Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_022221 Salmonella enterica subsp. enterica serovar Gallinarum/pullorum str. CDC1983-67, complete genome 2 crisprs DEDDh,cas3,DinG,WYL,csa3,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 1 4 0

Results visualization

1. NC_022221
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022221_1 2931244-2931399 TypeI-E I-E
2 spacers
cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022221_2 2947545-2947937 TypeI-E I-E
6 spacers
cas3,cas8e,cse2gr11

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_022221_1 1.1|2931278|27|NC_022221|PILER-CR 2931278-2931304 27 MK449011 Streptococcus phage Javan92, complete genome 36161-36187 5 0.815
NC_022221_1 1.1|2931278|27|NC_022221|PILER-CR 2931278-2931304 27 MK448835 Streptococcus phage Javan93, complete genome 36161-36187 5 0.815
NC_022221_1 1.1|2931278|27|NC_022221|PILER-CR 2931278-2931304 27 MK448836 Streptococcus phage Javan95, complete genome 37404-37430 5 0.815
NC_022221_1 1.1|2931278|27|NC_022221|PILER-CR 2931278-2931304 27 MK448825 Streptococcus phage Javan639, complete genome 37404-37430 5 0.815

1. spacer 1.1|2931278|27|NC_022221|PILER-CR matches to MK449011 (Streptococcus phage Javan92, complete genome) position: , mismatch: 5, identity: 0.815

gccgctggtcaaattcccaatctgagc	CRISPR spacer
acatcttgacaaattcccaatctgagc	Protospacer
.*  ** * ******************

2. spacer 1.1|2931278|27|NC_022221|PILER-CR matches to MK448835 (Streptococcus phage Javan93, complete genome) position: , mismatch: 5, identity: 0.815

gccgctggtcaaattcccaatctgagc	CRISPR spacer
acatcttgacaaattcccaatctgagc	Protospacer
.*  ** * ******************

3. spacer 1.1|2931278|27|NC_022221|PILER-CR matches to MK448836 (Streptococcus phage Javan95, complete genome) position: , mismatch: 5, identity: 0.815

gccgctggtcaaattcccaatctgagc	CRISPR spacer
acatcttgacaaattcccaatctgagc	Protospacer
.*  ** * ******************

4. spacer 1.1|2931278|27|NC_022221|PILER-CR matches to MK448825 (Streptococcus phage Javan639, complete genome) position: , mismatch: 5, identity: 0.815

gccgctggtcaaattcccaatctgagc	CRISPR spacer
acatcttgacaaattcccaatctgagc	Protospacer
.*  ** * ******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 781068 : 790239 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_2 857432 : 867939 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_3 1663965 : 1754262 98 Enterobacteria_phage(27.66%) lysis,integrase,terminase,tail,tRNA,portal,protease,holin attL 1730640:1730654|attR 1756031:1756045
DBSCAN-SWA_4 2057129 : 2064442 7 Ralstonia_phage(16.67%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage