Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP047266 Pseudomonas asturiensis strain CC1524 plasmid pCC1524, complete sequence 2 crisprs NA 0 2 0 0
NZ_CP047265 Pseudomonas asturiensis strain CC1524 chromosome, complete genome 1 crisprs DEDDh,DinG,csa3,cas3,RT 0 0 5 0

Results visualization

1. NZ_CP047266
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047266_1 47194-47332 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047266_2 47574-47682 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP047266_2 2.1|47597|21|NZ_CP047266|CRISPRCasFinder 47597-47617 21 NZ_CP047266 Pseudomonas asturiensis strain CC1524 plasmid pCC1524, complete sequence 47597-47617 0 1.0
NZ_CP047266_2 2.2|47641|19|NZ_CP047266|CRISPRCasFinder 47641-47659 19 NZ_CP047266 Pseudomonas asturiensis strain CC1524 plasmid pCC1524, complete sequence 47641-47659 0 1.0
NZ_CP047266_2 2.1|47597|21|NZ_CP047266|CRISPRCasFinder 47597-47617 21 NZ_CP047266 Pseudomonas asturiensis strain CC1524 plasmid pCC1524, complete sequence 47640-47660 2 0.905

1. spacer 2.1|47597|21|NZ_CP047266|CRISPRCasFinder matches to NZ_CP047266 (Pseudomonas asturiensis strain CC1524 plasmid pCC1524, complete sequence) position: , mismatch: 0, identity: 1.0

tcatagctgaaatctgtagtc	CRISPR spacer
tcatagctgaaatctgtagtc	Protospacer
*********************

2. spacer 2.2|47641|19|NZ_CP047266|CRISPRCasFinder matches to NZ_CP047266 (Pseudomonas asturiensis strain CC1524 plasmid pCC1524, complete sequence) position: , mismatch: 0, identity: 1.0

tatagctgaaatctgtagt	CRISPR spacer
tatagctgaaatctgtagt	Protospacer
*******************

3. spacer 2.1|47597|21|NZ_CP047266|CRISPRCasFinder matches to NZ_CP047266 (Pseudomonas asturiensis strain CC1524 plasmid pCC1524, complete sequence) position: , mismatch: 2, identity: 0.905

tcatagctgaaatctgtagtc	CRISPR spacer
gtatagctgaaatctgtagtc	Protospacer
 .*******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP047265
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047265_1 5780633-5780723 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 342753 : 461378 110 Pseudomonas_phage(45.24%) portal,head,tail,capsid,integrase,plate,terminase,bacteriocin,lysis,transposase attL 410013:410059|attR 443785:443831
DBSCAN-SWA_2 683798 : 762419 60 Bacillus_virus(30.0%) protease,holin NA
DBSCAN-SWA_3 1856057 : 1882741 44 Pseudomonas_phage(44.44%) protease,portal,holin,head,capsid,tail,integrase,terminase attL 1848369:1848383|attR 1861086:1861100
DBSCAN-SWA_4 2506219 : 2514321 9 uncultured_Caudovirales_phage(85.71%) tRNA NA
DBSCAN-SWA_5 2908404 : 2952793 68 Pseudomonas_phage(42.5%) tail,capsid,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage