Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_021717 Alteromonas mediterranea U7, complete sequence 1 crisprs DinG,DEDDh,WYL,cas3,Cas9_archaeal,RT,csa3,PrimPol 1 1 1 0

Results visualization

1. NC_021717
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021717_1 512167-512246 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_021717_1 1.1|512190|34|NC_021717|CRISPRCasFinder 512190-512223 34 NC_021717.1 34087-34120 0 1.0

1. spacer 1.1|512190|34|NC_021717|CRISPRCasFinder matches to position: 34087-34120, mismatch: 0, identity: 1.0

ttgagcgttcggaaagaatgtgacacttttttta	CRISPR spacer
ttgagcgttcggaaagaatgtgacacttttttta	Protospacer
**********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_021717_1 1.1|512190|34|NC_021717|CRISPRCasFinder 512190-512223 34 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 65890-65923 10 0.706
NC_021717_1 1.1|512190|34|NC_021717|CRISPRCasFinder 512190-512223 34 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 48906-48939 10 0.706

1. spacer 1.1|512190|34|NC_021717|CRISPRCasFinder matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ttgagcgttcggaaagaatgtgacacttttttta	CRISPR spacer
tctgaagttcggaaagtatctgacacttttctcg	Protospacer
*. .. ********** ** **********.*..

2. spacer 1.1|512190|34|NC_021717|CRISPRCasFinder matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.706

ttgagcgttcggaaagaatgtgacacttttttta	CRISPR spacer
tctgaagttcggaaagtatctgacacttttctcg	Protospacer
*. .. ********** ** **********.*..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1062426 : 1071131 6 Streptococcus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage