Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017025 Flavobacterium indicum GPTSA100-9 = DSM 17447, complete genome 3 crisprs DEDDh,csa3,cas3,WYL 1 0 1 0

Results visualization

1. NC_017025
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017025_1 1744952-1745036 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017025_2 2058296-2058400 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017025_3 2872075-2872188 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_017025_1 1.1|1744975|39|NC_017025|CRISPRCasFinder 1744975-1745013 39 NC_017025.1 1745167-1745205 2 0.949

1. spacer 1.1|1744975|39|NC_017025|CRISPRCasFinder matches to position: 1745167-1745205, mismatch: 2, identity: 0.949

tccgaacttgtttcggaatctctcgtttgcttacgcctg	CRISPR spacer
tccgaactcgtttcggaatctctcgtttgctaacgcctg	Protospacer
********.********************** *******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 59246 : 66049 7 Burkholderia_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage