Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_021714 Alteromonas mediterranea UM4b, complete sequence 3 crisprs PD-DExK,cas3,DEDDh,WYL,csa3,Cas9_archaeal,DinG,PrimPol,RT 2 1 4 0

Results visualization

1. NC_021714
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021714_1 625794-625945 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021714_2 1851833-1851928 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021714_3 2991190-2991321 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_021714_2 2.1|1851867|28|NC_021714|CRISPRCasFinder 1851867-1851894 28 NC_021714.1 1852122-1852149 0 1.0
NC_021714_1 1.1|625844|52|NC_021714|CRISPRCasFinder 625844-625895 52 NC_021714.1 966247-966298 1 0.981

1. spacer 2.1|1851867|28|NC_021714|CRISPRCasFinder matches to position: 1852122-1852149, mismatch: 0, identity: 1.0

ggtcaataagcttattttcaagactcta	CRISPR spacer
ggtcaataagcttattttcaagactcta	Protospacer
****************************

2. spacer 1.1|625844|52|NC_021714|CRISPRCasFinder matches to position: 966247-966298, mismatch: 1, identity: 0.981

caaggagtttcacgaggttgcctrttgtgaagagcagcgtggagcgacacca	CRISPR spacer
caaggagtttcacgaggttgcctgttgtgaagagcagcgtggagcgacacca	Protospacer
*********************** ****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_021714_2 2.1|1851867|28|NC_021714|CRISPRCasFinder 1851867-1851894 28 KJ000058 Salmonella phage STP4-a, complete genome 104880-104907 6 0.786
NC_021714_2 2.1|1851867|28|NC_021714|CRISPRCasFinder 1851867-1851894 28 CP002962 Emticicia oligotrophica DSM 17448 plasmid pEMTOL01, complete sequence 46931-46958 7 0.75

1. spacer 2.1|1851867|28|NC_021714|CRISPRCasFinder matches to KJ000058 (Salmonella phage STP4-a, complete genome) position: , mismatch: 6, identity: 0.786

ggtcaataagcttattttcaagactcta	CRISPR spacer
ggtcaataagcatattttcaaatgactt	Protospacer
*********** *********.   ** 

2. spacer 2.1|1851867|28|NC_021714|CRISPRCasFinder matches to CP002962 (Emticicia oligotrophica DSM 17448 plasmid pEMTOL01, complete sequence) position: , mismatch: 7, identity: 0.75

ggtcaataagcttattttcaagactcta	CRISPR spacer
tgtcaataagtttattttcaagcgattt	Protospacer
 *********.***********   .* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 963665 : 983092 15 Escherichia_phage(40.0%) integrase,transposase attL 974859:974907|attR 987907:987955
DBSCAN-SWA_2 1012531 : 1021236 6 Streptococcus_phage(16.67%) NA NA
DBSCAN-SWA_3 2096338 : 2161441 59 Streptococcus_phage(13.33%) transposase,tRNA,protease NA
DBSCAN-SWA_4 4366372 : 4377394 7 Organic_Lake_phycodnavirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage