Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_021920 Corynebacterium maris DSM 45190 plasmid pCmaris1, complete sequence 1 crisprs c2c9_V-U4,csa3 0 2 0 0
NC_021915 Corynebacterium maris DSM 45190, complete sequence 2 crisprs cas3,DEDDh,csa3,WYL,c2c9_V-U4,DinG 0 0 0 0

Results visualization

1. NC_021920
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021920_1 4805-4950 TypeV-U4 NA
2 spacers
c2c9_V-U4

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_021920_1 1.1|4828|39|NC_021920|CRISPRCasFinder 4828-4866 39 NC_021920 Corynebacterium maris DSM 45190 plasmid pCmaris1, complete sequence 4828-4866 0 1.0
NC_021920_1 1.2|4890|38|NC_021920|CRISPRCasFinder 4890-4927 38 NC_021920 Corynebacterium maris DSM 45190 plasmid pCmaris1, complete sequence 4890-4927 0 1.0

1. spacer 1.1|4828|39|NC_021920|CRISPRCasFinder matches to NC_021920 (Corynebacterium maris DSM 45190 plasmid pCmaris1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaggtctgttcaccgtcagcgtctttgactcaggtcgc	CRISPR spacer
gcaggtctgttcaccgtcagcgtctttgactcaggtcgc	Protospacer
***************************************

2. spacer 1.2|4890|38|NC_021920|CRISPRCasFinder matches to NC_021920 (Corynebacterium maris DSM 45190 plasmid pCmaris1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcgtgttcggaccccgtaagggcggcggtcagggatc	CRISPR spacer
ttcgtgttcggaccccgtaagggcggcggtcagggatc	Protospacer
**************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_021915
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021915_1 268314-268397 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_021915_2 1220716-1220823 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage