Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_021834 Campylobacter jejuni 32488, complete sequence 1 crisprs cas1,cas9,csa3,DEDDh,WYL 0 1 2 0

Results visualization

1. NC_021834
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021834_1 652140-652240 TypeII NA
1 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_021834_1 1.1|652175|31|NC_021834|CRISPRCasFinder 652175-652205 31 MN530981 Campylobacter phage DA10, complete genome 1112-1142 3 0.903
NC_021834_1 1.1|652175|31|NC_021834|CRISPRCasFinder 652175-652205 31 MF417908 Uncultured Caudovirales phage clone 10S_1, partial genome 6848-6878 8 0.742
NC_021834_1 1.1|652175|31|NC_021834|CRISPRCasFinder 652175-652205 31 AP014375 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S42-C56, *** SEQUENCING IN PROGRESS *** 28285-28315 8 0.742
NC_021834_1 1.1|652175|31|NC_021834|CRISPRCasFinder 652175-652205 31 MN044033 Klebsiella phage Marfa, complete genome 55493-55523 8 0.742
NC_021834_1 1.1|652175|31|NC_021834|CRISPRCasFinder 652175-652205 31 MN395284 Klebsiella phage PhiKpNIH-6, complete genome 87237-87267 8 0.742
NC_021834_1 1.1|652175|31|NC_021834|CRISPRCasFinder 652175-652205 31 MN106245 Klebsiella phage EI, complete genome 57282-57312 8 0.742
NC_021834_1 1.1|652175|31|NC_021834|CRISPRCasFinder 652175-652205 31 NC_048694 Klebsiella phage vB_Kpn_F48, complete genome 8957-8987 8 0.742
NC_021834_1 1.1|652175|31|NC_021834|CRISPRCasFinder 652175-652205 31 MN434092 Klebsiella phage AmPh_EK29, complete genome 8961-8991 8 0.742
NC_021834_1 1.1|652175|31|NC_021834|CRISPRCasFinder 652175-652205 31 MN781108 Klebsiella phage vB_Kpn_P545, complete genome 8729-8759 8 0.742
NC_021834_1 1.1|652175|31|NC_021834|CRISPRCasFinder 652175-652205 31 MN013081 Klebsiella phage vB_KpnM_Potts1, complete genome 8540-8570 8 0.742
NC_021834_1 1.1|652175|31|NC_021834|CRISPRCasFinder 652175-652205 31 NC_019909 Yersinia phage phiR1-RT complete genome 65680-65710 9 0.71
NC_021834_1 1.1|652175|31|NC_021834|CRISPRCasFinder 652175-652205 31 NC_028820 Yersinia phage vB_YenM_TG1, complete genome 60594-60624 9 0.71

1. spacer 1.1|652175|31|NC_021834|CRISPRCasFinder matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 3, identity: 0.903

ctgttttattgtcaataacgcctttactaag	CRISPR spacer
ttgttttattgtcaataacacctttactaac	Protospacer
.******************.********** 

2. spacer 1.1|652175|31|NC_021834|CRISPRCasFinder matches to MF417908 (Uncultured Caudovirales phage clone 10S_1, partial genome) position: , mismatch: 8, identity: 0.742

ctgttttattgtcaataacgcctttactaag	CRISPR spacer
taattgtattttcaataacgcctttacctcg	Protospacer
. .** **** ****************.  *

3. spacer 1.1|652175|31|NC_021834|CRISPRCasFinder matches to AP014375 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S42-C56, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.742

ctgttttattgtcaataacgcctttactaag	CRISPR spacer
gtgttttatggtcaataaagccttgttttac	Protospacer
 ******** ******** *****  .* * 

4. spacer 1.1|652175|31|NC_021834|CRISPRCasFinder matches to MN044033 (Klebsiella phage Marfa, complete genome) position: , mismatch: 8, identity: 0.742

ctgttttattgtcaataacgcctttactaag	CRISPR spacer
ccaatttattgtcaataacccatttaccagc	Protospacer
*.. *************** * *****.*. 

5. spacer 1.1|652175|31|NC_021834|CRISPRCasFinder matches to MN395284 (Klebsiella phage PhiKpNIH-6, complete genome) position: , mismatch: 8, identity: 0.742

ctgttttattgtcaataacgcctttactaag	CRISPR spacer
ccaatttattgtcaataacccatttaccagc	Protospacer
*.. *************** * *****.*. 

6. spacer 1.1|652175|31|NC_021834|CRISPRCasFinder matches to MN106245 (Klebsiella phage EI, complete genome) position: , mismatch: 8, identity: 0.742

ctgttttattgtcaataacgcctttactaag	CRISPR spacer
ccaatttattgtcaataacccatttaccagc	Protospacer
*.. *************** * *****.*. 

7. spacer 1.1|652175|31|NC_021834|CRISPRCasFinder matches to NC_048694 (Klebsiella phage vB_Kpn_F48, complete genome) position: , mismatch: 8, identity: 0.742

ctgttttattgtcaataacgcctttactaag	CRISPR spacer
ccaatttattgtcaataacccatttaccagc	Protospacer
*.. *************** * *****.*. 

8. spacer 1.1|652175|31|NC_021834|CRISPRCasFinder matches to MN434092 (Klebsiella phage AmPh_EK29, complete genome) position: , mismatch: 8, identity: 0.742

ctgttttattgtcaataacgcctttactaag	CRISPR spacer
ccaatttattgtcaataacccatttaccagc	Protospacer
*.. *************** * *****.*. 

9. spacer 1.1|652175|31|NC_021834|CRISPRCasFinder matches to MN781108 (Klebsiella phage vB_Kpn_P545, complete genome) position: , mismatch: 8, identity: 0.742

ctgttttattgtcaataacgcctttactaag	CRISPR spacer
ccaatttattgtcaataacccatttaccagc	Protospacer
*.. *************** * *****.*. 

10. spacer 1.1|652175|31|NC_021834|CRISPRCasFinder matches to MN013081 (Klebsiella phage vB_KpnM_Potts1, complete genome) position: , mismatch: 8, identity: 0.742

ctgttttattgtcaataacgcctttactaag	CRISPR spacer
ccaatttattgtcaataacccatttaccagc	Protospacer
*.. *************** * *****.*. 

11. spacer 1.1|652175|31|NC_021834|CRISPRCasFinder matches to NC_019909 (Yersinia phage phiR1-RT complete genome) position: , mismatch: 9, identity: 0.71

ctgttttattgtcaataacgcctttactaag	CRISPR spacer
ataatttattgtcaataacccatttaccttt	Protospacer
 *. *************** * *****.   

12. spacer 1.1|652175|31|NC_021834|CRISPRCasFinder matches to NC_028820 (Yersinia phage vB_YenM_TG1, complete genome) position: , mismatch: 9, identity: 0.71

ctgttttattgtcaataacgcctttactaag	CRISPR spacer
ataatttattgtcaataacccatttaccttt	Protospacer
 *. *************** * *****.   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 87688 : 191413 105 Campylobacter_phage(19.44%) plate,head,terminase,tRNA,tail,protease NA
DBSCAN-SWA_2 546456 : 560889 17 Synechococcus_phage(35.71%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage