Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_021902 Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1, complete genome 2 crisprs RT,WYL,DEDDh,c2c9_V-U4,DinG,cas3,csa3,cas14j,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e 0 41 10 0

Results visualization

1. NC_021902
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021902_1 4080470-4082084 TypeI-E I-E
26 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021902_2 4098753-4099939 TypeI-E I-E
19 spacers
cas8e,cse2gr11,cas7,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_021902_1 1.1|4080499|32|NC_021902|CRISPRCasFinder,CRT 4080499-4080530 32 NC_004313 Salmonella phage ST64B, complete genome 31961-31992 1 0.969
NC_021902_1 1.1|4080499|32|NC_021902|CRISPRCasFinder,CRT 4080499-4080530 32 KU927493 Salmonella phage 118970_sal3, complete genome 69573-69604 1 0.969
NC_021902_1 1.1|4080499|32|NC_021902|CRISPRCasFinder,CRT 4080499-4080530 32 AY055382 Salmonella typhimurium phage ST64B complete sequence 31961-31992 1 0.969
NC_021902_1 1.27|4080501|32|NC_021902|PILER-CR 4080501-4080532 32 NC_004313 Salmonella phage ST64B, complete genome 31961-31992 1 0.969
NC_021902_1 1.27|4080501|32|NC_021902|PILER-CR 4080501-4080532 32 KU927493 Salmonella phage 118970_sal3, complete genome 69573-69604 1 0.969
NC_021902_1 1.27|4080501|32|NC_021902|PILER-CR 4080501-4080532 32 AY055382 Salmonella typhimurium phage ST64B complete sequence 31961-31992 1 0.969
NC_021902_1 1.17|4081475|32|NC_021902|CRISPRCasFinder,CRT 4081475-4081506 32 MK448237 Klebsiella phage ST974-OXA48phi18.2, complete genome 10331-10362 5 0.844
NC_021902_1 1.43|4081477|32|NC_021902|PILER-CR 4081477-4081508 32 MK448237 Klebsiella phage ST974-OXA48phi18.2, complete genome 10331-10362 5 0.844
NC_021902_2 2.1|4098782|31|NC_021902|CRISPRCasFinder,CRT 4098782-4098812 31 NZ_CP044082 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence 90792-90822 5 0.839
NC_021902_2 2.1|4098782|31|NC_021902|CRISPRCasFinder,CRT 4098782-4098812 31 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 271400-271430 5 0.839
NC_021902_2 2.1|4098782|31|NC_021902|CRISPRCasFinder,CRT 4098782-4098812 31 NZ_CP024424 Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence 112053-112083 5 0.839
NC_021902_2 2.1|4098782|31|NC_021902|CRISPRCasFinder,CRT 4098782-4098812 31 NZ_CP020440 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence 224972-225002 5 0.839
NC_021902_1 1.17|4081475|32|NC_021902|CRISPRCasFinder,CRT 4081475-4081506 32 MK448230 Klebsiella phage ST16-OXA48phi5.2, complete genome 5451-5482 6 0.812
NC_021902_1 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT 4081719-4081750 32 MH319741 Marine virus AG-345-E15 Ga0172270_11 genomic sequence 30961-30992 6 0.812
NC_021902_1 1.43|4081477|32|NC_021902|PILER-CR 4081477-4081508 32 MK448230 Klebsiella phage ST16-OXA48phi5.2, complete genome 5451-5482 6 0.812
NC_021902_1 1.47|4081721|32|NC_021902|PILER-CR 4081721-4081752 32 MH319741 Marine virus AG-345-E15 Ga0172270_11 genomic sequence 30961-30992 6 0.812
NC_021902_2 2.1|4098782|31|NC_021902|CRISPRCasFinder,CRT 4098782-4098812 31 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 654403-654433 6 0.806
NC_021902_2 2.7|4099147|32|NC_021902|CRISPRCasFinder,CRT 4099147-4099178 32 MK448383 Streptococcus satellite phage Javan248, complete genome 4976-5007 6 0.812
NC_021902_2 2.25|4099148|32|NC_021902|PILER-CR 4099148-4099179 32 MK448383 Streptococcus satellite phage Javan248, complete genome 4976-5007 6 0.812
NC_021902_1 1.6|4080804|32|NC_021902|CRISPRCasFinder,CRT 4080804-4080835 32 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 304164-304195 7 0.781
NC_021902_1 1.6|4080804|32|NC_021902|CRISPRCasFinder,CRT 4080804-4080835 32 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 194506-194537 7 0.781
NC_021902_1 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT 4081719-4081750 32 NZ_CP045273 Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence 294630-294661 7 0.781
NC_021902_1 1.32|4080806|32|NC_021902|PILER-CR 4080806-4080837 32 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 304164-304195 7 0.781
NC_021902_1 1.32|4080806|32|NC_021902|PILER-CR 4080806-4080837 32 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 194506-194537 7 0.781
NC_021902_1 1.47|4081721|32|NC_021902|PILER-CR 4081721-4081752 32 NZ_CP045273 Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence 294630-294661 7 0.781
NC_021902_2 2.1|4098782|31|NC_021902|CRISPRCasFinder,CRT 4098782-4098812 31 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 2052295-2052325 7 0.774
NC_021902_2 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT 4098842-4098873 32 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 4747-4778 7 0.781
NC_021902_2 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT 4098842-4098873 32 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 389262-389293 7 0.781
NC_021902_2 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT 4098842-4098873 32 AP014010 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C97-MedDCM-OCT-S27-C11, *** SEQUENCING IN PROGRESS *** 33568-33599 7 0.781
NC_021902_2 2.5|4099025|32|NC_021902|CRISPRCasFinder,CRT 4099025-4099056 32 NZ_CP016366 Phaeobacter porticola strain P97 plasmid pP97_b, complete sequence 126588-126619 7 0.781
NC_021902_2 2.5|4099025|32|NC_021902|CRISPRCasFinder,CRT 4099025-4099056 32 NZ_CP010602 Phaeobacter inhibens strain P83 plasmid pP83_c, complete sequence 115384-115415 7 0.781
NC_021902_2 2.5|4099025|32|NC_021902|CRISPRCasFinder,CRT 4099025-4099056 32 NZ_CP010769 Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence 133543-133574 7 0.781
NC_021902_2 2.5|4099025|32|NC_021902|CRISPRCasFinder,CRT 4099025-4099056 32 NZ_CP010708 Phaeobacter inhibens strain P66 plasmid pP66_c, complete sequence 115381-115412 7 0.781
NC_021902_2 2.5|4099025|32|NC_021902|CRISPRCasFinder,CRT 4099025-4099056 32 NZ_CP010737 Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence 183735-183766 7 0.781
NC_021902_2 2.18|4099818|32|NC_021902|CRISPRCasFinder,CRT 4099818-4099849 32 NZ_CP024891 Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence 51303-51334 7 0.781
NC_021902_2 2.20|4098843|32|NC_021902|PILER-CR 4098843-4098874 32 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 4747-4778 7 0.781
NC_021902_2 2.20|4098843|32|NC_021902|PILER-CR 4098843-4098874 32 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 389262-389293 7 0.781
NC_021902_2 2.20|4098843|32|NC_021902|PILER-CR 4098843-4098874 32 AP014010 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C97-MedDCM-OCT-S27-C11, *** SEQUENCING IN PROGRESS *** 33568-33599 7 0.781
NC_021902_2 2.23|4099026|32|NC_021902|PILER-CR 4099026-4099057 32 NZ_CP016366 Phaeobacter porticola strain P97 plasmid pP97_b, complete sequence 126588-126619 7 0.781
NC_021902_2 2.23|4099026|32|NC_021902|PILER-CR 4099026-4099057 32 NZ_CP010602 Phaeobacter inhibens strain P83 plasmid pP83_c, complete sequence 115384-115415 7 0.781
NC_021902_2 2.23|4099026|32|NC_021902|PILER-CR 4099026-4099057 32 NZ_CP010769 Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence 133543-133574 7 0.781
NC_021902_2 2.23|4099026|32|NC_021902|PILER-CR 4099026-4099057 32 NZ_CP010708 Phaeobacter inhibens strain P66 plasmid pP66_c, complete sequence 115381-115412 7 0.781
NC_021902_2 2.23|4099026|32|NC_021902|PILER-CR 4099026-4099057 32 NZ_CP010737 Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence 183735-183766 7 0.781
NC_021902_2 2.36|4099819|32|NC_021902|PILER-CR 4099819-4099850 32 NZ_CP024891 Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence 51303-51334 7 0.781
NC_021902_1 1.6|4080804|32|NC_021902|CRISPRCasFinder,CRT 4080804-4080835 32 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 1756038-1756069 8 0.75
NC_021902_1 1.6|4080804|32|NC_021902|CRISPRCasFinder,CRT 4080804-4080835 32 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 1879010-1879041 8 0.75
NC_021902_1 1.32|4080806|32|NC_021902|PILER-CR 4080806-4080837 32 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 1756038-1756069 8 0.75
NC_021902_1 1.32|4080806|32|NC_021902|PILER-CR 4080806-4080837 32 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 1879010-1879041 8 0.75
NC_021902_2 2.4|4098964|32|NC_021902|CRISPRCasFinder,CRT 4098964-4098995 32 NC_019364 Sulfitobacter guttiformis plasmid pSD118, complete sequence 10703-10734 8 0.75
NC_021902_2 2.5|4099025|32|NC_021902|CRISPRCasFinder,CRT 4099025-4099056 32 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 276525-276556 8 0.75
NC_021902_2 2.5|4099025|32|NC_021902|CRISPRCasFinder,CRT 4099025-4099056 32 AY639599 Bacteriophage TP Ogr (ogr) and putative protease genes, complete cds 1396-1427 8 0.75
NC_021902_2 2.12|4099452|32|NC_021902|CRISPRCasFinder,CRT 4099452-4099483 32 CP047389 Agrobacterium sp. CGMCC 11546 plasmid pA 272606-272637 8 0.75
NC_021902_2 2.22|4098965|32|NC_021902|PILER-CR 4098965-4098996 32 NC_019364 Sulfitobacter guttiformis plasmid pSD118, complete sequence 10703-10734 8 0.75
NC_021902_2 2.23|4099026|32|NC_021902|PILER-CR 4099026-4099057 32 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 276525-276556 8 0.75
NC_021902_2 2.23|4099026|32|NC_021902|PILER-CR 4099026-4099057 32 AY639599 Bacteriophage TP Ogr (ogr) and putative protease genes, complete cds 1396-1427 8 0.75
NC_021902_2 2.30|4099453|32|NC_021902|PILER-CR 4099453-4099484 32 CP047389 Agrobacterium sp. CGMCC 11546 plasmid pA 272606-272637 8 0.75
NC_021902_1 1.1|4080499|32|NC_021902|CRISPRCasFinder,CRT 4080499-4080530 32 NZ_CP015221 Rhodococcus sp. PBTS 2 plasmid unnamed1, complete sequence 111308-111339 9 0.719
NC_021902_1 1.15|4081353|32|NC_021902|CRISPRCasFinder,CRT 4081353-4081384 32 NZ_CP013139 Pseudoalteromonas sp. Bsw20308 plasmid pPBSW1, complete sequence 213856-213887 9 0.719
NC_021902_1 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT 4081719-4081750 32 MN693555 Marine virus AFVG_25M96, complete genome 8842-8873 9 0.719
NC_021902_1 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT 4081719-4081750 32 MN693550 Marine virus AFVG_25M93, complete genome 10730-10761 9 0.719
NC_021902_1 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT 4081719-4081750 32 MN693245 Marine virus AFVG_25M69, complete genome 11115-11146 9 0.719
NC_021902_1 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT 4081719-4081750 32 MN693208 Marine virus AFVG_25M383, complete genome 25882-25913 9 0.719
NC_021902_1 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT 4081719-4081750 32 MN693436 Marine virus AFVG_25M57, complete genome 28024-28055 9 0.719
NC_021902_1 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT 4081719-4081750 32 MN693515 Marine virus AFVG_25M70, complete genome 10467-10498 9 0.719
NC_021902_1 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT 4081719-4081750 32 MN693320 Marine virus AFVG_25M58, complete genome 28018-28049 9 0.719
NC_021902_1 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT 4081719-4081750 32 MN693286 Marine virus AFVG_25M92, complete genome 9636-9667 9 0.719
NC_021902_1 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT 4081719-4081750 32 MN693549 Marine virus AFVG_25M89, complete genome 11533-11564 9 0.719
NC_021902_1 1.25|4081963|32|NC_021902|CRISPRCasFinder,CRT 4081963-4081994 32 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 616323-616354 9 0.719
NC_021902_1 1.25|4081963|32|NC_021902|CRISPRCasFinder,CRT 4081963-4081994 32 NC_024369 Vibrio phage X29, complete genome 16391-16422 9 0.719
NC_021902_1 1.25|4081963|32|NC_021902|CRISPRCasFinder,CRT 4081963-4081994 32 MK575466 Vibrio phage Rostov 7, complete genome 37606-37637 9 0.719
NC_021902_1 1.25|4081963|32|NC_021902|CRISPRCasFinder,CRT 4081963-4081994 32 KJ545483 Vibrio phage phi 2, complete genome 16391-16422 9 0.719
NC_021902_1 1.26|4082024|32|NC_021902|CRISPRCasFinder,CRT 4082024-4082055 32 NZ_CP047227 Moraxella osloensis strain YV1 plasmid p1, complete sequence 115808-115839 9 0.719
NC_021902_1 1.27|4080501|32|NC_021902|PILER-CR 4080501-4080532 32 NZ_CP015221 Rhodococcus sp. PBTS 2 plasmid unnamed1, complete sequence 111308-111339 9 0.719
NC_021902_1 1.41|4081355|32|NC_021902|PILER-CR 4081355-4081386 32 NZ_CP013139 Pseudoalteromonas sp. Bsw20308 plasmid pPBSW1, complete sequence 213856-213887 9 0.719
NC_021902_1 1.47|4081721|32|NC_021902|PILER-CR 4081721-4081752 32 MN693555 Marine virus AFVG_25M96, complete genome 8842-8873 9 0.719
NC_021902_1 1.47|4081721|32|NC_021902|PILER-CR 4081721-4081752 32 MN693550 Marine virus AFVG_25M93, complete genome 10730-10761 9 0.719
NC_021902_1 1.47|4081721|32|NC_021902|PILER-CR 4081721-4081752 32 MN693245 Marine virus AFVG_25M69, complete genome 11115-11146 9 0.719
NC_021902_1 1.47|4081721|32|NC_021902|PILER-CR 4081721-4081752 32 MN693208 Marine virus AFVG_25M383, complete genome 25882-25913 9 0.719
NC_021902_1 1.47|4081721|32|NC_021902|PILER-CR 4081721-4081752 32 MN693436 Marine virus AFVG_25M57, complete genome 28024-28055 9 0.719
NC_021902_1 1.47|4081721|32|NC_021902|PILER-CR 4081721-4081752 32 MN693515 Marine virus AFVG_25M70, complete genome 10467-10498 9 0.719
NC_021902_1 1.47|4081721|32|NC_021902|PILER-CR 4081721-4081752 32 MN693320 Marine virus AFVG_25M58, complete genome 28018-28049 9 0.719
NC_021902_1 1.47|4081721|32|NC_021902|PILER-CR 4081721-4081752 32 MN693286 Marine virus AFVG_25M92, complete genome 9636-9667 9 0.719
NC_021902_1 1.47|4081721|32|NC_021902|PILER-CR 4081721-4081752 32 MN693549 Marine virus AFVG_25M89, complete genome 11533-11564 9 0.719
NC_021902_1 1.51|4081965|32|NC_021902|PILER-CR 4081965-4081996 32 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 616323-616354 9 0.719
NC_021902_1 1.51|4081965|32|NC_021902|PILER-CR 4081965-4081996 32 NC_024369 Vibrio phage X29, complete genome 16391-16422 9 0.719
NC_021902_1 1.51|4081965|32|NC_021902|PILER-CR 4081965-4081996 32 MK575466 Vibrio phage Rostov 7, complete genome 37606-37637 9 0.719
NC_021902_1 1.51|4081965|32|NC_021902|PILER-CR 4081965-4081996 32 KJ545483 Vibrio phage phi 2, complete genome 16391-16422 9 0.719
NC_021902_1 1.52|4082026|32|NC_021902|PILER-CR 4082026-4082057 32 NZ_CP047227 Moraxella osloensis strain YV1 plasmid p1, complete sequence 115808-115839 9 0.719
NC_021902_2 2.7|4099147|32|NC_021902|CRISPRCasFinder,CRT 4099147-4099178 32 MK250029 Prevotella phage Lak-C1, complete genome 220147-220178 9 0.719
NC_021902_2 2.7|4099147|32|NC_021902|CRISPRCasFinder,CRT 4099147-4099178 32 MK250016 Prevotella phage Lak-A1, complete genome 256365-256396 9 0.719
NC_021902_2 2.7|4099147|32|NC_021902|CRISPRCasFinder,CRT 4099147-4099178 32 MK250019 Prevotella phage Lak-A2, complete genome 177499-177530 9 0.719
NC_021902_2 2.10|4099330|32|NC_021902|CRISPRCasFinder,CRT 4099330-4099361 32 MN693011 Marine virus AFVG_117M58, complete genome 34901-34932 9 0.719
NC_021902_2 2.25|4099148|32|NC_021902|PILER-CR 4099148-4099179 32 MK250029 Prevotella phage Lak-C1, complete genome 220147-220178 9 0.719
NC_021902_2 2.25|4099148|32|NC_021902|PILER-CR 4099148-4099179 32 MK250016 Prevotella phage Lak-A1, complete genome 256365-256396 9 0.719
NC_021902_2 2.25|4099148|32|NC_021902|PILER-CR 4099148-4099179 32 MK250019 Prevotella phage Lak-A2, complete genome 177499-177530 9 0.719
NC_021902_2 2.28|4099331|32|NC_021902|PILER-CR 4099331-4099362 32 MN693011 Marine virus AFVG_117M58, complete genome 34901-34932 9 0.719
NC_021902_1 1.6|4080804|32|NC_021902|CRISPRCasFinder,CRT 4080804-4080835 32 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 91874-91905 10 0.688
NC_021902_1 1.14|4081292|32|NC_021902|CRISPRCasFinder,CRT 4081292-4081323 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 191710-191741 10 0.688
NC_021902_1 1.14|4081292|32|NC_021902|CRISPRCasFinder,CRT 4081292-4081323 32 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 237223-237254 10 0.688
NC_021902_1 1.16|4081414|32|NC_021902|CRISPRCasFinder,CRT 4081414-4081445 32 MK047641 Phage NV21, complete genome 23610-23641 10 0.688
NC_021902_1 1.22|4081780|32|NC_021902|CRISPRCasFinder,CRT 4081780-4081811 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1888410-1888441 10 0.688
NC_021902_1 1.22|4081780|32|NC_021902|CRISPRCasFinder,CRT 4081780-4081811 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1888408-1888439 10 0.688
NC_021902_1 1.32|4080806|32|NC_021902|PILER-CR 4080806-4080837 32 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 91874-91905 10 0.688
NC_021902_1 1.40|4081294|32|NC_021902|PILER-CR 4081294-4081325 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 191710-191741 10 0.688
NC_021902_1 1.40|4081294|32|NC_021902|PILER-CR 4081294-4081325 32 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 237223-237254 10 0.688
NC_021902_1 1.42|4081416|32|NC_021902|PILER-CR 4081416-4081447 32 MK047641 Phage NV21, complete genome 23610-23641 10 0.688
NC_021902_1 1.48|4081782|32|NC_021902|PILER-CR 4081782-4081813 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1888410-1888441 10 0.688
NC_021902_1 1.48|4081782|32|NC_021902|PILER-CR 4081782-4081813 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1888408-1888439 10 0.688
NC_021902_2 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT 4098842-4098873 32 NC_011246 Borrelia recurrentis A1 plasmid pl124, complete sequence 78355-78386 10 0.688
NC_021902_2 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT 4098842-4098873 32 NZ_CP053971 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence 72031-72062 10 0.688
NC_021902_2 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT 4098842-4098873 32 NZ_CP013278 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence 3413-3444 10 0.688
NC_021902_2 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT 4098842-4098873 32 NC_018509 Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence 232722-232753 10 0.688
NC_021902_2 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT 4098842-4098873 32 NZ_CP039724 Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence 129890-129921 10 0.688
NC_021902_2 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT 4098842-4098873 32 NZ_CP051859 Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence 109941-109972 10 0.688
NC_021902_2 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT 4098842-4098873 32 NZ_CP009347 Bacillus thuringiensis HD1002 plasmid 3, complete sequence 148697-148728 10 0.688
NC_021902_2 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT 4098842-4098873 32 NZ_CP045025 Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence 3413-3444 10 0.688
NC_021902_2 2.3|4098903|32|NC_021902|CRISPRCasFinder,CRT 4098903-4098934 32 NZ_CP024657 Bacillus cereus strain MLY1 plasmid pMLY1.1, complete sequence 129540-129571 10 0.688
NC_021902_2 2.3|4098903|32|NC_021902|CRISPRCasFinder,CRT 4098903-4098934 32 NZ_CP015354 Bacillus thuringiensis strain MYBT18246 plasmid p120416, complete sequence 111984-112015 10 0.688
NC_021902_2 2.3|4098903|32|NC_021902|CRISPRCasFinder,CRT 4098903-4098934 32 NC_047948 Staphylococcus phage phiSA_BS2, complete genome 46996-47027 10 0.688
NC_021902_2 2.3|4098903|32|NC_021902|CRISPRCasFinder,CRT 4098903-4098934 32 MH078572 Staphylococcus phage phiSA_BS1, complete genome 1850-1881 10 0.688
NC_021902_2 2.4|4098964|32|NC_021902|CRISPRCasFinder,CRT 4098964-4098995 32 AP022645 Bacillus wiedmannii PL1 plasmid pBwiPL1-2 DNA, complete sequence 62931-62962 10 0.688
NC_021902_2 2.11|4099391|32|NC_021902|CRISPRCasFinder,CRT 4099391-4099422 32 MK449008 Streptococcus phage Javan84, complete genome 18935-18966 10 0.688
NC_021902_2 2.11|4099391|32|NC_021902|CRISPRCasFinder,CRT 4099391-4099422 32 MK448832 Streptococcus phage Javan85, complete genome 18935-18966 10 0.688
NC_021902_2 2.14|4099574|32|NC_021902|CRISPRCasFinder,CRT 4099574-4099605 32 MG945729 UNVERIFIED: Microviridae sp. isolate 2292-1801, complete genome 1763-1794 10 0.688
NC_021902_2 2.20|4098843|32|NC_021902|PILER-CR 4098843-4098874 32 NC_011246 Borrelia recurrentis A1 plasmid pl124, complete sequence 78355-78386 10 0.688
NC_021902_2 2.20|4098843|32|NC_021902|PILER-CR 4098843-4098874 32 NZ_CP053971 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence 72031-72062 10 0.688
NC_021902_2 2.20|4098843|32|NC_021902|PILER-CR 4098843-4098874 32 NZ_CP013278 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence 3413-3444 10 0.688
NC_021902_2 2.20|4098843|32|NC_021902|PILER-CR 4098843-4098874 32 NC_018509 Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence 232722-232753 10 0.688
NC_021902_2 2.20|4098843|32|NC_021902|PILER-CR 4098843-4098874 32 NZ_CP039724 Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence 129890-129921 10 0.688
NC_021902_2 2.20|4098843|32|NC_021902|PILER-CR 4098843-4098874 32 NZ_CP051859 Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence 109941-109972 10 0.688
NC_021902_2 2.20|4098843|32|NC_021902|PILER-CR 4098843-4098874 32 NZ_CP009347 Bacillus thuringiensis HD1002 plasmid 3, complete sequence 148697-148728 10 0.688
NC_021902_2 2.20|4098843|32|NC_021902|PILER-CR 4098843-4098874 32 NZ_CP045025 Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence 3413-3444 10 0.688
NC_021902_2 2.21|4098904|32|NC_021902|PILER-CR 4098904-4098935 32 NZ_CP024657 Bacillus cereus strain MLY1 plasmid pMLY1.1, complete sequence 129540-129571 10 0.688
NC_021902_2 2.21|4098904|32|NC_021902|PILER-CR 4098904-4098935 32 NZ_CP015354 Bacillus thuringiensis strain MYBT18246 plasmid p120416, complete sequence 111984-112015 10 0.688
NC_021902_2 2.21|4098904|32|NC_021902|PILER-CR 4098904-4098935 32 NC_047948 Staphylococcus phage phiSA_BS2, complete genome 46996-47027 10 0.688
NC_021902_2 2.21|4098904|32|NC_021902|PILER-CR 4098904-4098935 32 MH078572 Staphylococcus phage phiSA_BS1, complete genome 1850-1881 10 0.688
NC_021902_2 2.22|4098965|32|NC_021902|PILER-CR 4098965-4098996 32 AP022645 Bacillus wiedmannii PL1 plasmid pBwiPL1-2 DNA, complete sequence 62931-62962 10 0.688
NC_021902_2 2.29|4099392|32|NC_021902|PILER-CR 4099392-4099423 32 MK449008 Streptococcus phage Javan84, complete genome 18935-18966 10 0.688
NC_021902_2 2.29|4099392|32|NC_021902|PILER-CR 4099392-4099423 32 MK448832 Streptococcus phage Javan85, complete genome 18935-18966 10 0.688
NC_021902_2 2.32|4099575|32|NC_021902|PILER-CR 4099575-4099606 32 MG945729 UNVERIFIED: Microviridae sp. isolate 2292-1801, complete genome 1763-1794 10 0.688

1. spacer 1.1|4080499|32|NC_021902|CRISPRCasFinder,CRT matches to NC_004313 (Salmonella phage ST64B, complete genome) position: , mismatch: 1, identity: 0.969

gatgagcaacacgcccgcactggcgtaactta	CRISPR spacer
gatgagcaacacgcctgcactggcgtaactta	Protospacer
***************.****************

2. spacer 1.1|4080499|32|NC_021902|CRISPRCasFinder,CRT matches to KU927493 (Salmonella phage 118970_sal3, complete genome) position: , mismatch: 1, identity: 0.969

gatgagcaacacgcccgcactggcgtaactta	CRISPR spacer
gatgagcaacacgcctgcactggcgtaactta	Protospacer
***************.****************

3. spacer 1.1|4080499|32|NC_021902|CRISPRCasFinder,CRT matches to AY055382 (Salmonella typhimurium phage ST64B complete sequence) position: , mismatch: 1, identity: 0.969

gatgagcaacacgcccgcactggcgtaactta	CRISPR spacer
gatgagcaacacgcctgcactggcgtaactta	Protospacer
***************.****************

4. spacer 1.27|4080501|32|NC_021902|PILER-CR matches to NC_004313 (Salmonella phage ST64B, complete genome) position: , mismatch: 1, identity: 0.969

gatgagcaacacgcccgcactggcgtaactta	CRISPR spacer
gatgagcaacacgcctgcactggcgtaactta	Protospacer
***************.****************

5. spacer 1.27|4080501|32|NC_021902|PILER-CR matches to KU927493 (Salmonella phage 118970_sal3, complete genome) position: , mismatch: 1, identity: 0.969

gatgagcaacacgcccgcactggcgtaactta	CRISPR spacer
gatgagcaacacgcctgcactggcgtaactta	Protospacer
***************.****************

6. spacer 1.27|4080501|32|NC_021902|PILER-CR matches to AY055382 (Salmonella typhimurium phage ST64B complete sequence) position: , mismatch: 1, identity: 0.969

gatgagcaacacgcccgcactggcgtaactta	CRISPR spacer
gatgagcaacacgcctgcactggcgtaactta	Protospacer
***************.****************

7. spacer 1.17|4081475|32|NC_021902|CRISPRCasFinder,CRT matches to MK448237 (Klebsiella phage ST974-OXA48phi18.2, complete genome) position: , mismatch: 5, identity: 0.844

aatgtttcccgcacccaaatgcgatcgccagg	CRISPR spacer
aaggcctcccgcacccagatgcgatcgcctgg	Protospacer
** *..***********.*********** **

8. spacer 1.43|4081477|32|NC_021902|PILER-CR matches to MK448237 (Klebsiella phage ST974-OXA48phi18.2, complete genome) position: , mismatch: 5, identity: 0.844

aatgtttcccgcacccaaatgcgatcgccagg	CRISPR spacer
aaggcctcccgcacccagatgcgatcgcctgg	Protospacer
** *..***********.*********** **

9. spacer 2.1|4098782|31|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.839

-acggcaacggatgcgaccgccagcgcgatcc	CRISPR spacer
tgcggc-acggatgaggccgccagcgcgatct	Protospacer
 .**** ******* *.**************.

10. spacer 2.1|4098782|31|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 5, identity: 0.839

-acggcaacggatgcgaccgccagcgcgatcc	CRISPR spacer
tgcggc-acggatgaggccgccagcgcgatct	Protospacer
 .**** ******* *.**************.

11. spacer 2.1|4098782|31|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 5, identity: 0.839

-acggcaacggatgcgaccgccagcgcgatcc	CRISPR spacer
tgcggc-acggatgaggccgccagcgcgatct	Protospacer
 .**** ******* *.**************.

12. spacer 2.1|4098782|31|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.839

-acggcaacggatgcgaccgccagcgcgatcc	CRISPR spacer
tgcggc-acggatgaggccgccagcgcgatct	Protospacer
 .**** ******* *.**************.

13. spacer 1.17|4081475|32|NC_021902|CRISPRCasFinder,CRT matches to MK448230 (Klebsiella phage ST16-OXA48phi5.2, complete genome) position: , mismatch: 6, identity: 0.812

aatgtttcccgcacccaaatgcgatcgccagg	CRISPR spacer
catgtttcacgcacccagatgcgatcgccgac	Protospacer
 ******* ********.***********.. 

14. spacer 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT matches to MH319741 (Marine virus AG-345-E15 Ga0172270_11 genomic sequence) position: , mismatch: 6, identity: 0.812

ttata-gagttgactcaaattcatttttattcc	CRISPR spacer
-tatatcagttgactcaaatacttttttattat	Protospacer
 ****  ************* * ******** .

15. spacer 1.43|4081477|32|NC_021902|PILER-CR matches to MK448230 (Klebsiella phage ST16-OXA48phi5.2, complete genome) position: , mismatch: 6, identity: 0.812

aatgtttcccgcacccaaatgcgatcgccagg	CRISPR spacer
catgtttcacgcacccagatgcgatcgccgac	Protospacer
 ******* ********.***********.. 

16. spacer 1.47|4081721|32|NC_021902|PILER-CR matches to MH319741 (Marine virus AG-345-E15 Ga0172270_11 genomic sequence) position: , mismatch: 6, identity: 0.812

ttata-gagttgactcaaattcatttttattcc	CRISPR spacer
-tatatcagttgactcaaatacttttttattat	Protospacer
 ****  ************* * ******** .

17. spacer 2.1|4098782|31|NC_021902|CRISPRCasFinder,CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 6, identity: 0.806

-acggcaacggatgcgaccgccagcgcgatcc	CRISPR spacer
cgcgccga-ggaagcgaccgccagcgcgagcc	Protospacer
 .** *.* *** **************** **

18. spacer 2.7|4099147|32|NC_021902|CRISPRCasFinder,CRT matches to MK448383 (Streptococcus satellite phage Javan248, complete genome) position: , mismatch: 6, identity: 0.812

aacccttacggttatatgaaagaagattttta	CRISPR spacer
aatacatacgtttctatgaaagaagattttca	Protospacer
**. * **** ** ****************.*

19. spacer 2.25|4099148|32|NC_021902|PILER-CR matches to MK448383 (Streptococcus satellite phage Javan248, complete genome) position: , mismatch: 6, identity: 0.812

aacccttacggttatatgaaagaagattttta	CRISPR spacer
aatacatacgtttctatgaaagaagattttca	Protospacer
**. * **** ** ****************.*

20. spacer 1.6|4080804|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 7, identity: 0.781

agttcgctctcgatcgtcgcggcatacatcgc	CRISPR spacer
agcgtggattcaatcgtcgcggcatacatcgc	Protospacer
**. .*  .**.********************

21. spacer 1.6|4080804|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 7, identity: 0.781

agttcgctctcgatcgtcgcggcatacatcgc	CRISPR spacer
tgttcgctcttgttcgtcgcggcatgaatggt	Protospacer
 *********.* ************. ** *.

22. spacer 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP045273 (Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence) position: , mismatch: 7, identity: 0.781

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
gtagggagttacctcaaattcatttttataca	Protospacer
 ** .*****. ***************** * 

23. spacer 1.32|4080806|32|NC_021902|PILER-CR matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 7, identity: 0.781

agttcgctctcgatcgtcgcggcatacatcgc	CRISPR spacer
agcgtggattcaatcgtcgcggcatacatcgc	Protospacer
**. .*  .**.********************

24. spacer 1.32|4080806|32|NC_021902|PILER-CR matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 7, identity: 0.781

agttcgctctcgatcgtcgcggcatacatcgc	CRISPR spacer
tgttcgctcttgttcgtcgcggcatgaatggt	Protospacer
 *********.* ************. ** *.

25. spacer 1.47|4081721|32|NC_021902|PILER-CR matches to NZ_CP045273 (Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence) position: , mismatch: 7, identity: 0.781

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
gtagggagttacctcaaattcatttttataca	Protospacer
 ** .*****. ***************** * 

26. spacer 2.1|4098782|31|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.774

acggcaacggatgcgaccgccagcgcgatcc	CRISPR spacer
cgggccgaggatgcgaccgcgagcgcgagcc	Protospacer
  *** . ************ ******* **

27. spacer 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 7, identity: 0.781

ttgatgaaagttcatctaataatgatt-gtgct	CRISPR spacer
ttgatgcaagttcatctaaaaatctttcgtaa-	Protospacer
****** ************ ***  ** **.  

28. spacer 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 7, identity: 0.781

ttgatgaaagttcatctaataatgatt-gtgct	CRISPR spacer
ttgatgcaagttcatctaaaaatctttcgtaa-	Protospacer
****** ************ ***  ** **.  

29. spacer 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT matches to AP014010 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C97-MedDCM-OCT-S27-C11, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.781

ttgatga--aagttcatctaataatgattgtgct	CRISPR spacer
--catcaccaagttcatctaataattcttgtgtt	Protospacer
   ** *  ****************  *****.*

30. spacer 2.5|4099025|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP016366 (Phaeobacter porticola strain P97 plasmid pP97_b, complete sequence) position: , mismatch: 7, identity: 0.781

ttcaaactgcttgcggtaagaaactgttgcac	CRISPR spacer
ttttatctgctttcggtaagaatctgttgcca	Protospacer
**. * ****** ********* *******  

31. spacer 2.5|4099025|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP010602 (Phaeobacter inhibens strain P83 plasmid pP83_c, complete sequence) position: , mismatch: 7, identity: 0.781

ttcaaactgcttgcggtaagaaactgttgcac	CRISPR spacer
ttctgcctgcttgtggtaagaatctgttgcca	Protospacer
*** . *******.******** *******  

32. spacer 2.5|4099025|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP010769 (Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence) position: , mismatch: 7, identity: 0.781

ttcaaactgcttgcggtaagaaactgttgcac	CRISPR spacer
ttctgcctgcttgtggtaagaatctgttgcca	Protospacer
*** . *******.******** *******  

33. spacer 2.5|4099025|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP010708 (Phaeobacter inhibens strain P66 plasmid pP66_c, complete sequence) position: , mismatch: 7, identity: 0.781

ttcaaactgcttgcggtaagaaactgttgcac	CRISPR spacer
ttctgcctgcttgtggtaagaatctgttgcca	Protospacer
*** . *******.******** *******  

34. spacer 2.5|4099025|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP010737 (Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence) position: , mismatch: 7, identity: 0.781

ttcaaactgcttgcggtaagaaactgttgcac	CRISPR spacer
ttctgcctgcttgtggtaagaatctgttgcca	Protospacer
*** . *******.******** *******  

35. spacer 2.18|4099818|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 7, identity: 0.781

atggcgtgtctcgattgcgcgctgccgcactg	CRISPR spacer
agagcccgtctcgattgctcgctgtcgcaccg	Protospacer
* .** .*********** *****.*****.*

36. spacer 2.20|4098843|32|NC_021902|PILER-CR matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 7, identity: 0.781

ttgatgaaagttcatctaataatgatt-gtgct	CRISPR spacer
ttgatgcaagttcatctaaaaatctttcgtaa-	Protospacer
****** ************ ***  ** **.  

37. spacer 2.20|4098843|32|NC_021902|PILER-CR matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 7, identity: 0.781

ttgatgaaagttcatctaataatgatt-gtgct	CRISPR spacer
ttgatgcaagttcatctaaaaatctttcgtaa-	Protospacer
****** ************ ***  ** **.  

38. spacer 2.20|4098843|32|NC_021902|PILER-CR matches to AP014010 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C97-MedDCM-OCT-S27-C11, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.781

ttgatga--aagttcatctaataatgattgtgct	CRISPR spacer
--catcaccaagttcatctaataattcttgtgtt	Protospacer
   ** *  ****************  *****.*

39. spacer 2.23|4099026|32|NC_021902|PILER-CR matches to NZ_CP016366 (Phaeobacter porticola strain P97 plasmid pP97_b, complete sequence) position: , mismatch: 7, identity: 0.781

ttcaaactgcttgcggtaagaaactgttgcac	CRISPR spacer
ttttatctgctttcggtaagaatctgttgcca	Protospacer
**. * ****** ********* *******  

40. spacer 2.23|4099026|32|NC_021902|PILER-CR matches to NZ_CP010602 (Phaeobacter inhibens strain P83 plasmid pP83_c, complete sequence) position: , mismatch: 7, identity: 0.781

ttcaaactgcttgcggtaagaaactgttgcac	CRISPR spacer
ttctgcctgcttgtggtaagaatctgttgcca	Protospacer
*** . *******.******** *******  

41. spacer 2.23|4099026|32|NC_021902|PILER-CR matches to NZ_CP010769 (Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence) position: , mismatch: 7, identity: 0.781

ttcaaactgcttgcggtaagaaactgttgcac	CRISPR spacer
ttctgcctgcttgtggtaagaatctgttgcca	Protospacer
*** . *******.******** *******  

42. spacer 2.23|4099026|32|NC_021902|PILER-CR matches to NZ_CP010708 (Phaeobacter inhibens strain P66 plasmid pP66_c, complete sequence) position: , mismatch: 7, identity: 0.781

ttcaaactgcttgcggtaagaaactgttgcac	CRISPR spacer
ttctgcctgcttgtggtaagaatctgttgcca	Protospacer
*** . *******.******** *******  

43. spacer 2.23|4099026|32|NC_021902|PILER-CR matches to NZ_CP010737 (Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence) position: , mismatch: 7, identity: 0.781

ttcaaactgcttgcggtaagaaactgttgcac	CRISPR spacer
ttctgcctgcttgtggtaagaatctgttgcca	Protospacer
*** . *******.******** *******  

44. spacer 2.36|4099819|32|NC_021902|PILER-CR matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 7, identity: 0.781

atggcgtgtctcgattgcgcgctgccgcactg	CRISPR spacer
agagcccgtctcgattgctcgctgtcgcaccg	Protospacer
* .** .*********** *****.*****.*

45. spacer 1.6|4080804|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 8, identity: 0.75

agttcgctctcgatcgtcgcggcatacatcgc	CRISPR spacer
tgttcgttctcgatcgtcgtggcataaggttc	Protospacer
 *****.************.****** . . *

46. spacer 1.6|4080804|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 8, identity: 0.75

agttcgctctcgatcgtcgcggcatacatcgc	CRISPR spacer
tgttcgttctcgatcgtcgtggcataaggttc	Protospacer
 *****.************.****** . . *

47. spacer 1.32|4080806|32|NC_021902|PILER-CR matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 8, identity: 0.75

agttcgctctcgatcgtcgcggcatacatcgc	CRISPR spacer
tgttcgttctcgatcgtcgtggcataaggttc	Protospacer
 *****.************.****** . . *

48. spacer 1.32|4080806|32|NC_021902|PILER-CR matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 8, identity: 0.75

agttcgctctcgatcgtcgcggcatacatcgc	CRISPR spacer
tgttcgttctcgatcgtcgtggcataaggttc	Protospacer
 *****.************.****** . . *

49. spacer 2.4|4098964|32|NC_021902|CRISPRCasFinder,CRT matches to NC_019364 (Sulfitobacter guttiformis plasmid pSD118, complete sequence) position: , mismatch: 8, identity: 0.75

gccacc--cggacaacaaaatgaatcccgatgat	CRISPR spacer
--cattaggggacaacaaaatgcatcacgatgac	Protospacer
  **..   ************* *** ******.

50. spacer 2.5|4099025|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

ttcaaactgcttgcggtaagaaactgttgcac	CRISPR spacer
aagcagctgcatgcggaaagaaactgttgcaa	Protospacer
    *.**** ***** ************** 

51. spacer 2.5|4099025|32|NC_021902|CRISPRCasFinder,CRT matches to AY639599 (Bacteriophage TP Ogr (ogr) and putative protease genes, complete cds) position: , mismatch: 8, identity: 0.75

ttcaaactgcttgcggtaagaaactgttgcac	CRISPR spacer
aacaaactgctggcggtcagaaactgaataac	Protospacer
  ********* ***** ********    **

52. spacer 2.12|4099452|32|NC_021902|CRISPRCasFinder,CRT matches to CP047389 (Agrobacterium sp. CGMCC 11546 plasmid pA) position: , mismatch: 8, identity: 0.75

aaactctgggcgctcgaatggctgtcctattg	CRISPR spacer
acggactgggcgctcgaatagctgtcctgtga	Protospacer
* .  **************.********.* .

53. spacer 2.22|4098965|32|NC_021902|PILER-CR matches to NC_019364 (Sulfitobacter guttiformis plasmid pSD118, complete sequence) position: , mismatch: 8, identity: 0.75

gccacc--cggacaacaaaatgaatcccgatgat	CRISPR spacer
--cattaggggacaacaaaatgcatcacgatgac	Protospacer
  **..   ************* *** ******.

54. spacer 2.23|4099026|32|NC_021902|PILER-CR matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

ttcaaactgcttgcggtaagaaactgttgcac	CRISPR spacer
aagcagctgcatgcggaaagaaactgttgcaa	Protospacer
    *.**** ***** ************** 

55. spacer 2.23|4099026|32|NC_021902|PILER-CR matches to AY639599 (Bacteriophage TP Ogr (ogr) and putative protease genes, complete cds) position: , mismatch: 8, identity: 0.75

ttcaaactgcttgcggtaagaaactgttgcac	CRISPR spacer
aacaaactgctggcggtcagaaactgaataac	Protospacer
  ********* ***** ********    **

56. spacer 2.30|4099453|32|NC_021902|PILER-CR matches to CP047389 (Agrobacterium sp. CGMCC 11546 plasmid pA) position: , mismatch: 8, identity: 0.75

aaactctgggcgctcgaatggctgtcctattg	CRISPR spacer
acggactgggcgctcgaatagctgtcctgtga	Protospacer
* .  **************.********.* .

57. spacer 1.1|4080499|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP015221 (Rhodococcus sp. PBTS 2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gatgagcaacacgcccgcact---ggcgtaactta	CRISPR spacer
catgagcaacgcgcccgcactcgccgcgcagt---	Protospacer
 *********.**********    ***.*..   

58. spacer 1.15|4081353|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP013139 (Pseudoalteromonas sp. Bsw20308 plasmid pPBSW1, complete sequence) position: , mismatch: 9, identity: 0.719

ctgattgtcaaaatcaaaaaacaggccgagtc	CRISPR spacer
gtgtaagtcaaaatgaaagaacaggccgacgg	Protospacer
 **   ******** ***.**********   

59. spacer 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT matches to MN693555 (Marine virus AFVG_25M96, complete genome) position: , mismatch: 9, identity: 0.719

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
tcatagagttgaatcaatttcatttattagaa	Protospacer
*.********** **** ******* *     

60. spacer 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT matches to MN693550 (Marine virus AFVG_25M93, complete genome) position: , mismatch: 9, identity: 0.719

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
tcatagagttgaatcaatttcatttattagaa	Protospacer
*.********** **** ******* *     

61. spacer 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT matches to MN693245 (Marine virus AFVG_25M69, complete genome) position: , mismatch: 9, identity: 0.719

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
tcatagagttgaatcaatttcatttattagaa	Protospacer
*.********** **** ******* *     

62. spacer 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT matches to MN693208 (Marine virus AFVG_25M383, complete genome) position: , mismatch: 9, identity: 0.719

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
tcatagagttgaatcaatttcatttattaaaa	Protospacer
*.********** **** ******* *     

63. spacer 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT matches to MN693436 (Marine virus AFVG_25M57, complete genome) position: , mismatch: 9, identity: 0.719

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
tcatagagttgaatcaatttcatttattagaa	Protospacer
*.********** **** ******* *     

64. spacer 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT matches to MN693515 (Marine virus AFVG_25M70, complete genome) position: , mismatch: 9, identity: 0.719

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
tcatagagttgaatcaatttcatttattagaa	Protospacer
*.********** **** ******* *     

65. spacer 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT matches to MN693320 (Marine virus AFVG_25M58, complete genome) position: , mismatch: 9, identity: 0.719

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
tcatagagttgaatcaatttcatttattaaaa	Protospacer
*.********** **** ******* *     

66. spacer 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT matches to MN693286 (Marine virus AFVG_25M92, complete genome) position: , mismatch: 9, identity: 0.719

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
tcatagagttgaatcaatttcatttattagaa	Protospacer
*.********** **** ******* *     

67. spacer 1.21|4081719|32|NC_021902|CRISPRCasFinder,CRT matches to MN693549 (Marine virus AFVG_25M89, complete genome) position: , mismatch: 9, identity: 0.719

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
tcatagagttgaatcaatttcatttattaaaa	Protospacer
*.********** **** ******* *     

68. spacer 1.25|4081963|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.719

ccgtcgccgcacgcaaacaatccgggcgccca	CRISPR spacer
ccggccccgcacgcaaacaatccgaccaatgg	Protospacer
*** * ******************. *. . .

69. spacer 1.25|4081963|32|NC_021902|CRISPRCasFinder,CRT matches to NC_024369 (Vibrio phage X29, complete genome) position: , mismatch: 9, identity: 0.719

ccgtcgccgcacgcaaacaatccgggcgccca	CRISPR spacer
cattcgccgcacgcaaaaaagccgggcttggg	Protospacer
*  ************** ** ****** .  .

70. spacer 1.25|4081963|32|NC_021902|CRISPRCasFinder,CRT matches to MK575466 (Vibrio phage Rostov 7, complete genome) position: , mismatch: 9, identity: 0.719

ccgtcgccgcacgcaaacaatccgggcgccca	CRISPR spacer
cattcgccgcacgcaaaaaagccgggcttggg	Protospacer
*  ************** ** ****** .  .

71. spacer 1.25|4081963|32|NC_021902|CRISPRCasFinder,CRT matches to KJ545483 (Vibrio phage phi 2, complete genome) position: , mismatch: 9, identity: 0.719

ccgtcgccgcacgcaaacaatccgggcgccca	CRISPR spacer
cattcgccgcacgcaaaaaagccgggcttggg	Protospacer
*  ************** ** ****** .  .

72. spacer 1.26|4082024|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP047227 (Moraxella osloensis strain YV1 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

tcaataaccccttttaaatactgccgttccag	CRISPR spacer
ttgcaaaccgcttttaattactgccgtttacg	Protospacer
*..  **** ******* **********.  *

73. spacer 1.27|4080501|32|NC_021902|PILER-CR matches to NZ_CP015221 (Rhodococcus sp. PBTS 2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gatgagcaacacgcccgcact---ggcgtaactta	CRISPR spacer
catgagcaacgcgcccgcactcgccgcgcagt---	Protospacer
 *********.**********    ***.*..   

74. spacer 1.41|4081355|32|NC_021902|PILER-CR matches to NZ_CP013139 (Pseudoalteromonas sp. Bsw20308 plasmid pPBSW1, complete sequence) position: , mismatch: 9, identity: 0.719

ctgattgtcaaaatcaaaaaacaggccgagtc	CRISPR spacer
gtgtaagtcaaaatgaaagaacaggccgacgg	Protospacer
 **   ******** ***.**********   

75. spacer 1.47|4081721|32|NC_021902|PILER-CR matches to MN693555 (Marine virus AFVG_25M96, complete genome) position: , mismatch: 9, identity: 0.719

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
tcatagagttgaatcaatttcatttattagaa	Protospacer
*.********** **** ******* *     

76. spacer 1.47|4081721|32|NC_021902|PILER-CR matches to MN693550 (Marine virus AFVG_25M93, complete genome) position: , mismatch: 9, identity: 0.719

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
tcatagagttgaatcaatttcatttattagaa	Protospacer
*.********** **** ******* *     

77. spacer 1.47|4081721|32|NC_021902|PILER-CR matches to MN693245 (Marine virus AFVG_25M69, complete genome) position: , mismatch: 9, identity: 0.719

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
tcatagagttgaatcaatttcatttattagaa	Protospacer
*.********** **** ******* *     

78. spacer 1.47|4081721|32|NC_021902|PILER-CR matches to MN693208 (Marine virus AFVG_25M383, complete genome) position: , mismatch: 9, identity: 0.719

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
tcatagagttgaatcaatttcatttattaaaa	Protospacer
*.********** **** ******* *     

79. spacer 1.47|4081721|32|NC_021902|PILER-CR matches to MN693436 (Marine virus AFVG_25M57, complete genome) position: , mismatch: 9, identity: 0.719

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
tcatagagttgaatcaatttcatttattagaa	Protospacer
*.********** **** ******* *     

80. spacer 1.47|4081721|32|NC_021902|PILER-CR matches to MN693515 (Marine virus AFVG_25M70, complete genome) position: , mismatch: 9, identity: 0.719

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
tcatagagttgaatcaatttcatttattagaa	Protospacer
*.********** **** ******* *     

81. spacer 1.47|4081721|32|NC_021902|PILER-CR matches to MN693320 (Marine virus AFVG_25M58, complete genome) position: , mismatch: 9, identity: 0.719

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
tcatagagttgaatcaatttcatttattaaaa	Protospacer
*.********** **** ******* *     

82. spacer 1.47|4081721|32|NC_021902|PILER-CR matches to MN693286 (Marine virus AFVG_25M92, complete genome) position: , mismatch: 9, identity: 0.719

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
tcatagagttgaatcaatttcatttattagaa	Protospacer
*.********** **** ******* *     

83. spacer 1.47|4081721|32|NC_021902|PILER-CR matches to MN693549 (Marine virus AFVG_25M89, complete genome) position: , mismatch: 9, identity: 0.719

ttatagagttgactcaaattcatttttattcc	CRISPR spacer
tcatagagttgaatcaatttcatttattaaaa	Protospacer
*.********** **** ******* *     

84. spacer 1.51|4081965|32|NC_021902|PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.719

ccgtcgccgcacgcaaacaatccgggcgccca	CRISPR spacer
ccggccccgcacgcaaacaatccgaccaatgg	Protospacer
*** * ******************. *. . .

85. spacer 1.51|4081965|32|NC_021902|PILER-CR matches to NC_024369 (Vibrio phage X29, complete genome) position: , mismatch: 9, identity: 0.719

ccgtcgccgcacgcaaacaatccgggcgccca	CRISPR spacer
cattcgccgcacgcaaaaaagccgggcttggg	Protospacer
*  ************** ** ****** .  .

86. spacer 1.51|4081965|32|NC_021902|PILER-CR matches to MK575466 (Vibrio phage Rostov 7, complete genome) position: , mismatch: 9, identity: 0.719

ccgtcgccgcacgcaaacaatccgggcgccca	CRISPR spacer
cattcgccgcacgcaaaaaagccgggcttggg	Protospacer
*  ************** ** ****** .  .

87. spacer 1.51|4081965|32|NC_021902|PILER-CR matches to KJ545483 (Vibrio phage phi 2, complete genome) position: , mismatch: 9, identity: 0.719

ccgtcgccgcacgcaaacaatccgggcgccca	CRISPR spacer
cattcgccgcacgcaaaaaagccgggcttggg	Protospacer
*  ************** ** ****** .  .

88. spacer 1.52|4082026|32|NC_021902|PILER-CR matches to NZ_CP047227 (Moraxella osloensis strain YV1 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

tcaataaccccttttaaatactgccgttccag	CRISPR spacer
ttgcaaaccgcttttaattactgccgtttacg	Protospacer
*..  **** ******* **********.  *

89. spacer 2.7|4099147|32|NC_021902|CRISPRCasFinder,CRT matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 9, identity: 0.719

aacccttacggttatatgaaagaagattttta	CRISPR spacer
attgcttaccgttatgtgaaagaagataatac	Protospacer
* . ***** *****.***********  *  

90. spacer 2.7|4099147|32|NC_021902|CRISPRCasFinder,CRT matches to MK250016 (Prevotella phage Lak-A1, complete genome) position: , mismatch: 9, identity: 0.719

aacccttacggttatatgaaagaagattttta	CRISPR spacer
attgcttaccgttatgtgaaagaagataatac	Protospacer
* . ***** *****.***********  *  

91. spacer 2.7|4099147|32|NC_021902|CRISPRCasFinder,CRT matches to MK250019 (Prevotella phage Lak-A2, complete genome) position: , mismatch: 9, identity: 0.719

aacccttacggttatatgaaagaagattttta	CRISPR spacer
attgcttaccgttatgtgaaagaagataatac	Protospacer
* . ***** *****.***********  *  

92. spacer 2.10|4099330|32|NC_021902|CRISPRCasFinder,CRT matches to MN693011 (Marine virus AFVG_117M58, complete genome) position: , mismatch: 9, identity: 0.719

gttttctctacatttagctatagacgttagtt	CRISPR spacer
attttctccacttttagctatagaacctttta	Protospacer
.*******.** ************  .*  * 

93. spacer 2.25|4099148|32|NC_021902|PILER-CR matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 9, identity: 0.719

aacccttacggttatatgaaagaagattttta	CRISPR spacer
attgcttaccgttatgtgaaagaagataatac	Protospacer
* . ***** *****.***********  *  

94. spacer 2.25|4099148|32|NC_021902|PILER-CR matches to MK250016 (Prevotella phage Lak-A1, complete genome) position: , mismatch: 9, identity: 0.719

aacccttacggttatatgaaagaagattttta	CRISPR spacer
attgcttaccgttatgtgaaagaagataatac	Protospacer
* . ***** *****.***********  *  

95. spacer 2.25|4099148|32|NC_021902|PILER-CR matches to MK250019 (Prevotella phage Lak-A2, complete genome) position: , mismatch: 9, identity: 0.719

aacccttacggttatatgaaagaagattttta	CRISPR spacer
attgcttaccgttatgtgaaagaagataatac	Protospacer
* . ***** *****.***********  *  

96. spacer 2.28|4099331|32|NC_021902|PILER-CR matches to MN693011 (Marine virus AFVG_117M58, complete genome) position: , mismatch: 9, identity: 0.719

gttttctctacatttagctatagacgttagtt	CRISPR spacer
attttctccacttttagctatagaacctttta	Protospacer
.*******.** ************  .*  * 

97. spacer 1.6|4080804|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 10, identity: 0.688

agttcgctctcgatcgtcgcggcatacatcgc	CRISPR spacer
ttttcggtatcgatcgtcgcggcatggacaaa	Protospacer
  **** * ****************. *. . 

98. spacer 1.14|4081292|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 10, identity: 0.688

cgcgcacggcgtttgccctcgtcggttattgg	CRISPR spacer
accgcacggcgggtgccctcgtcggcgctgat	Protospacer
  *********  ************.  * . 

99. spacer 1.14|4081292|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 10, identity: 0.688

cgcgcacggcgtttgccctcgtcggttattgg	CRISPR spacer
accgcacggcgggtgccctcgtcggcgctgat	Protospacer
  *********  ************.  * . 

100. spacer 1.16|4081414|32|NC_021902|CRISPRCasFinder,CRT matches to MK047641 (Phage NV21, complete genome) position: , mismatch: 10, identity: 0.688

gagcgaaggtgcaacattatcaccatattcgg	CRISPR spacer
ccaagacggtgaaacattatcaccataagtag	Protospacer
  . ** **** ***************  ..*

101. spacer 1.22|4081780|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

tagccgggtctgtatcgaataccagccccgcg	CRISPR spacer
ggcgcgggtcggaatcgaataccagcccgagc	Protospacer
 .  ****** * *************** .  

102. spacer 1.22|4081780|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

tagccgggtctgtatcgaataccagccccgcg	CRISPR spacer
ggcgcgggtcggaatcgaataccagcccgagc	Protospacer
 .  ****** * *************** .  

103. spacer 1.32|4080806|32|NC_021902|PILER-CR matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 10, identity: 0.688

agttcgctctcgatcgtcgcggcatacatcgc	CRISPR spacer
ttttcggtatcgatcgtcgcggcatggacaaa	Protospacer
  **** * ****************. *. . 

104. spacer 1.40|4081294|32|NC_021902|PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 10, identity: 0.688

cgcgcacggcgtttgccctcgtcggttattgg	CRISPR spacer
accgcacggcgggtgccctcgtcggcgctgat	Protospacer
  *********  ************.  * . 

105. spacer 1.40|4081294|32|NC_021902|PILER-CR matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 10, identity: 0.688

cgcgcacggcgtttgccctcgtcggttattgg	CRISPR spacer
accgcacggcgggtgccctcgtcggcgctgat	Protospacer
  *********  ************.  * . 

106. spacer 1.42|4081416|32|NC_021902|PILER-CR matches to MK047641 (Phage NV21, complete genome) position: , mismatch: 10, identity: 0.688

gagcgaaggtgcaacattatcaccatattcgg	CRISPR spacer
ccaagacggtgaaacattatcaccataagtag	Protospacer
  . ** **** ***************  ..*

107. spacer 1.48|4081782|32|NC_021902|PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

tagccgggtctgtatcgaataccagccccgcg	CRISPR spacer
ggcgcgggtcggaatcgaataccagcccgagc	Protospacer
 .  ****** * *************** .  

108. spacer 1.48|4081782|32|NC_021902|PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

tagccgggtctgtatcgaataccagccccgcg	CRISPR spacer
ggcgcgggtcggaatcgaataccagcccgagc	Protospacer
 .  ****** * *************** .  

109. spacer 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT matches to NC_011246 (Borrelia recurrentis A1 plasmid pl124, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
ttgttgaaaattcatctaataatgccataaga	Protospacer
*** *****.************** .   .  

110. spacer 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP053971 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

111. spacer 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP013278 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

112. spacer 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT matches to NC_018509 (Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

113. spacer 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP039724 (Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

114. spacer 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP051859 (Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

115. spacer 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP009347 (Bacillus thuringiensis HD1002 plasmid 3, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

116. spacer 2.2|4098842|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP045025 (Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

117. spacer 2.3|4098903|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP024657 (Bacillus cereus strain MLY1 plasmid pMLY1.1, complete sequence) position: , mismatch: 10, identity: 0.688

gaaccgcttttatttttagacatagagcaccg	CRISPR spacer
ctgccgtttttatttttcgacatagaaatgca	Protospacer
  .***.********** ********.   *.

118. spacer 2.3|4098903|32|NC_021902|CRISPRCasFinder,CRT matches to NZ_CP015354 (Bacillus thuringiensis strain MYBT18246 plasmid p120416, complete sequence) position: , mismatch: 10, identity: 0.688

gaaccgcttttatttttagacatagagcaccg	CRISPR spacer
ctgccgtttttatttttcgacatagaaatgca	Protospacer
  .***.********** ********.   *.

119. spacer 2.3|4098903|32|NC_021902|CRISPRCasFinder,CRT matches to NC_047948 (Staphylococcus phage phiSA_BS2, complete genome) position: , mismatch: 10, identity: 0.688

gaaccgcttttatttttagacatagagcaccg	CRISPR spacer
atacccctttcatttttagacataggtatcta	Protospacer
. *** ****.**************.   *..

120. spacer 2.3|4098903|32|NC_021902|CRISPRCasFinder,CRT matches to MH078572 (Staphylococcus phage phiSA_BS1, complete genome) position: , mismatch: 10, identity: 0.688

gaaccgcttttatttttagacatagagcaccg	CRISPR spacer
atacccctttcatttttagacataggtatcta	Protospacer
. *** ****.**************.   *..

121. spacer 2.4|4098964|32|NC_021902|CRISPRCasFinder,CRT matches to AP022645 (Bacillus wiedmannii PL1 plasmid pBwiPL1-2 DNA, complete sequence) position: , mismatch: 10, identity: 0.688

gccacccggacaacaaaatgaatcccgatgat	CRISPR spacer
ttgatgaatacaacaaaatgaatcctgataat	Protospacer
 . *.  . ****************.***.**

122. spacer 2.11|4099391|32|NC_021902|CRISPRCasFinder,CRT matches to MK449008 (Streptococcus phage Javan84, complete genome) position: , mismatch: 10, identity: 0.688

tggcctgactttatcaagcagtgcatactgac	CRISPR spacer
ccaggtaactttatcaagctgtccatactgtg	Protospacer
. .  *.************ ** *******  

123. spacer 2.11|4099391|32|NC_021902|CRISPRCasFinder,CRT matches to MK448832 (Streptococcus phage Javan85, complete genome) position: , mismatch: 10, identity: 0.688

tggcctgactttatcaagcagtgcatactgac	CRISPR spacer
ccaggtaactttatcaagctgtccatactgtg	Protospacer
. .  *.************ ** *******  

124. spacer 2.14|4099574|32|NC_021902|CRISPRCasFinder,CRT matches to MG945729 (UNVERIFIED: Microviridae sp. isolate 2292-1801, complete genome) position: , mismatch: 10, identity: 0.688

gagacttttcacactgataatgttgttatttt	CRISPR spacer
attaaagttgacactgataaggttgttattgc	Protospacer
.  *   ** ********** ********* .

125. spacer 2.20|4098843|32|NC_021902|PILER-CR matches to NC_011246 (Borrelia recurrentis A1 plasmid pl124, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
ttgttgaaaattcatctaataatgccataaga	Protospacer
*** *****.************** .   .  

126. spacer 2.20|4098843|32|NC_021902|PILER-CR matches to NZ_CP053971 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

127. spacer 2.20|4098843|32|NC_021902|PILER-CR matches to NZ_CP013278 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

128. spacer 2.20|4098843|32|NC_021902|PILER-CR matches to NC_018509 (Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

129. spacer 2.20|4098843|32|NC_021902|PILER-CR matches to NZ_CP039724 (Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

130. spacer 2.20|4098843|32|NC_021902|PILER-CR matches to NZ_CP051859 (Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

131. spacer 2.20|4098843|32|NC_021902|PILER-CR matches to NZ_CP009347 (Bacillus thuringiensis HD1002 plasmid 3, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

132. spacer 2.20|4098843|32|NC_021902|PILER-CR matches to NZ_CP045025 (Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

133. spacer 2.21|4098904|32|NC_021902|PILER-CR matches to NZ_CP024657 (Bacillus cereus strain MLY1 plasmid pMLY1.1, complete sequence) position: , mismatch: 10, identity: 0.688

gaaccgcttttatttttagacatagagcaccg	CRISPR spacer
ctgccgtttttatttttcgacatagaaatgca	Protospacer
  .***.********** ********.   *.

134. spacer 2.21|4098904|32|NC_021902|PILER-CR matches to NZ_CP015354 (Bacillus thuringiensis strain MYBT18246 plasmid p120416, complete sequence) position: , mismatch: 10, identity: 0.688

gaaccgcttttatttttagacatagagcaccg	CRISPR spacer
ctgccgtttttatttttcgacatagaaatgca	Protospacer
  .***.********** ********.   *.

135. spacer 2.21|4098904|32|NC_021902|PILER-CR matches to NC_047948 (Staphylococcus phage phiSA_BS2, complete genome) position: , mismatch: 10, identity: 0.688

gaaccgcttttatttttagacatagagcaccg	CRISPR spacer
atacccctttcatttttagacataggtatcta	Protospacer
. *** ****.**************.   *..

136. spacer 2.21|4098904|32|NC_021902|PILER-CR matches to MH078572 (Staphylococcus phage phiSA_BS1, complete genome) position: , mismatch: 10, identity: 0.688

gaaccgcttttatttttagacatagagcaccg	CRISPR spacer
atacccctttcatttttagacataggtatcta	Protospacer
. *** ****.**************.   *..

137. spacer 2.22|4098965|32|NC_021902|PILER-CR matches to AP022645 (Bacillus wiedmannii PL1 plasmid pBwiPL1-2 DNA, complete sequence) position: , mismatch: 10, identity: 0.688

gccacccggacaacaaaatgaatcccgatgat	CRISPR spacer
ttgatgaatacaacaaaatgaatcctgataat	Protospacer
 . *.  . ****************.***.**

138. spacer 2.29|4099392|32|NC_021902|PILER-CR matches to MK449008 (Streptococcus phage Javan84, complete genome) position: , mismatch: 10, identity: 0.688

tggcctgactttatcaagcagtgcatactgac	CRISPR spacer
ccaggtaactttatcaagctgtccatactgtg	Protospacer
. .  *.************ ** *******  

139. spacer 2.29|4099392|32|NC_021902|PILER-CR matches to MK448832 (Streptococcus phage Javan85, complete genome) position: , mismatch: 10, identity: 0.688

tggcctgactttatcaagcagtgcatactgac	CRISPR spacer
ccaggtaactttatcaagctgtccatactgtg	Protospacer
. .  *.************ ** *******  

140. spacer 2.32|4099575|32|NC_021902|PILER-CR matches to MG945729 (UNVERIFIED: Microviridae sp. isolate 2292-1801, complete genome) position: , mismatch: 10, identity: 0.688

gagacttttcacactgataatgttgttatttt	CRISPR spacer
attaaagttgacactgataaggttgttattgc	Protospacer
.  *   ** ********** ********* .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 490341 : 541407 51 Burkholderia_phage(37.5%) tRNA,tail,plate NA
DBSCAN-SWA_2 1842677 : 1879496 58 Salmonella_phage(45.61%) terminase,tail,portal,integrase,head,protease,lysis attL 1842588:1842612|attR 1879765:1879789
DBSCAN-SWA_3 2003985 : 2011299 7 Dickeya_phage(16.67%) protease NA
DBSCAN-SWA_4 2061650 : 2203965 167 Salmonella_phage(51.4%) holin,terminase,tail,portal,integrase,head,tRNA,protease,lysis attL 2159587:2159646|attR 2201453:2201530
DBSCAN-SWA_5 3103414 : 3114064 12 Morganella_phage(25.0%) NA NA
DBSCAN-SWA_6 3207195 : 3217702 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_7 3286560 : 3295731 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_8 3709232 : 3810714 110 Salmonella_phage(36.07%) capsid,terminase,holin,tail,portal,tRNA,integrase,lysis,head,protease,transposase attL 3735376:3735391|attR 3805803:3805818
DBSCAN-SWA_9 3815353 : 3905130 79 Cronobacter_phage(65.91%) capsid,holin,terminase,tail,portal,tRNA,integrase,head attL 3869630:3869645|attR 3909240:3909255
DBSCAN-SWA_10 4671958 : 4737739 79 Salmonella_phage(42.22%) capsid,holin,terminase,tail,portal,integrase,plate,lysis,head,protease attL 4701814:4701860|attR 4732793:4732839
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage