Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_021841 Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 plasmid pSEEH1578_02, complete sequence 0 crisprs NA 0 0 0 0
NC_021810 Salmonella enterica subsp. enterica serovar Heidelberg str. 41578, complete sequence 3 crisprs cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3,WYL,csa3,PD-DExK,DEDDh,DinG 0 39 10 0
NC_021811 Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 plasmid pSEEH1578_01, complete sequence 0 crisprs NA 0 0 1 0
NC_021869 Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 plasmid pSEEH1578_03, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_021810
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021810_1 6274-7936 TypeI-E I-E
26 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021810_2 24193-25198 TypeI-E I-E
16 spacers
cas3,cas8e,cse2gr11,cas7,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021810_3 4608614-4608723 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_021810_1 1.8|6730|28|NC_021810|PILER-CR 6730-6757 28 NC_009927 Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence 337987-338014 5 0.821
NC_021810_1 1.11|6909|32|NC_021810|PILER-CR 6909-6940 32 MT774487 Salmonella phage MG40, complete genome 21746-21777 6 0.812
NC_021810_1 1.30|6894|32|NC_021810|CRT,CRISPRCasFinder 6894-6925 32 MT774487 Salmonella phage MG40, complete genome 21746-21777 6 0.812
NC_021810_1 1.7|6669|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 6669-6700 32 NZ_CP013929 Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence 188177-188208 7 0.781
NC_021810_1 1.7|6669|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 6669-6700 32 CP013931 Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence 192938-192969 7 0.781
NC_021810_1 1.7|6669|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 6669-6700 32 NC_019394 Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence 188204-188235 7 0.781
NC_021810_1 1.11|6909|32|NC_021810|PILER-CR 6909-6940 32 JQ288021 Salmonella phage SPN3UB, complete genome 39452-39483 7 0.781
NC_021810_1 1.11|6909|32|NC_021810|PILER-CR 6909-6940 32 MH370364 Salmonella phage S107, complete genome 29959-29990 7 0.781
NC_021810_1 1.11|6909|32|NC_021810|PILER-CR 6909-6940 32 MH370382 Salmonella phage S135, complete genome 29959-29990 7 0.781
NC_021810_1 1.11|6909|32|NC_021810|PILER-CR 6909-6940 32 MH370383 Salmonella phage S137, complete genome 29959-29990 7 0.781
NC_021810_1 1.14|7092|32|NC_021810|PILER-CR 7092-7123 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 535406-535437 7 0.781
NC_021810_1 1.16|7214|32|NC_021810|PILER-CR 7214-7245 32 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29079 7 0.781
NC_021810_1 1.16|7214|32|NC_021810|PILER-CR 7214-7245 32 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142294-142325 7 0.781
NC_021810_1 1.20|7458|32|NC_021810|PILER-CR 7458-7489 32 NZ_CP031397 Borreliella burgdorferi strain MM1 plasmid plsm_lp54, complete sequence 50725-50756 7 0.781
NC_021810_1 1.20|7458|32|NC_021810|PILER-CR 7458-7489 32 NZ_CP019854 Borreliella burgdorferi plasmid lp54, complete sequence 50437-50468 7 0.781
NC_021810_1 1.20|7458|32|NC_021810|PILER-CR 7458-7489 32 NZ_CP019765 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp54, complete sequence 50437-50468 7 0.781
NC_021810_1 1.20|7458|32|NC_021810|PILER-CR 7458-7489 32 NC_011784 Borreliella burgdorferi ZS7 plasmid ZS7_lp54, complete sequence 50424-50455 7 0.781
NC_021810_1 1.20|7458|32|NC_021810|PILER-CR 7458-7489 32 NZ_CP017218 Borreliella burgdorferi strain B331 plasmid B331_lp54, complete sequence 3204-3235 7 0.781
NC_021810_1 1.20|7458|32|NC_021810|PILER-CR 7458-7489 32 NC_013130 Borreliella burgdorferi N40 plasmid N40_lp54, complete sequence 50571-50602 7 0.781
NC_021810_1 1.20|7458|32|NC_021810|PILER-CR 7458-7489 32 NC_013129 Borreliella burgdorferi JD1 plasmid JD1_lp54, complete sequence 49716-49747 7 0.781
NC_021810_1 1.20|7458|32|NC_021810|PILER-CR 7458-7489 32 NC_001857 Borreliella burgdorferi B31 plasmid lp54, complete sequence 50444-50475 7 0.781
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 MH509446 Gordonia phage DelRio, complete genome 6223-6260 7 0.816
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 325874-325911 7 0.816
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NC_019201 Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence 248-285 7 0.816
NC_021810_1 1.25|7769|32|NC_021810|PILER-CR 7769-7800 32 DQ838728 Lactococcus phage P335, complete genome 1117-1148 7 0.781
NC_021810_1 1.30|6894|32|NC_021810|CRT,CRISPRCasFinder 6894-6925 32 JQ288021 Salmonella phage SPN3UB, complete genome 39452-39483 7 0.781
NC_021810_1 1.30|6894|32|NC_021810|CRT,CRISPRCasFinder 6894-6925 32 MH370364 Salmonella phage S107, complete genome 29959-29990 7 0.781
NC_021810_1 1.30|6894|32|NC_021810|CRT,CRISPRCasFinder 6894-6925 32 MH370382 Salmonella phage S135, complete genome 29959-29990 7 0.781
NC_021810_1 1.30|6894|32|NC_021810|CRT,CRISPRCasFinder 6894-6925 32 MH370383 Salmonella phage S137, complete genome 29959-29990 7 0.781
NC_021810_1 1.33|7077|32|NC_021810|CRT,CRISPRCasFinder 7077-7108 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 535406-535437 7 0.781
NC_021810_1 1.35|7199|32|NC_021810|CRT,CRISPRCasFinder 7199-7230 32 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29079 7 0.781
NC_021810_1 1.35|7199|32|NC_021810|CRT,CRISPRCasFinder 7199-7230 32 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142294-142325 7 0.781
NC_021810_1 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder 7443-7474 32 NZ_CP031397 Borreliella burgdorferi strain MM1 plasmid plsm_lp54, complete sequence 50725-50756 7 0.781
NC_021810_1 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder 7443-7474 32 NZ_CP019854 Borreliella burgdorferi plasmid lp54, complete sequence 50437-50468 7 0.781
NC_021810_1 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder 7443-7474 32 NZ_CP019765 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp54, complete sequence 50437-50468 7 0.781
NC_021810_1 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder 7443-7474 32 NC_011784 Borreliella burgdorferi ZS7 plasmid ZS7_lp54, complete sequence 50424-50455 7 0.781
NC_021810_1 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder 7443-7474 32 NZ_CP017218 Borreliella burgdorferi strain B331 plasmid B331_lp54, complete sequence 3204-3235 7 0.781
NC_021810_1 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder 7443-7474 32 NC_013130 Borreliella burgdorferi N40 plasmid N40_lp54, complete sequence 50571-50602 7 0.781
NC_021810_1 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder 7443-7474 32 NC_013129 Borreliella burgdorferi JD1 plasmid JD1_lp54, complete sequence 49716-49747 7 0.781
NC_021810_1 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder 7443-7474 32 NC_001857 Borreliella burgdorferi B31 plasmid lp54, complete sequence 50444-50475 7 0.781
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 MH509446 Gordonia phage DelRio, complete genome 6223-6260 7 0.816
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 325874-325911 7 0.816
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NC_019201 Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence 248-285 7 0.816
NC_021810_1 1.44|7754|32|NC_021810|CRT,CRISPRCasFinder 7754-7785 32 DQ838728 Lactococcus phage P335, complete genome 1117-1148 7 0.781
NC_021810_2 2.17|25080|31|NC_021810|PILER-CR 25080-25110 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 406309-406339 7 0.774
NC_021810_2 2.17|25080|31|NC_021810|PILER-CR 25080-25110 31 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1840543-1840573 7 0.774
NC_021810_2 2.17|25080|31|NC_021810|PILER-CR 25080-25110 31 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1220925-1220955 7 0.774
NC_021810_2 2.17|25080|31|NC_021810|PILER-CR 25080-25110 31 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 718851-718881 7 0.774
NC_021810_2 2.17|25080|31|NC_021810|PILER-CR 25080-25110 31 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 911450-911480 7 0.774
NC_021810_1 1.2|6364|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 6364-6395 32 MN855803 Bacteriophage sp. isolate 108, partial genome 10057-10088 8 0.75
NC_021810_1 1.6|6608|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 6608-6639 32 NZ_CP016489 Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence 8862-8893 8 0.75
NC_021810_1 1.6|6608|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 6608-6639 32 NZ_CP016476 Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence 151600-151631 8 0.75
NC_021810_1 1.15|7153|32|NC_021810|PILER-CR 7153-7184 32 NZ_CP016179 Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence 203354-203385 8 0.75
NC_021810_1 1.19|7397|32|NC_021810|PILER-CR 7397-7428 32 AP013976 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7-MedDCM-OCT-S26-C28, *** SEQUENCING IN PROGRESS *** 6246-6277 8 0.75
NC_021810_1 1.19|7397|32|NC_021810|PILER-CR 7397-7428 32 JX536274 Uncultured Mediterranean phage MEDS5 group fosmid MedDCM-OCT-S15-C5, complete sequence 3959-3990 8 0.75
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 336385-336422 8 0.789
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 619925-619962 8 0.789
NC_021810_1 1.25|7769|32|NC_021810|PILER-CR 7769-7800 32 NC_014754 Sulfuricurvum kujiense DSM 16994 plasmid pSULKU01, complete sequence 76425-76456 8 0.75
NC_021810_1 1.34|7138|32|NC_021810|CRT,CRISPRCasFinder 7138-7169 32 NZ_CP016179 Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence 203354-203385 8 0.75
NC_021810_1 1.38|7382|32|NC_021810|CRT,CRISPRCasFinder 7382-7413 32 AP013976 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7-MedDCM-OCT-S26-C28, *** SEQUENCING IN PROGRESS *** 6246-6277 8 0.75
NC_021810_1 1.38|7382|32|NC_021810|CRT,CRISPRCasFinder 7382-7413 32 JX536274 Uncultured Mediterranean phage MEDS5 group fosmid MedDCM-OCT-S15-C5, complete sequence 3959-3990 8 0.75
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 336385-336422 8 0.789
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 619925-619962 8 0.789
NC_021810_1 1.44|7754|32|NC_021810|CRT,CRISPRCasFinder 7754-7785 32 NC_014754 Sulfuricurvum kujiense DSM 16994 plasmid pSULKU01, complete sequence 76425-76456 8 0.75
NC_021810_2 2.5|24466|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24466-24497 32 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 1098771-1098802 8 0.75
NC_021810_2 2.5|24466|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24466-24497 32 NZ_CP014128 Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence 160189-160220 8 0.75
NC_021810_2 2.5|24466|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24466-24497 32 NC_014561 Pantoea vagans C9-1 plasmid pPag1, complete sequence 156443-156474 8 0.75
NC_021810_2 2.5|24466|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24466-24497 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 137983-138014 8 0.75
NC_021810_2 2.7|24588|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24588-24619 32 LQ277707 Sequence 2 from Patent WO2016071503 12422-12453 8 0.75
NC_021810_2 2.7|24588|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24588-24619 32 LZ998055 JP 2017534684-A/2: Phage Therapy 12422-12453 8 0.75
NC_021810_2 2.8|24649|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24649-24680 32 CP001770 Spirosoma linguale DSM 74 plasmid pSLIN01, complete sequence 145771-145802 8 0.75
NC_021810_2 2.16|25137|32|NC_021810|CRISPRCasFinder,CRT 25137-25168 32 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 462005-462036 8 0.75
NC_021810_2 2.17|25080|31|NC_021810|PILER-CR 25080-25110 31 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 353299-353329 8 0.742
NC_021810_1 1.11|6909|32|NC_021810|PILER-CR 6909-6940 32 MK448228 Klebsiella phage ST15-VIM1phi2.1, complete genome 32866-32897 9 0.719
NC_021810_1 1.18|7336|32|NC_021810|PILER-CR 7336-7367 32 MT162468 Synechococcus phage S-H25, complete genome 69929-69960 9 0.719
NC_021810_1 1.20|7458|32|NC_021810|PILER-CR 7458-7489 32 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 24080-24111 9 0.719
NC_021810_1 1.25|7769|32|NC_021810|PILER-CR 7769-7800 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 527800-527831 9 0.719
NC_021810_1 1.27|7891|32|NC_021810|PILER-CR 7891-7922 32 NZ_CP043846 Staphylococcus epidermidis strain ATCC 12228 plasmid unnamed, complete sequence 16198-16229 9 0.719
NC_021810_1 1.27|7891|32|NC_021810|PILER-CR 7891-7922 32 NZ_CP034117 Staphylococcus epidermidis strain CDC121 plasmid pSTA482, complete sequence 10125-10156 9 0.719
NC_021810_1 1.27|7891|32|NC_021810|PILER-CR 7891-7922 32 NZ_CP034114 Staphylococcus epidermidis strain CDC120 plasmid pSTA493, complete sequence 2991-3022 9 0.719
NC_021810_1 1.27|7891|32|NC_021810|PILER-CR 7891-7922 32 NZ_CP017904 Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence 177881-177912 9 0.719
NC_021810_1 1.27|7891|32|NC_021810|PILER-CR 7891-7922 32 NZ_CP017901 Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence 183537-183568 9 0.719
NC_021810_1 1.27|7891|32|NC_021810|PILER-CR 7891-7922 32 NZ_CP026804 Shigella flexneri strain 89-141 plasmid unnamed1 244387-244418 9 0.719
NC_021810_1 1.27|7891|32|NC_021810|PILER-CR 7891-7922 32 NZ_CP017909 Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence 180101-180132 9 0.719
NC_021810_1 1.27|7891|32|NC_021810|PILER-CR 7891-7922 32 NZ_CP017893 Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence 161475-161506 9 0.719
NC_021810_1 1.27|7891|32|NC_021810|PILER-CR 7891-7922 32 NZ_CP017898 Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence 182902-182933 9 0.719
NC_021810_1 1.30|6894|32|NC_021810|CRT,CRISPRCasFinder 6894-6925 32 MK448228 Klebsiella phage ST15-VIM1phi2.1, complete genome 32866-32897 9 0.719
NC_021810_1 1.37|7321|32|NC_021810|CRT,CRISPRCasFinder 7321-7352 32 MT162468 Synechococcus phage S-H25, complete genome 69929-69960 9 0.719
NC_021810_1 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder 7443-7474 32 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 24080-24111 9 0.719
NC_021810_1 1.44|7754|32|NC_021810|CRT,CRISPRCasFinder 7754-7785 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 527800-527831 9 0.719
NC_021810_1 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder 7876-7907 32 NZ_CP043846 Staphylococcus epidermidis strain ATCC 12228 plasmid unnamed, complete sequence 16198-16229 9 0.719
NC_021810_1 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder 7876-7907 32 NZ_CP034117 Staphylococcus epidermidis strain CDC121 plasmid pSTA482, complete sequence 10125-10156 9 0.719
NC_021810_1 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder 7876-7907 32 NZ_CP034114 Staphylococcus epidermidis strain CDC120 plasmid pSTA493, complete sequence 2991-3022 9 0.719
NC_021810_1 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder 7876-7907 32 NZ_CP017904 Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence 177881-177912 9 0.719
NC_021810_1 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder 7876-7907 32 NZ_CP017901 Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence 183537-183568 9 0.719
NC_021810_1 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder 7876-7907 32 NZ_CP026804 Shigella flexneri strain 89-141 plasmid unnamed1 244387-244418 9 0.719
NC_021810_1 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder 7876-7907 32 NZ_CP017909 Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence 180101-180132 9 0.719
NC_021810_1 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder 7876-7907 32 NZ_CP017893 Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence 161475-161506 9 0.719
NC_021810_1 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder 7876-7907 32 NZ_CP017898 Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence 182902-182933 9 0.719
NC_021810_2 2.5|24466|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24466-24497 32 NZ_CP045722 Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence 332-363 9 0.719
NC_021810_2 2.5|24466|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24466-24497 32 NZ_CP022519 Pantoea vagans strain FBS135 plasmid pPant3, complete sequence 62976-63007 9 0.719
NC_021810_2 2.5|24466|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24466-24497 32 NZ_CP028351 Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence 144976-145007 9 0.719
NC_021810_2 2.9|24710|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24710-24741 32 MN062720 Microbacterium phage FuzzBuster, complete genome 19374-19405 9 0.719
NC_021810_2 2.10|24771|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24771-24802 32 MN694645 Marine virus AFVG_250M761, complete genome 31050-31081 9 0.719
NC_021810_2 2.12|24893|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24893-24924 32 MN693046 Marine virus AFVG_25M413, complete genome 4323-4354 9 0.719
NC_021810_2 2.12|24893|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24893-24924 32 MN693008 Marine virus AFVG_117M9, complete genome 4316-4347 9 0.719
NC_021810_2 2.15|25076|32|NC_021810|CRISPRCasFinder,CRT 25076-25107 32 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 353298-353329 9 0.719
NC_021810_2 2.15|25076|32|NC_021810|CRISPRCasFinder,CRT 25076-25107 32 AM749121 Streptococcus phage M102 complete genome 7893-7924 9 0.719
NC_021810_2 2.15|25076|32|NC_021810|CRISPRCasFinder,CRT 25076-25107 32 NC_012884 Streptococcus phage M102, complete genome 7893-7924 9 0.719
NC_021810_2 2.17|25080|31|NC_021810|PILER-CR 25080-25110 31 AM749121 Streptococcus phage M102 complete genome 7893-7923 9 0.71
NC_021810_2 2.17|25080|31|NC_021810|PILER-CR 25080-25110 31 NC_012884 Streptococcus phage M102, complete genome 7893-7923 9 0.71
NC_021810_1 1.1|6303|32|NC_021810|CRISPRCasFinder,CRT 6303-6334 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1151729-1151760 10 0.688
NC_021810_1 1.1|6303|32|NC_021810|CRISPRCasFinder,CRT 6303-6334 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 661429-661460 10 0.688
NC_021810_1 1.13|7031|32|NC_021810|PILER-CR 7031-7062 32 NC_024995 Gluconacetobacter europaeus plasmid pGE3 genomic DNA, complete sequence, strain: KGMA0119 5043-5074 10 0.688
NC_021810_1 1.18|7336|32|NC_021810|PILER-CR 7336-7367 32 LN681539 Clostridium phage phiCD505, complete genome 8933-8964 10 0.688
NC_021810_1 1.18|7336|32|NC_021810|PILER-CR 7336-7367 32 JX145341 Clostridium phage phiMMP02, complete genome 8932-8963 10 0.688
NC_021810_1 1.18|7336|32|NC_021810|PILER-CR 7336-7367 32 NC_011398 Clostridium phage phiCD27, complete genome 8924-8955 10 0.688
NC_021810_1 1.18|7336|32|NC_021810|PILER-CR 7336-7367 32 NC_048642 Clostridium phage CDKM9, complete genome 8871-8902 10 0.688
NC_021810_1 1.18|7336|32|NC_021810|PILER-CR 7336-7367 32 KX228400 Clostridium phage CDKM15, complete genome 9066-9097 10 0.688
NC_021810_1 1.19|7397|32|NC_021810|PILER-CR 7397-7428 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 53255-53286 10 0.688
NC_021810_1 1.20|7458|32|NC_021810|PILER-CR 7458-7489 32 NZ_CP012188 Lactobacillus paracasei strain CAUH35 plasmid unnamed1, complete sequence 53401-53432 10 0.688
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP028537 Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence 45638-45675 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_AP023191 Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence 47029-47066 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 MN539017 Salmonella sp. strain PJM1 plasmid pPJM1, complete sequence 71631-71668 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 MN539018 Salmonella sp. strain OYZ4 plasmid pOYZ4, complete sequence 121312-121349 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 MT077888 Escherichia coli plasmid p65, complete sequence 47123-47160 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NC_009838 Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence 46527-46564 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP044306 Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence 130757-130794 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP039170 Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence 69614-69651 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 CP048299 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence 195971-196008 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 CP048303 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence 41259-41296 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP037959 Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence 45070-45107 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP039861 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence 239704-239741 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP048776 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence 45070-45107 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NC_019114 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence 43320-43357 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_AP023198 Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence 47029-47066 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP043223 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence 5920-5957 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP043223 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence 240141-240178 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP027411 Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence 73185-73222 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_KY689633 Escherichia coli strain 100R plasmid p100R, complete sequence 90192-90229 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_KY689632 Escherichia coli strain 19-M12 plasmid p19M12, complete sequence 93444-93481 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP045446 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence 47435-47472 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_KU743384 Escherichia coli strain SA26 plasmid pSA26-MCR-1, complete sequence 181822-181859 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_KU254578 Escherichia coli strain YD786 plasmid pYD786-1, complete sequence 164955-164992 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_KX129782 Escherichia coli strain S38 plasmid pS38, complete sequence 46423-46460 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP015833 Escherichia coli O157 strain 180-PT54 plasmid unnamed, complete sequence 45075-45112 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 LT221036 Yersinia pseudotuberculosis strain Yps.F1, plasmid pYps.F1 complete sequence 41890-41927 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 CP019195 Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence 98508-98545 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP045449 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence 47434-47471 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 MN732922 Escherichia coli strain 49K plasmid unnamed, complete sequence 70876-70913 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP020493 Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-1, complete sequence 47990-48027 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 CP031284 Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence 60929-60966 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 CP042895 Escherichia coli strain CFSAN061772 plasmid pCFSAN061772_02, complete sequence 106230-106267 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP022735 Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence 61639-61676 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 CP042898 Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_02, complete sequence 125697-125734 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP022165 Escherichia coli strain M160133 plasmid pM160133_p1, complete sequence 45073-45110 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP012931 Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence 119613-119650 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP023143 Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence 136437-136474 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP026936 Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence 46422-46459 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP025402 Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence 182643-182680 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP026933 Escherichia coli strain CFS3273 plasmid pCFS3273-1, complete sequence 46272-46309 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_MH924589 Escherichia coli strain RDB9 plasmid pRDB9, complete sequence 197020-197057 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_MH208235 Escherichia coli strain APECA2 plasmid pJMA2, complete sequence 166860-166897 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_MK169211 Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence 46085-46122 10 0.737
NC_021810_1 1.24|7702|38|NC_021810|PILER-CR 7702-7739 38 NZ_CP016838 Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence 46814-46851 10 0.737
NC_021810_1 1.27|7891|32|NC_021810|PILER-CR 7891-7922 32 NZ_CP044540 Borrelia sp. CA690 plasmid lp17, complete sequence 10481-10512 10 0.688
NC_021810_1 1.27|7891|32|NC_021810|PILER-CR 7891-7922 32 NZ_LR215005 Mycoplasma conjunctivae strain NCTC10147 plasmid 9 126578-126609 10 0.688
NC_021810_1 1.32|7016|32|NC_021810|CRT,CRISPRCasFinder 7016-7047 32 NC_024995 Gluconacetobacter europaeus plasmid pGE3 genomic DNA, complete sequence, strain: KGMA0119 5043-5074 10 0.688
NC_021810_1 1.37|7321|32|NC_021810|CRT,CRISPRCasFinder 7321-7352 32 LN681539 Clostridium phage phiCD505, complete genome 8933-8964 10 0.688
NC_021810_1 1.37|7321|32|NC_021810|CRT,CRISPRCasFinder 7321-7352 32 JX145341 Clostridium phage phiMMP02, complete genome 8932-8963 10 0.688
NC_021810_1 1.37|7321|32|NC_021810|CRT,CRISPRCasFinder 7321-7352 32 NC_011398 Clostridium phage phiCD27, complete genome 8924-8955 10 0.688
NC_021810_1 1.37|7321|32|NC_021810|CRT,CRISPRCasFinder 7321-7352 32 NC_048642 Clostridium phage CDKM9, complete genome 8871-8902 10 0.688
NC_021810_1 1.37|7321|32|NC_021810|CRT,CRISPRCasFinder 7321-7352 32 KX228400 Clostridium phage CDKM15, complete genome 9066-9097 10 0.688
NC_021810_1 1.38|7382|32|NC_021810|CRT,CRISPRCasFinder 7382-7413 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 53255-53286 10 0.688
NC_021810_1 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder 7443-7474 32 NZ_CP012188 Lactobacillus paracasei strain CAUH35 plasmid unnamed1, complete sequence 53401-53432 10 0.688
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP028537 Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence 45638-45675 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_AP023191 Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence 47029-47066 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 MN539017 Salmonella sp. strain PJM1 plasmid pPJM1, complete sequence 71631-71668 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 MN539018 Salmonella sp. strain OYZ4 plasmid pOYZ4, complete sequence 121312-121349 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 MT077888 Escherichia coli plasmid p65, complete sequence 47123-47160 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NC_009838 Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence 46527-46564 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP044306 Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence 130757-130794 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP039170 Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence 69614-69651 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 CP048299 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence 195971-196008 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 CP048303 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence 41259-41296 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP037959 Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence 45070-45107 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP039861 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence 239704-239741 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP048776 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence 45070-45107 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NC_019114 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence 43320-43357 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_AP023198 Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence 47029-47066 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP043223 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence 5920-5957 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP043223 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence 240141-240178 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP027411 Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence 73185-73222 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_KY689633 Escherichia coli strain 100R plasmid p100R, complete sequence 90192-90229 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_KY689632 Escherichia coli strain 19-M12 plasmid p19M12, complete sequence 93444-93481 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP045446 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence 47435-47472 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_KU743384 Escherichia coli strain SA26 plasmid pSA26-MCR-1, complete sequence 181822-181859 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_KU254578 Escherichia coli strain YD786 plasmid pYD786-1, complete sequence 164955-164992 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_KX129782 Escherichia coli strain S38 plasmid pS38, complete sequence 46423-46460 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP015833 Escherichia coli O157 strain 180-PT54 plasmid unnamed, complete sequence 45075-45112 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 LT221036 Yersinia pseudotuberculosis strain Yps.F1, plasmid pYps.F1 complete sequence 41890-41927 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 CP019195 Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence 98508-98545 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP045449 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence 47434-47471 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 MN732922 Escherichia coli strain 49K plasmid unnamed, complete sequence 70876-70913 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP020493 Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-1, complete sequence 47990-48027 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 CP031284 Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence 60929-60966 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 CP042895 Escherichia coli strain CFSAN061772 plasmid pCFSAN061772_02, complete sequence 106230-106267 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP022735 Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence 61639-61676 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 CP042898 Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_02, complete sequence 125697-125734 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP022165 Escherichia coli strain M160133 plasmid pM160133_p1, complete sequence 45073-45110 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP012931 Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence 119613-119650 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP023143 Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence 136437-136474 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP026936 Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence 46422-46459 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP025402 Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence 182643-182680 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP026933 Escherichia coli strain CFS3273 plasmid pCFS3273-1, complete sequence 46272-46309 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_MH924589 Escherichia coli strain RDB9 plasmid pRDB9, complete sequence 197020-197057 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_MH208235 Escherichia coli strain APECA2 plasmid pJMA2, complete sequence 166860-166897 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_MK169211 Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence 46085-46122 10 0.737
NC_021810_1 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder 7687-7724 38 NZ_CP016838 Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence 46814-46851 10 0.737
NC_021810_1 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder 7876-7907 32 NZ_CP044540 Borrelia sp. CA690 plasmid lp17, complete sequence 10481-10512 10 0.688
NC_021810_1 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder 7876-7907 32 NZ_LR215005 Mycoplasma conjunctivae strain NCTC10147 plasmid 9 126578-126609 10 0.688
NC_021810_2 2.1|24222|32|NC_021810|CRISPRCasFinder,CRT 24222-24253 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 146919-146950 10 0.688
NC_021810_2 2.4|24405|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24405-24436 32 NZ_CP044072 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence 99817-99848 10 0.688
NC_021810_2 2.9|24710|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24710-24741 32 NZ_CP019257 Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence 20006-20037 10 0.688
NC_021810_2 2.9|24710|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24710-24741 32 NZ_CP019274 Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence 9024-9055 10 0.688
NC_021810_2 2.9|24710|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24710-24741 32 NZ_CP019275 Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence 27130-27161 10 0.688
NC_021810_2 2.9|24710|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24710-24741 32 NZ_CP019279 Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence 19363-19394 10 0.688
NC_021810_2 2.9|24710|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24710-24741 32 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 23427-23458 10 0.688
NC_021810_2 2.9|24710|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24710-24741 32 NC_049342 Escherichia phage 500465-1, complete genome 24342-24373 10 0.688
NC_021810_2 2.9|24710|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24710-24741 32 KY271398 Klebsiella phage 4 LV-2017, complete genome 28240-28271 10 0.688
NC_021810_2 2.9|24710|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR 24710-24741 32 CP025900 Escherichia phage sp., complete genome 24342-24373 10 0.688
NC_021810_2 2.14|25015|32|NC_021810|CRISPRCasFinder,CRT 25015-25046 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 1134787-1134818 10 0.688
NC_021810_1 1.27|7891|32|NC_021810|PILER-CR 7891-7922 32 NZ_CP041669 Legionella israelensis strain L18-01051 plasmid unnamed, complete sequence 45678-45709 11 0.656
NC_021810_1 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder 7876-7907 32 NZ_CP041669 Legionella israelensis strain L18-01051 plasmid unnamed, complete sequence 45678-45709 11 0.656

1. spacer 1.8|6730|28|NC_021810|PILER-CR matches to NC_009927 (Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence) position: , mismatch: 5, identity: 0.821 

gatcgagtaacgtgcgctggaacgcgtc	CRISPR spacer
gattgaggaacgtgcgctggaacgatta	Protospacer
***.*** ****************  *

2. spacer 1.11|6909|32|NC_021810|PILER-CR matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 6, identity: 0.812 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
ccagccagtgccggtagtgcctgatgaaatgg	Protospacer
****  **********************  .

3. spacer 1.30|6894|32|NC_021810|CRT,CRISPRCasFinder matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 6, identity: 0.812 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
ccagccagtgccggtagtgcctgatgaaatgg	Protospacer
****  **********************  .

4. spacer 1.7|6669|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013929 (Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence) position: , mismatch: 7, identity: 0.781 

aatcact--gcgggggtatttagcggaaacggct	CRISPR spacer
--tcgctgcgcgggggtatttagcgaaatcgggg	Protospacer
  **.**  ****************.** ***

5. spacer 1.7|6669|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to CP013931 (Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence) position: , mismatch: 7, identity: 0.781 

aatcact--gcgggggtatttagcggaaacggct	CRISPR spacer
--tcgctgcgcgggggtatttagcgaaatcgggg	Protospacer
  **.**  ****************.** ***

6. spacer 1.7|6669|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to NC_019394 (Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence) position: , mismatch: 7, identity: 0.781 

aatcact--gcgggggtatttagcggaaacggct	CRISPR spacer
--tcgctgcgcgggggtatttagcgaaatcgggg	Protospacer
  **.**  ****************.** ***

7. spacer 1.11|6909|32|NC_021810|PILER-CR matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

8. spacer 1.11|6909|32|NC_021810|PILER-CR matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

9. spacer 1.11|6909|32|NC_021810|PILER-CR matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

10. spacer 1.11|6909|32|NC_021810|PILER-CR matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

11. spacer 1.14|7092|32|NC_021810|PILER-CR matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

ggcagcgggcgaggcaaacacattcggggcgt	CRISPR spacer
gccacggcgcgaggcaaacacattcaggtcgc	Protospacer
* **  * *****************.** **.

12. spacer 1.16|7214|32|NC_021810|PILER-CR matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 7, identity: 0.781 

gaatctaatgcaacagatgaataaacacgtaa	CRISPR spacer
gcttctaatgcaatagatgaagaaacaccaat	Protospacer
*  **********.******* ******  *

13. spacer 1.16|7214|32|NC_021810|PILER-CR matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781 

gaatctaatgcaacagatgaataaacacgtaa	CRISPR spacer
gcttctaatgcaatagatgaagaaacaccaat	Protospacer
*  **********.******* ******  *

14. spacer 1.20|7458|32|NC_021810|PILER-CR matches to NZ_CP031397 (Borreliella burgdorferi strain MM1 plasmid plsm_lp54, complete sequence) position: , mismatch: 7, identity: 0.781 

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

15. spacer 1.20|7458|32|NC_021810|PILER-CR matches to NZ_CP019854 (Borreliella burgdorferi plasmid lp54, complete sequence) position: , mismatch: 7, identity: 0.781 

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

16. spacer 1.20|7458|32|NC_021810|PILER-CR matches to NZ_CP019765 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp54, complete sequence) position: , mismatch: 7, identity: 0.781 

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

17. spacer 1.20|7458|32|NC_021810|PILER-CR matches to NC_011784 (Borreliella burgdorferi ZS7 plasmid ZS7_lp54, complete sequence) position: , mismatch: 7, identity: 0.781 

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

18. spacer 1.20|7458|32|NC_021810|PILER-CR matches to NZ_CP017218 (Borreliella burgdorferi strain B331 plasmid B331_lp54, complete sequence) position: , mismatch: 7, identity: 0.781 

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

19. spacer 1.20|7458|32|NC_021810|PILER-CR matches to NC_013130 (Borreliella burgdorferi N40 plasmid N40_lp54, complete sequence) position: , mismatch: 7, identity: 0.781 

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

20. spacer 1.20|7458|32|NC_021810|PILER-CR matches to NC_013129 (Borreliella burgdorferi JD1 plasmid JD1_lp54, complete sequence) position: , mismatch: 7, identity: 0.781 

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

21. spacer 1.20|7458|32|NC_021810|PILER-CR matches to NC_001857 (Borreliella burgdorferi B31 plasmid lp54, complete sequence) position: , mismatch: 7, identity: 0.781 

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

22. spacer 1.24|7702|38|NC_021810|PILER-CR matches to MH509446 (Gordonia phage DelRio, complete genome) position: , mismatch: 7, identity: 0.816 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tctcggtttcggtctcggtcgcggtctcggtgccctcg	Protospacer
*******.************ **********. .  **

23. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.816 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tcgcggtctcggtctcggtctcggtcttgtcggcggcg	Protospacer
** ************************.* ..*.*.**

24. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NC_019201 (Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence) position: , mismatch: 7, identity: 0.816 

tctcggtctcggtctcggtctcggtctcg-gtagtgacg	CRISPR spacer
gctcggtctcagtctcggtctcagtctcgcgtgggggc-	Protospacer
 *********.***********.****** **.* *.*

25. spacer 1.25|7769|32|NC_021810|PILER-CR matches to DQ838728 (Lactococcus phage P335, complete genome) position: , mismatch: 7, identity: 0.781 

attttatttgacaaattggcggcatctcactg-	CRISPR spacer
ttgttatttcagaaattggcggcatc-cgctat	Protospacer
 * ****** * ************** *.**.

26. spacer 1.30|6894|32|NC_021810|CRT,CRISPRCasFinder matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

27. spacer 1.30|6894|32|NC_021810|CRT,CRISPRCasFinder matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

28. spacer 1.30|6894|32|NC_021810|CRT,CRISPRCasFinder matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

29. spacer 1.30|6894|32|NC_021810|CRT,CRISPRCasFinder matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

30. spacer 1.33|7077|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

ggcagcgggcgaggcaaacacattcggggcgt	CRISPR spacer
gccacggcgcgaggcaaacacattcaggtcgc	Protospacer
* **  * *****************.** **.

31. spacer 1.35|7199|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 7, identity: 0.781 

gaatctaatgcaacagatgaataaacacgtaa	CRISPR spacer
gcttctaatgcaatagatgaagaaacaccaat	Protospacer
*  **********.******* ******  *

32. spacer 1.35|7199|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781 

gaatctaatgcaacagatgaataaacacgtaa	CRISPR spacer
gcttctaatgcaatagatgaagaaacaccaat	Protospacer
*  **********.******* ******  *

33. spacer 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP031397 (Borreliella burgdorferi strain MM1 plasmid plsm_lp54, complete sequence) position: , mismatch: 7, identity: 0.781 

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

34. spacer 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP019854 (Borreliella burgdorferi plasmid lp54, complete sequence) position: , mismatch: 7, identity: 0.781 

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

35. spacer 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP019765 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp54, complete sequence) position: , mismatch: 7, identity: 0.781 

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

36. spacer 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder matches to NC_011784 (Borreliella burgdorferi ZS7 plasmid ZS7_lp54, complete sequence) position: , mismatch: 7, identity: 0.781 

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

37. spacer 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP017218 (Borreliella burgdorferi strain B331 plasmid B331_lp54, complete sequence) position: , mismatch: 7, identity: 0.781 

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

38. spacer 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder matches to NC_013130 (Borreliella burgdorferi N40 plasmid N40_lp54, complete sequence) position: , mismatch: 7, identity: 0.781 

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

39. spacer 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder matches to NC_013129 (Borreliella burgdorferi JD1 plasmid JD1_lp54, complete sequence) position: , mismatch: 7, identity: 0.781 

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

40. spacer 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder matches to NC_001857 (Borreliella burgdorferi B31 plasmid lp54, complete sequence) position: , mismatch: 7, identity: 0.781 

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

41. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to MH509446 (Gordonia phage DelRio, complete genome) position: , mismatch: 7, identity: 0.816 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tctcggtttcggtctcggtcgcggtctcggtgccctcg	Protospacer
*******.************ **********. .  **

42. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.816 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tcgcggtctcggtctcggtctcggtcttgtcggcggcg	Protospacer
** ************************.* ..*.*.**

43. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NC_019201 (Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence) position: , mismatch: 7, identity: 0.816 

tctcggtctcggtctcggtctcggtctcg-gtagtgacg	CRISPR spacer
gctcggtctcagtctcggtctcagtctcgcgtgggggc-	Protospacer
 *********.***********.****** **.* *.*

44. spacer 1.44|7754|32|NC_021810|CRT,CRISPRCasFinder matches to DQ838728 (Lactococcus phage P335, complete genome) position: , mismatch: 7, identity: 0.781 

attttatttgacaaattggcggcatctcactg-	CRISPR spacer
ttgttatttcagaaattggcggcatc-cgctat	Protospacer
 * ****** * ************** *.**.

45. spacer 2.17|25080|31|NC_021810|PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774 

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ctcggcggacgaggagttgctcaaccgcgcc	Protospacer
*   *.************.*********  *

46. spacer 2.17|25080|31|NC_021810|PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.774 

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ctcggcggacgaggagttgctcaaccgcgcc	Protospacer
*   *.************.*********  *

47. spacer 2.17|25080|31|NC_021810|PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774 

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ctcggcggacgaggagttgctcaaccgcgcc	Protospacer
*   *.************.*********  *

48. spacer 2.17|25080|31|NC_021810|PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.774 

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ctcggcggacgaggagttgctcaaccgcgcc	Protospacer
*   *.************.*********  *

49. spacer 2.17|25080|31|NC_021810|PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.774 

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ctcggcggacgaggagttgctcaaccgcgcc	Protospacer
*   *.************.*********  *

50. spacer 1.2|6364|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to MN855803 (Bacteriophage sp. isolate 108, partial genome) position: , mismatch: 8, identity: 0.75 

gcgaaatagtggggaaaaacccctggttaacc	CRISPR spacer
tttcaatattggggaaaaacccctcgttacct	Protospacer
 .  **** *************** **** *.

51. spacer 1.6|6608|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016489 (Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.75 

tatccacatatacccgcaatcatattcaagaa	CRISPR spacer
ggtaaatctaaacccgcaatcatattcaagag	Protospacer
 .*  *. ** ********************.

52. spacer 1.6|6608|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016476 (Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

tatccacatatacccgcaatcatattcaagaa	CRISPR spacer
ggtaaatctaaacccgcaatcatattcaagag	Protospacer
 .*  *. ** ********************.

53. spacer 1.15|7153|32|NC_021810|PILER-CR matches to NZ_CP016179 (Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ggtaatttctcatctaacagcct-----gtacgcctc	CRISPR spacer
ggtaatttcgcatcaaacagccttattagtat-----	Protospacer
********* **** ********     ***.

54. spacer 1.19|7397|32|NC_021810|PILER-CR matches to AP013976 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7-MedDCM-OCT-S26-C28, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75 

cgttgcgtcaggttgatccagtgcgtcagcgg	CRISPR spacer
agttgcgccagcttgatccagtgctgatgcgt	Protospacer
 ******.*** ************    ***

55. spacer 1.19|7397|32|NC_021810|PILER-CR matches to JX536274 (Uncultured Mediterranean phage MEDS5 group fosmid MedDCM-OCT-S15-C5, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttgcgtcaggttgatccagtgcgtcagcgg	CRISPR spacer
agttgcgccagcttgatccagtgctgatgcgt	Protospacer
 ******.*** ************    ***

56. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 8, identity: 0.789 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tctcggtctcggtctcggtctcggtctcgacgacgctt	Protospacer
*****************************.....* .

57. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.789 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
cctcggtctcggcctcggcctcggtctcggcctcggcg	Protospacer
.***********.*****.***********.  .*.**

58. spacer 1.25|7769|32|NC_021810|PILER-CR matches to NC_014754 (Sulfuricurvum kujiense DSM 16994 plasmid pSULKU01, complete sequence) position: , mismatch: 8, identity: 0.75 

attttatttgacaaattggcggcatctcactg	CRISPR spacer
cctttttttgtcaaattggcggcatacggctg	Protospacer
 .*** **** ************** . .***

59. spacer 1.34|7138|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP016179 (Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ggtaatttctcatctaacagcct-----gtacgcctc	CRISPR spacer
ggtaatttcgcatcaaacagccttattagtat-----	Protospacer
********* **** ********     ***.

60. spacer 1.38|7382|32|NC_021810|CRT,CRISPRCasFinder matches to AP013976 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7-MedDCM-OCT-S26-C28, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75 

cgttgcgtcaggttgatccagtgcgtcagcgg	CRISPR spacer
agttgcgccagcttgatccagtgctgatgcgt	Protospacer
 ******.*** ************    ***

61. spacer 1.38|7382|32|NC_021810|CRT,CRISPRCasFinder matches to JX536274 (Uncultured Mediterranean phage MEDS5 group fosmid MedDCM-OCT-S15-C5, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttgcgtcaggttgatccagtgcgtcagcgg	CRISPR spacer
agttgcgccagcttgatccagtgctgatgcgt	Protospacer
 ******.*** ************    ***

62. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 8, identity: 0.789 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tctcggtctcggtctcggtctcggtctcgacgacgctt	Protospacer
*****************************.....* .

63. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.789 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
cctcggtctcggcctcggcctcggtctcggcctcggcg	Protospacer
.***********.*****.***********.  .*.**

64. spacer 1.44|7754|32|NC_021810|CRT,CRISPRCasFinder matches to NC_014754 (Sulfuricurvum kujiense DSM 16994 plasmid pSULKU01, complete sequence) position: , mismatch: 8, identity: 0.75 

attttatttgacaaattggcggcatctcactg	CRISPR spacer
cctttttttgtcaaattggcggcatacggctg	Protospacer
 .*** **** ************** . .***

65. spacer 2.5|24466|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.75 

-gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
cagcggatcc-ttgccggtatagaccagcgtat	Protospacer
 . ** .*.* ********************

66. spacer 2.5|24466|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014128 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75 

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
gaattttacgttgccggtgtagaccagtgtca	Protospacer
*   . * **********.********.****

67. spacer 2.5|24466|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to NC_014561 (Pantoea vagans C9-1 plasmid pPag1, complete sequence) position: , mismatch: 8, identity: 0.75 

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
gaattttacgttgccggtgtagaccagtgtca	Protospacer
*   . * **********.********.****

68. spacer 2.5|24466|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 8, identity: 0.75 

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
gatccggacgttgccggtattgaacagcgtcc	Protospacer
* . **  ************ ** *******

69. spacer 2.7|24588|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to LQ277707 (Sequence 2 from Patent WO2016071503) position: , mismatch: 8, identity: 0.75 

----gctcatgtcaaacgccatcagcgttccggcat	CRISPR spacer
aaaggct----gcaaacgccaatagcgttccggcaa	Protospacer
    ***     ********* .************

70. spacer 2.7|24588|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to LZ998055 (JP 2017534684-A/2: Phage Therapy) position: , mismatch: 8, identity: 0.75 

----gctcatgtcaaacgccatcagcgttccggcat	CRISPR spacer
aaaggct----gcaaacgccaatagcgttccggcaa	Protospacer
    ***     ********* .************

71. spacer 2.8|24649|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to CP001770 (Spirosoma linguale DSM 74 plasmid pSLIN01, complete sequence) position: , mismatch: 8, identity: 0.75 

aatcgccagcctcggaaatattccatcctccg	CRISPR spacer
ggttgccagccccggaagtattccatctccca	Protospacer
..*.*******.*****.*********..**.

72. spacer 2.16|25137|32|NC_021810|CRISPRCasFinder,CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

taatggccacagtaagtcaaacggttctggaa	CRISPR spacer
cggtggccacagtaaggcacacggttcggcag	Protospacer
...************* ** ******* * *.

73. spacer 2.17|25080|31|NC_021810|PILER-CR matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 8, identity: 0.742 

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ttcagtggacgaggagttcctcacccgcacc	Protospacer
.   ************** **** ****  *

74. spacer 1.11|6909|32|NC_021810|PILER-CR matches to MK448228 (Klebsiella phage ST15-VIM1phi2.1, complete genome) position: , mismatch: 9, identity: 0.719 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcatccagcgccggtagtgccggatgaactca	Protospacer
 **   **.************ *******

75. spacer 1.18|7336|32|NC_021810|PILER-CR matches to MT162468 (Synechococcus phage S-H25, complete genome) position: , mismatch: 9, identity: 0.719 

tcccattcaccaacaacaatatcgccctgcaa----	CRISPR spacer
ccccaatcaccaacaataatatcgt----cagtgtt	Protospacer
.**** **********.*******.    **.

76. spacer 1.20|7458|32|NC_021810|PILER-CR matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.719 

tgatgaaatcgtcaataaaattattggcgcgc	CRISPR spacer
aaattggatcgtcaatgaatttattggcgctg	Protospacer
 .** ..*********.** **********

77. spacer 1.25|7769|32|NC_021810|PILER-CR matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.719 

attttatttgacaaattggcggcatctcactg	CRISPR spacer
attctatttgacacattggcggcgccgagcca	Protospacer
***.********* *********..*  .*..

78. spacer 1.27|7891|32|NC_021810|PILER-CR matches to NZ_CP043846 (Staphylococcus epidermidis strain ATCC 12228 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

actgcttatcattgattttattgatttttccc	CRISPR spacer
cttttttagctttgattttattgatttttaga	Protospacer
 .* .*** * ******************

79. spacer 1.27|7891|32|NC_021810|PILER-CR matches to NZ_CP034117 (Staphylococcus epidermidis strain CDC121 plasmid pSTA482, complete sequence) position: , mismatch: 9, identity: 0.719 

actgcttatcattgattttattgatttttccc	CRISPR spacer
cttttttagctttgattttattgatttttaga	Protospacer
 .* .*** * ******************

80. spacer 1.27|7891|32|NC_021810|PILER-CR matches to NZ_CP034114 (Staphylococcus epidermidis strain CDC120 plasmid pSTA493, complete sequence) position: , mismatch: 9, identity: 0.719 

actgcttatcattgattttattgatttttccc	CRISPR spacer
cttttttagctttgattttattgatttttaga	Protospacer
 .* .*** * ******************

81. spacer 1.27|7891|32|NC_021810|PILER-CR matches to NZ_CP017904 (Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence) position: , mismatch: 9, identity: 0.719 

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

82. spacer 1.27|7891|32|NC_021810|PILER-CR matches to NZ_CP017901 (Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence) position: , mismatch: 9, identity: 0.719 

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

83. spacer 1.27|7891|32|NC_021810|PILER-CR matches to NZ_CP026804 (Shigella flexneri strain 89-141 plasmid unnamed1) position: , mismatch: 9, identity: 0.719 

actgcttatcattgattttattgatttttccc	CRISPR spacer
tgtaataatcaataattttattgatttttcga	Protospacer
  *. * **** *.****************

84. spacer 1.27|7891|32|NC_021810|PILER-CR matches to NZ_CP017909 (Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence) position: , mismatch: 9, identity: 0.719 

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

85. spacer 1.27|7891|32|NC_021810|PILER-CR matches to NZ_CP017893 (Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence) position: , mismatch: 9, identity: 0.719 

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

86. spacer 1.27|7891|32|NC_021810|PILER-CR matches to NZ_CP017898 (Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence) position: , mismatch: 9, identity: 0.719 

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

87. spacer 1.30|6894|32|NC_021810|CRT,CRISPRCasFinder matches to MK448228 (Klebsiella phage ST15-VIM1phi2.1, complete genome) position: , mismatch: 9, identity: 0.719 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcatccagcgccggtagtgccggatgaactca	Protospacer
 **   **.************ *******

88. spacer 1.37|7321|32|NC_021810|CRT,CRISPRCasFinder matches to MT162468 (Synechococcus phage S-H25, complete genome) position: , mismatch: 9, identity: 0.719 

tcccattcaccaacaacaatatcgccctgcaa----	CRISPR spacer
ccccaatcaccaacaataatatcgt----cagtgtt	Protospacer
.**** **********.*******.    **.

89. spacer 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.719 

tgatgaaatcgtcaataaaattattggcgcgc	CRISPR spacer
aaattggatcgtcaatgaatttattggcgctg	Protospacer
 .** ..*********.** **********

90. spacer 1.44|7754|32|NC_021810|CRT,CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.719 

attttatttgacaaattggcggcatctcactg	CRISPR spacer
attctatttgacacattggcggcgccgagcca	Protospacer
***.********* *********..*  .*..

91. spacer 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP043846 (Staphylococcus epidermidis strain ATCC 12228 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

actgcttatcattgattttattgatttttccc	CRISPR spacer
cttttttagctttgattttattgatttttaga	Protospacer
 .* .*** * ******************

92. spacer 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP034117 (Staphylococcus epidermidis strain CDC121 plasmid pSTA482, complete sequence) position: , mismatch: 9, identity: 0.719 

actgcttatcattgattttattgatttttccc	CRISPR spacer
cttttttagctttgattttattgatttttaga	Protospacer
 .* .*** * ******************

93. spacer 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP034114 (Staphylococcus epidermidis strain CDC120 plasmid pSTA493, complete sequence) position: , mismatch: 9, identity: 0.719 

actgcttatcattgattttattgatttttccc	CRISPR spacer
cttttttagctttgattttattgatttttaga	Protospacer
 .* .*** * ******************

94. spacer 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP017904 (Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence) position: , mismatch: 9, identity: 0.719 

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

95. spacer 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP017901 (Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence) position: , mismatch: 9, identity: 0.719 

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

96. spacer 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP026804 (Shigella flexneri strain 89-141 plasmid unnamed1) position: , mismatch: 9, identity: 0.719 

actgcttatcattgattttattgatttttccc	CRISPR spacer
tgtaataatcaataattttattgatttttcga	Protospacer
  *. * **** *.****************

97. spacer 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP017909 (Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence) position: , mismatch: 9, identity: 0.719 

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

98. spacer 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP017893 (Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence) position: , mismatch: 9, identity: 0.719 

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

99. spacer 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP017898 (Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence) position: , mismatch: 9, identity: 0.719 

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

100. spacer 2.5|24466|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045722 (Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
aaacttgacgttgccggtatagatcagcgtca	Protospacer
.   .   ***************.********

101. spacer 2.5|24466|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022519 (Pantoea vagans strain FBS135 plasmid pPant3, complete sequence) position: , mismatch: 9, identity: 0.719 

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
aaacttgacgttgccggtatagatcagcgtca	Protospacer
.   .   ***************.********

102. spacer 2.5|24466|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028351 (Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence) position: , mismatch: 9, identity: 0.719 

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
aaattttacgttgccggtgtagaccagtgtca	Protospacer
.   . * **********.********.****

103. spacer 2.9|24710|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to MN062720 (Microbacterium phage FuzzBuster, complete genome) position: , mismatch: 9, identity: 0.719 

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
tcctcctggacaggctgaccgttgacgatctg	Protospacer
     **..**** *********** ******

104. spacer 2.10|24771|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to MN694645 (Marine virus AFVG_250M761, complete genome) position: , mismatch: 9, identity: 0.719 

accggacaaatcttttttttcctgttcctgtt	CRISPR spacer
gcatcattaatcctttttttcctgttactgta	Protospacer
.*   *. ****.************* ****

105. spacer 2.12|24893|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to MN693046 (Marine virus AFVG_25M413, complete genome) position: , mismatch: 9, identity: 0.719 

ggtaaagccacaccattttttattgacctcgc	CRISPR spacer
tctgaaaccacaccattttttgttgaccctaa	Protospacer
  *.**.**************.******...

106. spacer 2.12|24893|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to MN693008 (Marine virus AFVG_117M9, complete genome) position: , mismatch: 9, identity: 0.719 

ggtaaagccacaccattttttattgacctcgc	CRISPR spacer
tctgaaaccacaccattttttgttgaccctaa	Protospacer
  *.**.**************.******...

107. spacer 2.15|25076|32|NC_021810|CRISPRCasFinder,CRT matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
gttcagtggacgaggagttcctcacccgcacc	Protospacer
 .   ************** **** ****  *

108. spacer 2.15|25076|32|NC_021810|CRISPRCasFinder,CRT matches to AM749121 (Streptococcus phage M102 complete genome) position: , mismatch: 9, identity: 0.719 

tcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ttgggctggaccaggagttactccaccgcctt	Protospacer
*.*.  ***** *********** *****. .

109. spacer 2.15|25076|32|NC_021810|CRISPRCasFinder,CRT matches to NC_012884 (Streptococcus phage M102, complete genome) position: , mismatch: 9, identity: 0.719 

tcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ttgggctggaccaggagttactccaccgcctt	Protospacer
*.*.  ***** *********** *****. .

110. spacer 2.17|25080|31|NC_021810|PILER-CR matches to AM749121 (Streptococcus phage M102 complete genome) position: , mismatch: 9, identity: 0.71 

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
tgggctggaccaggagttactccaccgcctt	Protospacer
.*.  ***** *********** *****. .

111. spacer 2.17|25080|31|NC_021810|PILER-CR matches to NC_012884 (Streptococcus phage M102, complete genome) position: , mismatch: 9, identity: 0.71 

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
tgggctggaccaggagttactccaccgcctt	Protospacer
.*.  ***** *********** *****. .

112. spacer 1.1|6303|32|NC_021810|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688 

ttttcagcccttgtcgactgcggaacgcccct	CRISPR spacer
tccctcaccctcgtcgactgcggaccgcccgg	Protospacer
*.... .****.************ *****

113. spacer 1.1|6303|32|NC_021810|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688 

ttttcagcccttgtcgactgcggaacgcccct	CRISPR spacer
tccctcaccctcgtcgactgcggaccgcccgg	Protospacer
*.... .****.************ *****

114. spacer 1.13|7031|32|NC_021810|PILER-CR matches to NC_024995 (Gluconacetobacter europaeus plasmid pGE3 genomic DNA, complete sequence, strain: KGMA0119) position: , mismatch: 10, identity: 0.688 

accgttccggtatgatcgaagatacggcaaac	CRISPR spacer
tcccttccgatatgatcgaagatagtcctgtt	Protospacer
 ** *****.**************   * . .

115. spacer 1.18|7336|32|NC_021810|PILER-CR matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

116. spacer 1.18|7336|32|NC_021810|PILER-CR matches to JX145341 (Clostridium phage phiMMP02, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

117. spacer 1.18|7336|32|NC_021810|PILER-CR matches to NC_011398 (Clostridium phage phiCD27, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

118. spacer 1.18|7336|32|NC_021810|PILER-CR matches to NC_048642 (Clostridium phage CDKM9, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

119. spacer 1.18|7336|32|NC_021810|PILER-CR matches to KX228400 (Clostridium phage CDKM15, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

120. spacer 1.19|7397|32|NC_021810|PILER-CR matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 10, identity: 0.688 

cgttgcgtcaggttgatccagtgcgtcagcgg	CRISPR spacer
tcaaacgccaggttgatcaagtgcgtcagatt	Protospacer
.   .**.********** **********

121. spacer 1.20|7458|32|NC_021810|PILER-CR matches to NZ_CP012188 (Lactobacillus paracasei strain CAUH35 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

tgatgaaatcgtcaataaaattattggcgcgc	CRISPR spacer
tgatgaaattgtcaaaaaaattaagcagcttc	Protospacer
*********.***** *******   .  . *

122. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

123. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_AP023191 (Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

124. spacer 1.24|7702|38|NC_021810|PILER-CR matches to MN539017 (Salmonella sp. strain PJM1 plasmid pPJM1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

125. spacer 1.24|7702|38|NC_021810|PILER-CR matches to MN539018 (Salmonella sp. strain OYZ4 plasmid pOYZ4, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

126. spacer 1.24|7702|38|NC_021810|PILER-CR matches to MT077888 (Escherichia coli plasmid p65, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

127. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

128. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP044306 (Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

129. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP039170 (Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

130. spacer 1.24|7702|38|NC_021810|PILER-CR matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

131. spacer 1.24|7702|38|NC_021810|PILER-CR matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

132. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP037959 (Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

133. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP039861 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

134. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

135. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

136. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_AP023198 (Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

137. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP043223 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

138. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP043223 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

139. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

140. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_KY689633 (Escherichia coli strain 100R plasmid p100R, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

141. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_KY689632 (Escherichia coli strain 19-M12 plasmid p19M12, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

142. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

143. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_KU743384 (Escherichia coli strain SA26 plasmid pSA26-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

144. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_KU254578 (Escherichia coli strain YD786 plasmid pYD786-1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

145. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_KX129782 (Escherichia coli strain S38 plasmid pS38, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

146. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP015833 (Escherichia coli O157 strain 180-PT54 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

147. spacer 1.24|7702|38|NC_021810|PILER-CR matches to LT221036 (Yersinia pseudotuberculosis strain Yps.F1, plasmid pYps.F1 complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

148. spacer 1.24|7702|38|NC_021810|PILER-CR matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

149. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

150. spacer 1.24|7702|38|NC_021810|PILER-CR matches to MN732922 (Escherichia coli strain 49K plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

151. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP020493 (Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

152. spacer 1.24|7702|38|NC_021810|PILER-CR matches to CP031284 (Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

153. spacer 1.24|7702|38|NC_021810|PILER-CR matches to CP042895 (Escherichia coli strain CFSAN061772 plasmid pCFSAN061772_02, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

154. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP022735 (Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

155. spacer 1.24|7702|38|NC_021810|PILER-CR matches to CP042898 (Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_02, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

156. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP022165 (Escherichia coli strain M160133 plasmid pM160133_p1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

157. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP012931 (Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

158. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP023143 (Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

159. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP026936 (Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

160. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP025402 (Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

161. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP026933 (Escherichia coli strain CFS3273 plasmid pCFS3273-1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

162. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_MH924589 (Escherichia coli strain RDB9 plasmid pRDB9, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

163. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_MH208235 (Escherichia coli strain APECA2 plasmid pJMA2, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

164. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_MK169211 (Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

165. spacer 1.24|7702|38|NC_021810|PILER-CR matches to NZ_CP016838 (Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

166. spacer 1.27|7891|32|NC_021810|PILER-CR matches to NZ_CP044540 (Borrelia sp. CA690 plasmid lp17, complete sequence) position: , mismatch: 10, identity: 0.688 

actgcttatcattgattttattgatttttccc	CRISPR spacer
cattaaagtcatttattttattggtttttccg	Protospacer
  *    .***** *********.*******

167. spacer 1.27|7891|32|NC_021810|PILER-CR matches to NZ_LR215005 (Mycoplasma conjunctivae strain NCTC10147 plasmid 9) position: , mismatch: 10, identity: 0.688 

actgcttatcattgattttattgatttttccc	CRISPR spacer
ttctttcatcattgattttcttgatttctcaa	Protospacer
 .. .*.************ *******.**

168. spacer 1.32|7016|32|NC_021810|CRT,CRISPRCasFinder matches to NC_024995 (Gluconacetobacter europaeus plasmid pGE3 genomic DNA, complete sequence, strain: KGMA0119) position: , mismatch: 10, identity: 0.688 

accgttccggtatgatcgaagatacggcaaac	CRISPR spacer
tcccttccgatatgatcgaagatagtcctgtt	Protospacer
 ** *****.**************   * . .

169. spacer 1.37|7321|32|NC_021810|CRT,CRISPRCasFinder matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

170. spacer 1.37|7321|32|NC_021810|CRT,CRISPRCasFinder matches to JX145341 (Clostridium phage phiMMP02, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

171. spacer 1.37|7321|32|NC_021810|CRT,CRISPRCasFinder matches to NC_011398 (Clostridium phage phiCD27, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

172. spacer 1.37|7321|32|NC_021810|CRT,CRISPRCasFinder matches to NC_048642 (Clostridium phage CDKM9, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

173. spacer 1.37|7321|32|NC_021810|CRT,CRISPRCasFinder matches to KX228400 (Clostridium phage CDKM15, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

174. spacer 1.38|7382|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 10, identity: 0.688 

cgttgcgtcaggttgatccagtgcgtcagcgg	CRISPR spacer
tcaaacgccaggttgatcaagtgcgtcagatt	Protospacer
.   .**.********** **********

175. spacer 1.39|7443|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP012188 (Lactobacillus paracasei strain CAUH35 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

tgatgaaatcgtcaataaaattattggcgcgc	CRISPR spacer
tgatgaaattgtcaaaaaaattaagcagcttc	Protospacer
*********.***** *******   .  . *

176. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

177. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_AP023191 (Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

178. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to MN539017 (Salmonella sp. strain PJM1 plasmid pPJM1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

179. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to MN539018 (Salmonella sp. strain OYZ4 plasmid pOYZ4, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

180. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to MT077888 (Escherichia coli plasmid p65, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

181. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

182. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP044306 (Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

183. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP039170 (Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

184. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

185. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

186. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP037959 (Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

187. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP039861 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

188. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

189. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

190. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_AP023198 (Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

191. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP043223 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

192. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP043223 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

193. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

194. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_KY689633 (Escherichia coli strain 100R plasmid p100R, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

195. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_KY689632 (Escherichia coli strain 19-M12 plasmid p19M12, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

196. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

197. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_KU743384 (Escherichia coli strain SA26 plasmid pSA26-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

198. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_KU254578 (Escherichia coli strain YD786 plasmid pYD786-1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

199. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_KX129782 (Escherichia coli strain S38 plasmid pS38, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

200. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP015833 (Escherichia coli O157 strain 180-PT54 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

201. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to LT221036 (Yersinia pseudotuberculosis strain Yps.F1, plasmid pYps.F1 complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

202. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

203. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

204. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to MN732922 (Escherichia coli strain 49K plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

205. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP020493 (Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

206. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to CP031284 (Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

207. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to CP042895 (Escherichia coli strain CFSAN061772 plasmid pCFSAN061772_02, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

208. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP022735 (Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

209. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to CP042898 (Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_02, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

210. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP022165 (Escherichia coli strain M160133 plasmid pM160133_p1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

211. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP012931 (Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

212. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP023143 (Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

213. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP026936 (Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

214. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP025402 (Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

215. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP026933 (Escherichia coli strain CFS3273 plasmid pCFS3273-1, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

216. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_MH924589 (Escherichia coli strain RDB9 plasmid pRDB9, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

217. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_MH208235 (Escherichia coli strain APECA2 plasmid pJMA2, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

218. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_MK169211 (Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

219. spacer 1.43|7687|38|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP016838 (Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence) position: , mismatch: 10, identity: 0.737 

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

220. spacer 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP044540 (Borrelia sp. CA690 plasmid lp17, complete sequence) position: , mismatch: 10, identity: 0.688 

actgcttatcattgattttattgatttttccc	CRISPR spacer
cattaaagtcatttattttattggtttttccg	Protospacer
  *    .***** *********.*******

221. spacer 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_LR215005 (Mycoplasma conjunctivae strain NCTC10147 plasmid 9) position: , mismatch: 10, identity: 0.688 

actgcttatcattgattttattgatttttccc	CRISPR spacer
ttctttcatcattgattttcttgatttctcaa	Protospacer
 .. .*.************ *******.**

222. spacer 2.1|24222|32|NC_021810|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

atcttcatattgcgtgacgctgccgatgaacg	CRISPR spacer
tgccggatatggcgtgacgatgccgatgatgt	Protospacer
  *.  **** ******** *********

223. spacer 2.4|24405|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044072 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

tgcccgttctgcctcttcgcactctcgatcaa	CRISPR spacer
tgcccgttctgtctcttggcactgccaccttc	Protospacer
***********.***** ***** .*. ..

224. spacer 2.9|24710|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019257 (Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence) position: , mismatch: 10, identity: 0.688 

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

225. spacer 2.9|24710|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019274 (Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence) position: , mismatch: 10, identity: 0.688 

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

226. spacer 2.9|24710|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019275 (Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence) position: , mismatch: 10, identity: 0.688 

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

227. spacer 2.9|24710|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019279 (Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence) position: , mismatch: 10, identity: 0.688 

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

228. spacer 2.9|24710|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 10, identity: 0.688 

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

229. spacer 2.9|24710|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to NC_049342 (Escherichia phage 500465-1, complete genome) position: , mismatch: 10, identity: 0.688 

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

230. spacer 2.9|24710|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to KY271398 (Klebsiella phage 4 LV-2017, complete genome) position: , mismatch: 10, identity: 0.688 

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

231. spacer 2.9|24710|32|NC_021810|CRISPRCasFinder,CRT,PILER-CR matches to CP025900 (Escherichia phage sp., complete genome) position: , mismatch: 10, identity: 0.688 

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

232. spacer 2.14|25015|32|NC_021810|CRISPRCasFinder,CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 10, identity: 0.688 

gtggtggcctcaaataaattcgagcgctggag	CRISPR spacer
aaacttgcctcaaataaattcgcgcggtgttc	Protospacer
. . * **************** *** **

233. spacer 1.27|7891|32|NC_021810|PILER-CR matches to NZ_CP041669 (Legionella israelensis strain L18-01051 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656 

actgcttatcattgattttattgatttttccc	CRISPR spacer
ttgatttattattgattttattcattttatta	Protospacer
 . ..****.************ ***** ..

234. spacer 1.46|7876|32|NC_021810|CRT,CRISPRCasFinder matches to NZ_CP041669 (Legionella israelensis strain L18-01051 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656 

actgcttatcattgattttattgatttttccc	CRISPR spacer
ttgatttattattgattttattcattttatta	Protospacer
 . ..****.************ ***** ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 885443 : 899082 14 Enterobacteria_phage(80.0%) integrase attL 885261:885282|attR 896533:896554
DBSCAN-SWA_2 1175953 : 1270474 107 Escherichia_phage(43.48%) terminase,head,portal,tail,lysis,tRNA,integrase,holin,capsid,plate,protease attL 1209172:1209218|attR 1240571:1240617
DBSCAN-SWA_3 1378460 : 1399357 26 Burkholderia_phage(45.0%) tail,plate NA
DBSCAN-SWA_4 2165856 : 2209451 64 Enterobacteria_phage(44.44%) terminase,portal,lysis,coat,integrase,protease attL 2169702:2169747|attR 2208967:2209012
DBSCAN-SWA_5 2813676 : 2821699 8 Dickeya_phage(14.29%) protease,transposase NA
DBSCAN-SWA_6 2872307 : 2970266 104 Salmonella_phage(44.83%) terminase,portal,tail,transposase,lysis,tRNA,protease NA
DBSCAN-SWA_7 3869396 : 3876648 8 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_8 3965992 : 3976498 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_9 4044774 : 4053945 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_10 4073352 : 4141872 63 Salmonella_phage(31.82%) lysis,tail,transposase,holin NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_021811
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 33717 : 68596 40 Stx2-converting_phage(21.43%) integrase,transposase attL 27692:27708|attR 73403:73419

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage