Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_022083 Klebsiella pneumoniae JM45 plasmid p2, complete sequence 0 crisprs RT 0 0 0 0
NC_022082 Klebsiella pneumoniae JM45, complete sequence 3 crisprs csa3,cas3,DEDDh,RT,DinG,WYL 0 1 9 0
NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 0 crisprs RT,csa3,cas3 0 0 3 0

Results visualization

1. NC_022082
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022082_1 1786692-1786787 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022082_2 3982768-3982863 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022082_3 4465765-4465859 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_022082_2 2.1|3982798|36|NC_022082|CRISPRCasFinder 3982798-3982833 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
NC_022082_2 2.1|3982798|36|NC_022082|CRISPRCasFinder 3982798-3982833 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
NC_022082_2 2.1|3982798|36|NC_022082|CRISPRCasFinder 3982798-3982833 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 2.1|3982798|36|NC_022082|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

2. spacer 2.1|3982798|36|NC_022082|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

3. spacer 2.1|3982798|36|NC_022082|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 482268 : 565796 78 uncultured_Caudovirales_phage(54.55%) tRNA,integrase,terminase,protease,capsid,portal,tail,transposase,head attL 499876:499893|attR 515871:515888
DBSCAN-SWA_2 1274713 : 1320949 61 Salmonella_phage(83.72%) tRNA,integrase,terminase,capsid,lysis,portal,tail,head,coat,plate attL 1273008:1273054|attR 1309574:1309620
DBSCAN-SWA_3 1759379 : 1766284 6 Planktothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_4 2758586 : 2768000 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_5 2962565 : 3037312 80 Klebsiella_phage(20.83%) integrase,terminase,tail,holin,plate attL 2986199:2986214|attR 3041240:3041255
DBSCAN-SWA_6 3413578 : 3506778 96 Salmonella_phage(56.9%) tRNA,integrase,terminase,protease,capsid,lysis,portal,tail,head,plate attL 3469354:3469372|attR 3506853:3506871
DBSCAN-SWA_7 3951694 : 3992917 61 Salmonella_phage(18.6%) tRNA,integrase,capsid,terminase attL 3945741:3945787|attR 3989991:3990037
DBSCAN-SWA_8 4202472 : 4214125 14 Enterobacteria_phage(70.0%) integrase attL 4202324:4202337|attR 4206537:4206550
DBSCAN-SWA_9 4682250 : 4688074 8 Enterobacteria_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_022078
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 11299 : 64340 49 Escherichia_phage(23.81%) transposase,integrase attL 38638:38670|attR 64361:64393
DBSCAN-SWA_2 69198 : 76764 12 Salmonella_phage(50.0%) integrase attL 66372:66386|attR 80456:80470
DBSCAN-SWA_3 111066 : 177511 63 Salmonella_phage(32.14%) protease,transposase,integrase attL 140114:140173|attR 155130:155950
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage