	Protospacer
**. .**** *********** ********  .

1198. spacer 2.9|335859|33|NC_021740|CRT matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccggcaccgccgttgccgccggccgtataggcc	Protospacer
*****.********* *********... ** .

1199. spacer 2.9|335859|33|NC_021740|CRT matches to MK524485 (Mycobacterium phage MissDaisy, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ctcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
*. ********* ****** ********.*   

1200. spacer 2.9|335859|33|NC_021740|CRT matches to MH926058 (Mycobacterium phage Reptar3000, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ctcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
*. ********* ****** ********.*   

1201. spacer 2.9|335859|33|NC_021740|CRT matches to MK524488 (Mycobacterium phage Patt, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ctcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
*. ********* ****** ********.*   

1202. spacer 2.9|335859|33|NC_021740|CRT matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccggcaccgccgttgccgccggccgtataggcc	Protospacer
*****.********* *********... ** .

1203. spacer 2.9|335859|33|NC_021740|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccactgccggcgttgacgccgcccgcgccgccc	Protospacer
**. .**** *********** ********  .

1204. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat----	CRISPR spacer
ccggcgccgccgttggcgccgac----ccgaactaca	Protospacer
***************.*****.*    ***.*.    

1205. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gcggagccgccgttgccgccggccgaacctcgt	Protospacer
 *** ********** ********* .**  .*

1206. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta	Protospacer
********* ***** ********  * **   

1207. spacer 2.9|335859|33|NC_021740|CRT matches to MH271296 (Gordonia phage Emperor, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
cccttgtcgcctttggcgccggccgcgccggtg	Protospacer
**  .*.**** ***.***************  

1208. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca	Protospacer
  * **.*****.**************** *..

1209. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

1210. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact	Protospacer
* ********.**********.**** .**.. 

1211. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc	Protospacer
 ***************** ** ***.* *  * 

1212. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

1213. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
cagacctcggtgaccacgccggcaacgatc	Protospacer
   ** .************** ******. 

1214. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.733

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
ggttggccggtgaccactccgccagcgatg	Protospacer
. .  ************ ******.***.*

1215. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgccggcctgctggtcgggctgacctc	Protospacer
********************* .. . *  

1216. spacer 6.13|925870|30|NC_021740|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg	Protospacer
* .*.    ************* *******

1217. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

1218. spacer 6.13|925870|30|NC_021740|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg	Protospacer
* .*.    ************* *******

1219. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc	Protospacer
*  .   *** ****************** 

1220. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

1221. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct	Protospacer
 * *************  ********    

1222. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

1223. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcaccgccctgctgatcggctccggcat	Protospacer
   *.*** *******.***********. 

1224. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

1225. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

1226. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt	Protospacer
 . ******************. ***  * 

1227. spacer 6.13|925870|30|NC_021740|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc	Protospacer
 *  ..************** * ****** 

1228. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

1229. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

1230. spacer 6.13|925870|30|NC_021740|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

1231. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

1232. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

1233. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

1234. spacer 6.15|925966|30|NC_021740|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgaccatctcggctccgacggcgctggcgc	Protospacer
*   *  .*********.*********** 

1235. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1236. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gccaccccgcggctccggaggcgctggcgg	Protospacer
 *..*. . ********* ***********

1237. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1238. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1239. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1240. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1241. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1242. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1243. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1244. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1245. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1246. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1247. spacer 6.15|925966|30|NC_021740|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

1248. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgatcggctccggcgccggcttctc	Protospacer
******* ************ ** .  *  

1249. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgtgcggctccggcggcaaccccga	Protospacer
 ******* *************. .  **.

1250. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgatgttcgactccggcggcgacgcacc	Protospacer
**** ******.*********** .*    

1251. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg	Protospacer
 *  *   .************** ******

1252. spacer 6.17|926056|36|NC_021740|CRT matches to MG770216 (Mycobacterium phage Rem711, complete genome) position: , mismatch: 8, identity: 0.778

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
attcggcggcaacggcggcaacggcgcggccggcgc	Protospacer
..* . ************.******* ******** 

1253. spacer 6.17|926056|36|NC_021740|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 8, identity: 0.778

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc	Protospacer
** ******** *************** * .*  * 

1254. spacer 6.17|926056|36|NC_021740|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 8, identity: 0.778

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc	Protospacer
** ******** *************** * .*  * 

1255. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
caacggcggcaacggcggcgacggcggtcgcggt--	Protospacer
 . ***************** ******  *.**.  

1256. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ccccggcggcaacggcggcaacggcggcaatgcc--	Protospacer
  *****************. ******  .** *  

1257. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
cgccggcggcagcgccggcgccggcagtatcggc--	Protospacer
 **********.** **********.*   .***  

1258. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
tgtcggcggtaacggcggcgtcggcgg--agccagc	Protospacer
 *.******.**********.******  .**.*  

1259. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

1260. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_047958 (Burkholderia phage vB_BmuP_KL4, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgccggccgcaacgacggcgccggcggccggtgc	Protospacer
 ****** ******.************ .**.  

1261. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

1262. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact	Protospacer
  ****************.**** ***  *.*.*  

1263. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcgggaagggcggcgccggcggcggtctg	Protospacer
  ******* ** **************  * **.

1264. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

1265. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

1266. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgccggcggaaacggtggcgccggcggcacggtg	Protospacer
 ******** *****.***********   * *.

1267. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
taccggcggcaatggaggcgccggcggcatcgcc-	Protospacer
 .**********.** *********** .* **. 

1268. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact	Protospacer
  ****************.**** ***  *.*.*  

1269. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact	Protospacer
  ****************.**** ***  *.*.*  

1270. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1271. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1272. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1273. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1274. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1275. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1276. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1277. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1278. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1279. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1280. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1281. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1282. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

1283. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg----gtggcta	CRISPR spacer
cggcggcggcaccggcggcaccggcggtgccgtg----	Protospacer
 * ******** *******.*******    ***    

1284. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ggccggcggcaacgggagcgccggc--ctcgccgcc	Protospacer
*************** .********   * **..  

1285. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcg-gcaacggcggcgccggcgggtggcta	CRISPR spacer
-ccgagcgcgccacggcggctccggcgggtggccc	Protospacer
  * .*** ** ******** ************. 

1286. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1287. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1288. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1289. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1290. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1291. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1292. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1293. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1294. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1295. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1296. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1297. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1298. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1299. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1300. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1301. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1302. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1303. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggccctggcggctcggtg	Protospacer
 .***************** *.***** * * *.

1304. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1305. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

1306. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
caccggcggcagcggcggcgcaggcggaaacggc--	Protospacer
 .*********.********* *****  ..***  

1307. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1308. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

1309. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
tctcggcggcgacggcggcgacggcggtgttgat-	Protospacer
  .*******.********* ****** ** * * 

1310. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcaacggcggccgcggctgccagcca	Protospacer
.******************  **** * ..**.*

1311. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
gcgcggcggcaccggcggcaccggc-ggcggtcat	Protospacer
*  ******** *******.***** **.**..* 

1312. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgtcggcggcagcggcggcggcggcggacgtcca	Protospacer
 *.********.******** ******..* *.*

1313. spacer 8.9|1211066|37|NC_021740|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.784

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
agtcggcggcggcggcggcaccggcgggaccggcggc	Protospacer
 ********.* **************** . ***..*

1314. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc	Protospacer
.   ********.******.*********  

1315. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

1316. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

1317. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

1318. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

1319. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

1320. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

1321. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc	Protospacer
.   **************** *.***** * 

1322. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

1323. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgc--gccttgcccgccgttgccgccggca	CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg	Protospacer
  ..**  **********  *********** .

1324. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
attgccgccctggccgccgttgccgccgatc	Protospacer
* *  ****.** ***************.. 

1325. spacer 11.3|2082990|30|NC_021740|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

1326. spacer 11.3|2082990|30|NC_021740|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

1327. spacer 14.24|3108841|29|NC_021740|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724

tccgcgaaattcactgcgcgttattcaag	CRISPR spacer
gacgcgaaatacactgcgctttattttca	Protospacer
  ******** ******** *****.  .

1328. spacer 15.7|3723528|31|NC_021740|CRT matches to CP033373 (Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
ttagcccacttcacggccgttgccgacgcgg	Protospacer
   *********** ********** **. .

1329. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1330. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1331. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1332. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1333. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1334. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1335. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1336. spacer 15.7|3723528|31|NC_021740|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1337. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1338. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct	Protospacer
 .*. *. ***********.********** 

1339. spacer 15.7|3723528|31|NC_021740|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1340. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1341. spacer 15.7|3723528|31|NC_021740|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

1342. spacer 15.7|3723528|31|NC_021740|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca	Protospacer
  ** . .****.*******.**********

1343. spacer 15.7|3723528|31|NC_021740|CRT matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
atcgcccacttcaccggcgtttccgaccctt	Protospacer
* ************** **** *** * .. 

1344. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 8, identity: 0.758

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaaggcggccccggcggtgccggcgataccga	Protospacer
*.******** ******* ********.. *  

1345. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.758

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cggcggcggcgccggcggggccggcggcgggac	Protospacer
*.. ******.***************.**.  *

1346. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 8, identity: 0.758

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaagacggcgccggcggggccgggatcaccac	Protospacer
*****.****.************* . *. * *

1347. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 8, identity: 0.758

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
caaagacggcgccggcggggccgggatcaccac	Protospacer
*****.****.************* . *. * *

1348. spacer 16.8|3928590|36|NC_021740|CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 8, identity: 0.778

tagcagcggtgccggcggcaccaacggctccggcgg	CRISPR spacer
gcgctgatgcgccggcgacaccaaaggctccggcgg	Protospacer
  ** *  *.*******.****** ***********

1349. spacer 2.9|335859|33|NC_021740|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
agcgcgccgccgatgacgccggccacggtggcg	Protospacer
   ********* ***********.** .**  

1350. spacer 2.9|335859|33|NC_021740|CRT matches to NC_010399 (Clavibacter michiganensis subsp. sepedonicus plasmid pCS1, complete sequence) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gctccgccgccgcagacgccggccgcgccatgc	Protospacer
 *  ********. ***************. ..

1351. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
agcgcgccgccgatgacgccggccacggtggcg	Protospacer
   ********* ***********.** .**  

1352. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
agcgcgccgccgatgacgccggccacggtggcg	Protospacer
   ********* ***********.** .**  

1353. spacer 2.9|335859|33|NC_021740|CRT matches to MN369761 (Mycobacterium phage Malthus, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

1354. spacer 2.9|335859|33|NC_021740|CRT matches to MK224497 (Mycobacterium phage Henu3, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

1355. spacer 2.9|335859|33|NC_021740|CRT matches to KJ944841 (Mycobacterium phage Cheetobro, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

1356. spacer 2.9|335859|33|NC_021740|CRT matches to AP018469 (Mycobacterium phage Y10 DNA, complete genome, note: sample1) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

1357. spacer 2.9|335859|33|NC_021740|CRT matches to KY087992 (Mycobacterium phage Mitti, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

1358. spacer 2.9|335859|33|NC_021740|CRT matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccggcaccgccgttgccgccggccgtatagacc	Protospacer
*****.********* *********... *. .

1359. spacer 2.9|335859|33|NC_021740|CRT matches to MF140402 (Mycobacterium phage Chancellor, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

1360. spacer 2.9|335859|33|NC_021740|CRT matches to AP018470 (Mycobacterium phage Y2 DNA, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

1361. spacer 2.9|335859|33|NC_021740|CRT matches to KT361920 (Mycobacterium phage Slarp, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

1362. spacer 2.9|335859|33|NC_021740|CRT matches to MT310882 (Mycobacterium phage JF1, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

1363. spacer 2.9|335859|33|NC_021740|CRT matches to AP018471 (Mycobacterium phage Y10 DNA, complete genome, note: sample2) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

1364. spacer 2.9|335859|33|NC_021740|CRT matches to KX621007 (Mycobacterium phage Taquito, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

1365. spacer 2.9|335859|33|NC_021740|CRT matches to MH051258 (Mycobacterium phage SamScheppers, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

1366. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP036221 (Mycobacterium avium subsp. hominissuis strain mc2 2500 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg	Protospacer
  **. ****** ********** ******.  

1367. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP040251 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid unnamed1) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg	Protospacer
  **. ****** ********** ******.  

1368. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP040252 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid unnamed2) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg	Protospacer
  **. ****** ********** ******.  

1369. spacer 2.9|335859|33|NC_021740|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
agggcgccgccgctgccgccggccgcctccggg	Protospacer
  **********.** ********** .* *. 

1370. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP029334 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109b, complete sequence) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg	Protospacer
  **. ****** ********** ******.  

1371. spacer 2.9|335859|33|NC_021740|CRT matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccactaccggcgttgacgccgcccgcgccgccc	Protospacer
**. ..*** *********** ********  .

1372. spacer 2.9|335859|33|NC_021740|CRT matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccactaccggcgttgacgccgcccgcgccgccc	Protospacer
**. ..*** *********** ********  .

1373. spacer 2.9|335859|33|NC_021740|CRT matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
aggacgccgccggagacgccggccgcgcggtcc	Protospacer
  *.********  ************** *  .

1374. spacer 2.9|335859|33|NC_021740|CRT matches to JX163858 (Caulobacter phage phiCbK, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccactaccggcgttgacgccgcccgcgccgccc	Protospacer
**. ..*** *********** ********  .

1375. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc	Protospacer
  *.  .******************.*****. 

1376. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

1377. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

1378. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

1379. spacer 4.2|631344|30|NC_021740|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
cccacgccggtcaccacgccgctgcccggc	Protospacer
 ********** **********.. * .  

1380. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga	Protospacer
.* .**************** .*****    

1381. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

1382. spacer 5.1|692058|31|NC_021740|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

1383. spacer 6.13|925870|30|NC_021740|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggcgccggcctgctggtcggactgctcac	Protospacer
**.****************** ..   *. 

1384. spacer 6.15|925966|30|NC_021740|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt	Protospacer
  .  .************* ***** *** 

1385. spacer 6.15|925966|30|NC_021740|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt	Protospacer
  .  .************* ***** *** 

1386. spacer 6.17|926056|36|NC_021740|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 9, identity: 0.75

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtacggc	Protospacer
** ******** *************** * ..  * 

1387. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
caacggcggcaacggcggcaacggcggcaacggc--	Protospacer
 . ****************. ******  ..***  

1388. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
cagcggcggcaacggcggccgcggcggcgacggc--	Protospacer
 . ****************  *****  *..***  

1389. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgccggcggcaactgcggcgccggcgcccaccgc	Protospacer
 ************ ************  .. *  

1390. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
cagcggcagcaatggcggcgccggcggcgccggc--	Protospacer
 . ****.****.*************  * .***  

1391. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cggcggcgggaccggcggcgccggcggcagtatc	Protospacer
 * ****** * ***************  *  * 

1392. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc	Protospacer
******************.*****.* *. . . 

1393. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc	Protospacer
******************.*****.* *. . . 

1394. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc	Protospacer
******************.*****.* *. . . 

1395. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcggcattttc	Protospacer
.**********  **************    .* 

1396. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcggcattttc	Protospacer
.**********  **************    .* 

1397. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgtcggcggccacggcggcgtcggcggtcaggaa	Protospacer
 *.******* *********.****** ..*  *

1398. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaccggcggcggcggcgggggcacc	Protospacer
 .********* ******** ******* *  . 

1399. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggcgccggcgtctaccag	Protospacer
  ********** *************  *. * .

1400. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1401. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gaccggcggcaccggcggcgccgccggccatcat	Protospacer
*.********* *********** *** .. *  

1402. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1403. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1404. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1405. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1406. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cggcggcggcaatggcggcaccggcggcacggtc	Protospacer
 * *********.******.*******   * * 

1407. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1408. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1409. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcggcagcggtggtgga	Protospacer
  ****************** *.****  *   *

1410. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1411. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1412. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1413. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1414. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1415. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1416. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1417. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1418. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1419. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1420. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1421. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1422. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1423. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

1424. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

1425. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

1426. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gaccggcggcaacggcggcggcggtggctcctcg	Protospacer
*.****************** ***.** *  ...

1427. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

1428. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

1429. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

1430. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

1431. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

1432. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

1433. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

1434. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgccggcggccccggcggcgccggccagctgcac	Protospacer
 *********  ************* .*. **  

1435. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

1436. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
ctgcggcggcgacggcggcaccggcggaggcagc--	Protospacer
   *******.********.******  **..**  

1437. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gttcggcggcgagggcggcgccggcggcaagcgt	Protospacer
* .*******.* **************  .**  

1438. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

1439. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgacggcggcaacggcggccgcggcggctccgtg	Protospacer
 * ****************  ****** *   *.

1440. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

1441. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgcggcggcgccggcggcgccggcggcgaggga	Protospacer
*  *******. ***************  .*  *

1442. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

1443. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

1444. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
caccggcggcaacggcggcaccgccgacaacggc--	Protospacer
 .*****************.*** **  ...***  

1445. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

1446. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

1447. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

1448. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

1449. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

1450. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

1451. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

1452. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
caacggcggcaacggcggcaacggcggcggcagc--	Protospacer
 . ****************. *****  **..**  

1453. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

1454. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gagcggcggcaacggcggcaacggcggcttcccc	Protospacer
*. ****************. ****** *  *. 

1455. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgacggccgcaacggcggctccggcggcgggaac	Protospacer
 * **** *********** *******  **   

1456. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

1457. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

1458. spacer 8.9|1211066|37|NC_021740|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.757

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
ggtgggcggtgccggcggcagcggcggcatggccttc	Protospacer
 ** **************** ******  *.* *  *

1459. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg	Protospacer
.... ****.***************** .*.

1460. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
tggcccgccttgccctccattgccgccggac	Protospacer
 . . ********** **.**********  

1461. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
atccttgccttgaccgccgttgccgccgctg	Protospacer
* .. .****** *************** ..

1462. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
accccagccctgcccgccgttgccgccgctc	Protospacer
* ..  ***.****************** . 

1463. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc	Protospacer
. ******** ********* ****   .* 

1464. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
accggcaccttgcccgccattgccgccatgt	Protospacer
* . **.***********.********.   

1465. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc	Protospacer
 .   *******.******* *******.* 

1466. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
agcgtggccttggccgccgttgccggcggtc	Protospacer
*..   ****** ************ ***. 

1467. spacer 15.5|3723387|34|NC_021740|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg	Protospacer
.**    .********.**** ***********.

1468. spacer 15.5|3723387|34|NC_021740|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg	Protospacer
*. . *. *****.***** *************.

1469. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

cagcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
cagcggcggggacggcggcagcggcgtgcagcgctg	Protospacer
*********** ******.******* *    .** 

1470. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
tggtgacggcaccggcggtgccggcggcgatgc	Protospacer
... *.************ *******.***. *

1471. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cggccgcggcaccggcggggccgccgccgatca	Protospacer
*..  ****************** ** ***.. 

1472. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

1473. spacer 16.5|3928353|33|NC_021740|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

1474. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

1475. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

1476. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

1477. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg	Protospacer
*.**************** * *****. . *  

1478. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg	Protospacer
*.**************** * *****. . *  

1479. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

1480. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

1481. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

1482. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ggtacccggcaccgccgaggccggcgacgagtt	Protospacer
 . *  ******** **.************ *.

1483. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

1484. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

1485. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
catgaccggcaccggcagggctggcgacgagca	Protospacer
** .. **********.****.******** . 

1486. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
catgaccggcaccggcagggctggcgacgagca	Protospacer
** .. **********.****.******** . 

1487. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg	Protospacer
* **************** * *****. . *  

1488. spacer 16.11|3928818|36|NC_021740|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.75

ggccggcggtagcggcggggccaacttcaacggcgg	CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct	Protospacer
*********** ******* ******    **.*  

1489. spacer 16.11|3928818|36|NC_021740|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.75

ggccggcggtagcggcggggccaacttcaacggcgg	CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct	Protospacer
*********** ******* ******    **.*  

1490. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

cagcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
cagcggcggggacggcggcagcggcgtgcagcgctg	Protospacer
*********** ******.******* *    .** 

1491. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
tgctcgccgccgatgacgccggccgtgcgcagt	Protospacer
.   ******** ************.**  ..*

1492. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP018080 (Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
agggcgccgccgatgacggcggccgcggtcagg	Protospacer
  ********** ***** ******** . .. 

1493. spacer 2.9|335859|33|NC_021740|CRT matches to MH371116 (Mycobacterium phage DMoney, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1494. spacer 2.9|335859|33|NC_021740|CRT matches to MH045569 (Mycobacterium phage Schiebel, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1495. spacer 2.9|335859|33|NC_021740|CRT matches to MH371119 (Mycobacterium phage OctaviousRex, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1496. spacer 2.9|335859|33|NC_021740|CRT matches to MF919497 (Mycobacterium phage Chance64, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1497. spacer 2.9|335859|33|NC_021740|CRT matches to MH001456 (Mycobacterium phage CLED96, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1498. spacer 2.9|335859|33|NC_021740|CRT matches to GQ303261 (Mycobacterium phage Hope, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1499. spacer 2.9|335859|33|NC_021740|CRT matches to MG099946 (Mycobacterium phage LouisV14, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1500. spacer 2.9|335859|33|NC_021740|CRT matches to KC787112 (Mycobacterium phage Clark, partial genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1501. spacer 2.9|335859|33|NC_021740|CRT matches to MH779513 (Mycobacterium phage Olga, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1502. spacer 2.9|335859|33|NC_021740|CRT matches to MK919475 (Mycobacterium phage Camri, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1503. spacer 2.9|335859|33|NC_021740|CRT matches to MK310146 (Mycobacterium phage Crespo, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1504. spacer 2.9|335859|33|NC_021740|CRT matches to MK524493 (Mycobacterium phage Darionha, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1505. spacer 2.9|335859|33|NC_021740|CRT matches to MH779505 (Mycobacterium phage Grizzly, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1506. spacer 2.9|335859|33|NC_021740|CRT matches to EU568876 (Mycobacterium phage BPs, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1507. spacer 2.9|335859|33|NC_021740|CRT matches to KC787107 (Mycobacterium phage Bo4, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1508. spacer 2.9|335859|33|NC_021740|CRT matches to MF668268 (Mycobacterium phage Aroostook, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1509. spacer 2.9|335859|33|NC_021740|CRT matches to MK524494 (Mycobacterium phage Rabbs, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1510. spacer 2.9|335859|33|NC_021740|CRT matches to KX588251 (Mycobacterium phage Jane, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1511. spacer 2.9|335859|33|NC_021740|CRT matches to KC787103 (Mycobacterium phage Chy2, partial genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1512. spacer 2.9|335859|33|NC_021740|CRT matches to MH001455 (Mycobacterium phage Remy19, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1513. spacer 2.9|335859|33|NC_021740|CRT matches to KT355472 (Mycobacterium phage Cedasite, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1514. spacer 2.9|335859|33|NC_021740|CRT matches to KX664455 (Mycobacterium phage Zombie, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1515. spacer 2.9|335859|33|NC_021740|CRT matches to MH077584 (Mycobacterium phage Phish, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1516. spacer 2.9|335859|33|NC_021740|CRT matches to KC787108 (Mycobacterium phage DNAIII, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1517. spacer 2.9|335859|33|NC_021740|CRT matches to MN444875 (Mycobacterium phage Jonghyun, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1518. spacer 2.9|335859|33|NC_021740|CRT matches to MK433279 (Mycobacterium phage Kareem, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1519. spacer 2.9|335859|33|NC_021740|CRT matches to KJ725374 (Mycobacterium phage Guo1, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1520. spacer 2.9|335859|33|NC_021740|CRT matches to NC_031102 (Mycobacterium phage Sneeze, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1521. spacer 2.9|335859|33|NC_021740|CRT matches to MT818422 (Mycobacterium phage Periodt, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1522. spacer 2.9|335859|33|NC_021740|CRT matches to MK305884 (Mycobacterium phage BQuat, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1523. spacer 2.9|335859|33|NC_021740|CRT matches to MF668272 (Mycobacterium phage Gideon, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1524. spacer 2.9|335859|33|NC_021740|CRT matches to KC787111 (Mycobacterium phage Sedge, partial genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1525. spacer 2.9|335859|33|NC_021740|CRT matches to KC787104 (Mycobacterium phage Chy3, partial genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1526. spacer 2.9|335859|33|NC_021740|CRT matches to NC_012788 (Mycobacterium phage Angel, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1527. spacer 2.9|335859|33|NC_021740|CRT matches to KX443326 (Mycobacterium phage BruceB, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1528. spacer 2.9|335859|33|NC_021740|CRT matches to MK433277 (Mycobacterium phage Renaissance, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1529. spacer 2.9|335859|33|NC_021740|CRT matches to MH590605 (Mycobacterium phage Cherrybomb426, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1530. spacer 2.9|335859|33|NC_021740|CRT matches to MH779509 (Mycobacterium phage Kasen3, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1531. spacer 2.9|335859|33|NC_021740|CRT matches to JN699002 (Mycobacterium phage Avrafan, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1532. spacer 2.9|335859|33|NC_021740|CRT matches to MH779507 (Mycobacterium phage Hotshotbaby7, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1533. spacer 2.9|335859|33|NC_021740|CRT matches to KT355474 (Mycobacterium phage Frosty24, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1534. spacer 2.9|335859|33|NC_021740|CRT matches to KC787109 (Mycobacterium phage Legendre, partial genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1535. spacer 2.9|335859|33|NC_021740|CRT matches to JN412593 (Mycobacterium phage Liefie, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1536. spacer 2.9|335859|33|NC_021740|CRT matches to MH479920 (Mycobacterium phage Mowgli, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1537. spacer 2.9|335859|33|NC_021740|CRT matches to KM923970 (Mycobacterium phage Gomashi, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1538. spacer 2.9|335859|33|NC_021740|CRT matches to MH450127 (Mycobacterium phage Plagueis, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1539. spacer 2.9|335859|33|NC_021740|CRT matches to KT347314 (Mycobacterium phage Phreak, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1540. spacer 2.9|335859|33|NC_021740|CRT matches to KT365399 (Mycobacterium phage Annihilator, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1541. spacer 2.9|335859|33|NC_021740|CRT matches to KC787110 (Mycobacterium phage Leo, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

1542. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

1543. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

1544. spacer 3.6|366835|33|NC_021740|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

1545. spacer 6.2|925366|39|NC_021740|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744

cggcgcgggcggggccgtcacgggaaccggcgccaccgg	CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc	Protospacer
*.  * ** ********.**************** *   

1546. spacer 6.5|925519|36|NC_021740|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

1547. spacer 6.5|925519|36|NC_021740|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

1548. spacer 6.5|925519|36|NC_021740|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

1549. spacer 6.5|925519|36|NC_021740|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

1550. spacer 6.5|925519|36|NC_021740|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

1551. spacer 6.17|926056|36|NC_021740|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 10, identity: 0.722

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
atctggaggcaacggcggtaacggcggggccagcac	Protospacer
... .  ************************.**. 

1552. spacer 6.17|926056|36|NC_021740|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gaccggcggcaacggcggaaacggcggcgccgcagc	Protospacer
* . . ************ ******** ****  * 

1553. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcg-----ggtggcta	CRISPR spacer
ccgcggcggcgacggcggcgcgggcggcaccggt-----	Protospacer
   *******.********** ****     ***     

1554. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gagcggcggcaacggcggtaccggcggtgacgtc	Protospacer
*. ***************..*******  .  * 

1555. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
acccggcggcaccggcggcgcgggcggtccggcc	Protospacer
. ********* ********* ***** . * . 

1556. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgccggcggcatcggcgccgccggcgcggcatcg	Protospacer
 ********** ***** ******** *  ....

1557. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaccggaggcgccggcggaggcacc	Protospacer
  ********* *** ***********. *  . 

1558. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
atccggcggcgccggcggcgccggcggcggaact	Protospacer
. ********. ***************  *. . 

1559. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg	Protospacer
  *****************. ****** *   ..

1560. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaccggcggcaccggcggcaccgga	Protospacer
 .********* *******.*******      *

1561. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg	Protospacer
  *****************. ****** *   ..

1562. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg	Protospacer
  *****************. ****** *   ..

1563. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1564. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to AP018709 (Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1565. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta-------	CRISPR spacer
ggccgacggcaagggcggcgcc-------ggttacgcctcc	Protospacer
*****.****** *********       **.**       

1566. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag	Protospacer
  ********* ********* ****.*   * .

1567. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1568. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgacggcggcaacagcggcaccggcggagcgaag	Protospacer
 * **********.*****.*******.  *  .

1569. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1570. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1571. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag	Protospacer
  ********* ********* ****.*   * .

1572. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1573. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1574. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_008385 (Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1575. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1576. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1577. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_MN366359 (Bacterium plasmid pALTS31, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1578. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcaacaacggcggcgccggcgccttcttc	Protospacer
 .*****..*****************  *  .* 

1579. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1580. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1581. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1582. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1583. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg	Protospacer
*  .   *** **********.********* *.

1584. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg	Protospacer
*  .   *** **********.********* *.

1585. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1586. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag	Protospacer
  ********** *****.*******  *. * .

1587. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag	Protospacer
  ********** *****.*******  *. * .

1588. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1589. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1590. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1591. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1592. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1593. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1594. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1595. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1596. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1597. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1598. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_001381 (Mycobacterium fortuitum plasmid pAL5000, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgcggcggcagcggcggcgctggcggcggcacg	Protospacer
*  ********.*********.*****  *  ..

1599. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1600. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1601. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1602. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1603. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1604. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to KU356987 (Variovorax paradoxus plasmid pBS64, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1605. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to KU356988 (Variovorax paradoxus plasmid pHB44, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1606. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcgacggcggcgacggcgccccgcgc	Protospacer
  ********.********* *****  . **  

1607. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP009797 (Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1608. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_013176 (Pseudomonas putida plasmid pW2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1609. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1610. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP017455 (Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1611. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1612. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1613. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgacgtcggcaccggcggcgccggcggcgcgaag	Protospacer
 * ** ***** ***************   *  .

1614. spacer 8.9|1211066|37|NC_021740|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 10, identity: 0.73

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc	Protospacer
. ***.**************.*******.   * * *

1615. spacer 8.9|1211066|37|NC_021740|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 10, identity: 0.73

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc	Protospacer
. ***.**************.*******.   * * *

1616. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc	Protospacer
.. . *****.********** ****** . 

1617. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg	Protospacer
  .. ****** *******.********  .

1618. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggccagaacttccccgctgttgccgccggca	Protospacer
..... . *** *****.*************

1619. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc	Protospacer
.. . *****.********** ****** . 

1620. spacer 9.10|1570130|31|NC_021740|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc	Protospacer
...   ****** ************ ***. 

1621. spacer 9.13|1570379|34|NC_021740|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706

gtcgccgtgcagccagccaccaccgccaccggcg	CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca	Protospacer
 . .. .*******.***************.**.

1622. spacer 13.9|3106243|35|NC_021740|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714

acttgcgcgcacaacgcatccgccatccacggggc	CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt	Protospacer
...  **********.***.**********. **.

1623. spacer 14.20|3109714|34|NC_021740|CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706

tagaaggcgatcactggaagcacggcgcttgcga	CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac	Protospacer
 . ********** ******* ***** . **. 

1624. spacer 14.36|3109718|34|NC_021740|PILER-CR matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706

tagaaggcgatcactggaagcacggcgcttgcga	CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac	Protospacer
 . ********** ******* ***** . **. 

1625. spacer 15.5|3723387|34|NC_021740|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc	Protospacer
   . *  ***** **************** ** 

1626. spacer 15.5|3723387|34|NC_021740|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc	Protospacer
*   .* *******.** *************.  

1627. spacer 15.5|3723387|34|NC_021740|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc	Protospacer
*   .* *******.** *************.  

1628. spacer 15.5|3723387|34|NC_021740|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc	Protospacer
*   .* *******.** *************.  

1629. spacer 16.3|3928209|36|NC_021740|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 10, identity: 0.722

cagcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
ggccggcggggccggcgggaccggcggggccggggg	Protospacer
 . *************** * **********..   

1630. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 10, identity: 0.697

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gacgcgcggcaccggctggtccggcgacgcgcg	Protospacer
 * . *********** ** *********  . 

1631. spacer 16.5|3928353|33|NC_021740|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 10, identity: 0.697

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
ggcaggcggcgccggcgaggccggcgaggggca	Protospacer
 . *******.******.********* *. . 

1632. spacer 16.17|3929409|36|NC_021740|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 10, identity: 0.722

cagcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
ggccggcggggccggcgggaccggcggggccggggg	Protospacer
 . *************** * **********..   

1633. spacer 2.9|335859|33|NC_021740|CRT matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 11, identity: 0.667

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gacaggccgccgtcgacgccggccgcaccccgc	Protospacer
   . ********.************.**  ..

1634. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caacggcggcaacggcggcaacggcggcacgtcg	Protospacer
 . ****************. ******   *...

1635. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tttcggcggcagcggcggcggcggcggaaccccg	Protospacer
  .********.******** ******.   *..

1636. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MH051334 (Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg	Protospacer
 .******** ********* ******  . . .

1637. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to MG852086 (Escherichia phage vB_EcoS-Ro145clw, complete genome) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg	Protospacer
 .******** ********* ******  . . .

1638. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggccacggcggggccggcggcgacgcg	Protospacer
 .******** ******* ********  .  ..

1639. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tttcggcggcaagggcggcgccgccggcgatcag	Protospacer
  .********* ********** ***  . * .

1640. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caggggcggcaacggcggccccggcaggacggcg	Protospacer
 .  *************** *****.**  * ..

1641. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cataggcggcgatggcggcgccggcgggatggcg	Protospacer
 .. ******.*.***************  * ..

1642. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccgacggcaagggcggcgccggatacgccccc	Protospacer
*****.****** ***********  .    *. 

1643. spacer 8.5|1210850|40|NC_021740|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.725

tgccggcggcgccggcggtgtcggcggacccgccgggttg	CRISPR spacer
ggttggcggcaccggcggtgtcggcggagccggtgacatc	Protospacer
 *..******.***************** *** .*.  * 

1644. spacer 15.5|3723387|34|NC_021740|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc	Protospacer
  ...*.  **.********.************ 

1645. spacer 16.3|3928209|36|NC_021740|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 11, identity: 0.694

cagcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc	Protospacer
*. .********************.** **    ..

1646. spacer 16.3|3928209|36|NC_021740|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 11, identity: 0.694

cagcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc	Protospacer
*. .********************.** **    ..

1647. spacer 16.5|3928353|33|NC_021740|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 11, identity: 0.667

caaaggcggcaccggcggggccggcgacgactc	CRISPR spacer
gcccggccgcaccggcggtgccggcgaccgagg	Protospacer
    *** ********** ********* .   

1648. spacer 16.17|3929409|36|NC_021740|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 11, identity: 0.694

cagcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc	Protospacer
*. .********************.** **    ..

1649. spacer 16.17|3929409|36|NC_021740|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 11, identity: 0.694

cagcggcggggccggcggtagcggcggggccaactt	CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc	Protospacer
*. .********************.** **    ..

1650. spacer 2.9|335859|33|NC_021740|CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 12, identity: 0.636

--ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
acagcgcgccgccggcgtccacggcggcgccgt--	Protospacer
     ********* .* *  **** ******   

1651. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 12, identity: 0.647

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
aaccggcggcgacggcgtcgccggcgccaattcg	Protospacer
..********.****** ********   . ...

1652. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_CP026703 (Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 12, identity: 0.647

ggccggcggcaacggcggcgc-----cggcgggtggcta	CRISPR spacer
-gccggaaacgccggcgccgctgttgcggccggtg----	Protospacer
 ***** ..*. ***** ***     **** ****    

1653. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 14, identity: 0.588

-----ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
acggcggccgccggcgccggcgtttccgccgaga-----	Protospacer
     ***** ****. ***** . *** **.*      

1654. spacer 8.3|1210745|34|NC_021740|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 15, identity: 0.559

-----ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
acggcggccgccggcgccgacgtttccgccgaga-----	Protospacer
     ***** ****. **.** . *** **.*      

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2928974 : 2967248 48 Mycobacterium_phage(30.0%) head,protease,terminase,integrase,capsid,tRNA attL 2957774:2957801|attR 2967401:2967428
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NC_021740.1|WP_009938544.1|2947889_2950226_-|PE-family-protein 2947889_2950226_- 778 aa aa NA NA NA 2928974-2967248 yes