Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_021879 Anaplasma phagocytophilum str. HZ2, complete genome 1 crisprs NA 1 0 0 0

Results visualization

1. NC_021879
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021879_1 1456703-1456831 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_021879_1 1.1|1456742|51|NC_021879|CRISPRCasFinder 1456742-1456792 51 NC_021879.1 1456370-1456420 1 0.98

1. spacer 1.1|1456742|51|NC_021879|CRISPRCasFinder matches to position: 1456370-1456420, mismatch: 1, identity: 0.98

agcaggaatctctgatcaagagacacaagcaactgaagaagttgagaaggt	CRISPR spacer
agcaggaatctctgatcaagagacacaagcaactgaagaagttgaaaaggt	Protospacer
*********************************************.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage