1. spacer 1.1|339374|34|NC_022364|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 0, identity: 1.0
aggctcctttggggagagggagaaaagcggtgcg CRISPR spacer
aggctcctttggggagagggagaaaagcggtgcg Protospacer
**********************************
2. spacer 3.5|2962657|32|NC_022364|CRISPRCasFinder,CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 5, identity: 0.844
tgtttttctgccggtttaacacggtgcgataa CRISPR spacer
tgtttttctgccggattaacgcggtgcgagtg Protospacer
************** *****.******** .
3. spacer 3.15|2962658|32|NC_022364|PILER-CR matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 5, identity: 0.844
tgtttttctgccggtttaacacggtgcgataa CRISPR spacer
tgtttttctgccggattaacgcggtgcgagtg Protospacer
************** *****.******** .
4. spacer 2.1|2935827|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
aaaaccaaacttctccataaattccatagccg CRISPR spacer
attactaaacttctgcataaattccataggag Protospacer
* **.******** ************** *
5. spacer 2.2|2935888|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 6, identity: 0.812
acgcgcgtaccggatcgcggacaacaaattgc CRISPR spacer
gcgggcgtaccgcatcgcggacaacaagctga Protospacer
.** ******** **************..**
6. spacer 2.5|2936071|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NC_021529 (Vibrio phage nt-1, complete genome) position: , mismatch: 7, identity: 0.781
ggcaacataacgaacaaaatcaacgtcaacct CRISPR spacer
gtcaacataatgagcaaaatcaacgtctctgt Protospacer
* ********.**.************* . *
7. spacer 3.4|2962596|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aggagaacgtgatccgcaacgtcgaaggcgtt Protospacer
*.** .************* *********..
8. spacer 3.14|2962597|32|NC_022364|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aggagaacgtgatccgcaacgtcgaaggcgtt Protospacer
*.** .************* *********..
9. spacer 1.1|339374|34|NC_022364|CRISPRCasFinder matches to NZ_CP010866 (Marinovum algicola DG 898 plasmid pMaD11, complete sequence) position: , mismatch: 8, identity: 0.765
aggctcctttggggagagggagaaaagc-ggtgcg CRISPR spacer
gtccggctttgtggcgagggagaaaagcgggtgc- Protospacer
. * ***** ** ************* *****
10. spacer 2.2|2935888|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to MT889371 (Microbacterium phage DelaGarza, complete genome) position: , mismatch: 8, identity: 0.75
acgcgcgtaccggatcgcggacaacaaattgc CRISPR spacer
gcgcgcctaccggatcgcggacaaccgcacgg Protospacer
.***** ****************** . .*
11. spacer 2.4|2936010|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX893538 (Pseudomonas fluorescens strain PC20 plasmid pG20, complete sequence) position: , mismatch: 8, identity: 0.75
gctggttttgaatcgtcccgcgctcgagacgc CRISPR spacer
actggttttgaatcggccggcgctgtaatcgt Protospacer
.************** ** ***** *. **.
12. spacer 2.8|2936254|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX426227 (Acinetobacter lwoffii strain ED23-35 plasmid pALWED1.1, complete sequence) position: , mismatch: 8, identity: 0.75
ggttttacaagcttaaatgattttaaattttg CRISPR spacer
attattttaagttaaaatgattttaaattttt Protospacer
. * ** .***.* *****************
13. spacer 2.8|2936254|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033130 (Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA23_010062, complete sequence) position: , mismatch: 8, identity: 0.75
ggttttacaagcttaaatgattttaaattttg CRISPR spacer
attattttaagttaaaatgattttaaattttt Protospacer
. * ** .***.* *****************
14. spacer 2.8|2936254|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042557 (Acinetobacter baumannii strain E47 plasmid pE47_001, complete sequence) position: , mismatch: 8, identity: 0.75
ggttttacaagcttaaatgattttaaattttg CRISPR spacer
attattttaagttaaaatgattttaaattttt Protospacer
. * ** .***.* *****************
15. spacer 2.8|2936254|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010351 (Acinetobacter johnsonii XBB1 plasmid pXBB1-9, complete sequence) position: , mismatch: 8, identity: 0.75
ggttttacaagcttaaatgattttaaattttg CRISPR spacer
attattttaagttaaaatgattttaaattttt Protospacer
. * ** .***.* *****************
16. spacer 2.8|2936254|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048828 (Acinetobacter baumannii strain ABF9692 plasmid pABF9692, complete sequence) position: , mismatch: 8, identity: 0.75
ggttttacaagcttaaatgattttaaattttg CRISPR spacer
attattttaagttaaaatgattttaaattttt Protospacer
. * ** .***.* *****************
17. spacer 2.8|2936254|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032285 (Acinetobacter sp. WCHA55 plasmid pOXA58_010055, complete sequence) position: , mismatch: 8, identity: 0.75
ggttttacaagcttaaatgattttaaattttg CRISPR spacer
attattttaagttaaaatgattttaaattttt Protospacer
. * ** .***.* *****************
18. spacer 2.8|2936254|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042365 (Acinetobacter pittii strain C54 plasmid pC54_001, complete sequence) position: , mismatch: 8, identity: 0.75
ggttttacaagcttaaatgattttaaattttg CRISPR spacer
attattttaagttaaaatgattttaaattttt Protospacer
. * ** .***.* *****************
19. spacer 2.8|2936254|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK134375 (Acinetobacter baumannii strain 34AB plasmid p34AB, complete sequence) position: , mismatch: 8, identity: 0.75
ggttttacaagcttaaatgattttaaattttg CRISPR spacer
attattttaagttaaaatgattttaaattttt Protospacer
. * ** .***.* *****************
20. spacer 2.8|2936254|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038010 (Acinetobacter haemolyticus strain TJR01 plasmid pAHTJR1, complete sequence) position: , mismatch: 8, identity: 0.75
ggttttacaagcttaaatgattttaaattttg CRISPR spacer
attattttaagttaaaatgattttaaattttt Protospacer
. * ** .***.* *****************
21. spacer 2.8|2936254|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043053 (Acinetobacter pittii strain AP43 plasmid pAP43-OXA58-NDM1, complete sequence) position: , mismatch: 8, identity: 0.75
ggttttacaagcttaaatgattttaaattttg CRISPR spacer
attattttaagttaaaatgattttaaattttt Protospacer
. * ** .***.* *****************
22. spacer 2.8|2936254|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH220285 (Acinetobacter ursingii strain RIVM0002 plasmid pRIVM0002_IMP-4_171109_B03, complete sequence) position: , mismatch: 8, identity: 0.75
ggttttacaagcttaaatgattttaaattttg CRISPR spacer
attattttaagttaaaatgattttaaattttt Protospacer
. * ** .***.* *****************
23. spacer 2.8|2936254|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH220287 (Acinetobacter ursingii strain RIVM0061 plasmid pRIVM0061_IMP-4_171109_B01, complete sequence) position: , mismatch: 8, identity: 0.75
ggttttacaagcttaaatgattttaaattttg CRISPR spacer
attattttaagttaaaatgattttaaattttt Protospacer
. * ** .***.* *****************
24. spacer 2.8|2936254|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043309 (Acinetobacter johnsonii strain Acsw19 plasmid pAcsw19-2, complete sequence) position: , mismatch: 8, identity: 0.75
ggttttacaagcttaaatgattttaaattttg CRISPR spacer
attattttaagttaaaatgattttaaattttt Protospacer
. * ** .***.* *****************
25. spacer 2.8|2936254|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH220286 (Acinetobacter ursingii strain RIVM0051 plasmid pRIVM0051_IMP-4, complete sequence) position: , mismatch: 8, identity: 0.75
ggttttacaagcttaaatgattttaaattttg CRISPR spacer
attattttaagttaaaatgattttaaattttt Protospacer
. * ** .***.* *****************
26. spacer 2.13|2936559|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to MN693118 (Marine virus AFVG_25M91, complete genome) position: , mismatch: 8, identity: 0.75
taaagtagaataaaaatattcgcataacagac CRISPR spacer
aaatttagaataaaaatatccgcatatcaata Protospacer
** **************.****** **.
27. spacer 3.4|2962596|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.75
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
cggacgacgtgatcggcaaagtcgaccaggcg Protospacer
.************ ********** . .**
28. spacer 3.6|2962718|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 8, identity: 0.75
aaacgggaccagtgctgcgatagcctggaggg CRISPR spacer
cgtcaggaccggtgctgcgatagcctggccga Protospacer
. *.*****.***************** *.
29. spacer 3.8|2962840|32|NC_022364|CRISPRCasFinder,CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 8, identity: 0.75
tatccagt-acccgccagcgggtttactgacgg CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg Protospacer
*. *.. ************* **.*******
30. spacer 3.8|2962840|32|NC_022364|CRISPRCasFinder,CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 8, identity: 0.75
tatccagt-acccgccagcgggtttactgacgg CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg Protospacer
*. *.. ************* **.*******
31. spacer 3.8|2962840|32|NC_022364|CRISPRCasFinder,CRT matches to NC_019407 (Caulobacter phage CcrMagneto, complete genome) position: , mismatch: 8, identity: 0.75
tatccagt-acccgccagcgggtttactgacgg CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg Protospacer
*. *.. ************* **.*******
32. spacer 3.8|2962840|32|NC_022364|CRISPRCasFinder,CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.75
tatccagt-acccgccagcgggtttactgacgg CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg Protospacer
*. *.. ************* **.*******
33. spacer 3.8|2962840|32|NC_022364|CRISPRCasFinder,CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 8, identity: 0.75
tatccagt-acccgccagcgggtttactgacgg CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg Protospacer
*. *.. ************* **.*******
34. spacer 3.14|2962597|32|NC_022364|PILER-CR matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.75
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
cggacgacgtgatcggcaaagtcgaccaggcg Protospacer
.************ ********** . .**
35. spacer 3.16|2962719|32|NC_022364|PILER-CR matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 8, identity: 0.75
aaacgggaccagtgctgcgatagcctggaggg CRISPR spacer
cgtcaggaccggtgctgcgatagcctggccga Protospacer
. *.*****.***************** *.
36. spacer 3.18|2962841|32|NC_022364|PILER-CR matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 8, identity: 0.75
tatccagt-acccgccagcgggtttactgacgg CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg Protospacer
*. *.. ************* **.*******
37. spacer 3.18|2962841|32|NC_022364|PILER-CR matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 8, identity: 0.75
tatccagt-acccgccagcgggtttactgacgg CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg Protospacer
*. *.. ************* **.*******
38. spacer 3.18|2962841|32|NC_022364|PILER-CR matches to NC_019407 (Caulobacter phage CcrMagneto, complete genome) position: , mismatch: 8, identity: 0.75
tatccagt-acccgccagcgggtttactgacgg CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg Protospacer
*. *.. ************* **.*******
39. spacer 3.18|2962841|32|NC_022364|PILER-CR matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.75
tatccagt-acccgccagcgggtttactgacgg CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg Protospacer
*. *.. ************* **.*******
40. spacer 3.18|2962841|32|NC_022364|PILER-CR matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 8, identity: 0.75
tatccagt-acccgccagcgggtttactgacgg CRISPR spacer
-acgaaacgacccgccagcgggattgctgacgg Protospacer
*. *.. ************* **.*******
41. spacer 2.2|2935888|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 9, identity: 0.719
acgcgcgtaccggatcgcggacaacaaattgc------ CRISPR spacer
tcgcgcggaccggatcgcggccaa------gccccgcg Protospacer
****** ************ *** **
42. spacer 2.4|2936010|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggttttgaatcgtcccgcgctcgagacgc CRISPR spacer
actggttttgaatcggccggcgctgtgatcgt Protospacer
.************** ** ***** .. **.
43. spacer 2.4|2936010|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to CP027479 (Pseudomonas koreensis strain P19E3 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggttttgaatcgtcccgcgctcgagacgc CRISPR spacer
actggttttgaatcggccggcgctgtgatcgt Protospacer
.************** ** ***** .. **.
44. spacer 2.5|2936071|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015355 (Bacillus thuringiensis strain MYBT18246 plasmid p109822, complete sequence) position: , mismatch: 9, identity: 0.719
ggcaacataacgaacaaaatcaacgtcaacct CRISPR spacer
tgcaacagaaccaacaaaatcaacattatatc Protospacer
****** *** ************.*.* ..
45. spacer 2.12|2936498|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ccgtgtgacgctcagcggcagagagtaaaaac CRISPR spacer
acgtgtgaccctcagcggcaaagaggtgccaa Protospacer
******** **********.**** . *
46. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
47. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
48. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
49. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
50. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP032995 (Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
51. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
52. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
53. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_KX710093 (Leclercia adecarboxylata strain pP10164 plasmid pP10164-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
54. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_KY271405 (Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
55. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
56. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
57. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
58. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MN783747 (Klebsiella oxytoca plasmid pIron_OXY, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
59. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
60. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
61. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP050847 (Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
62. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
63. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
64. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
65. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
66. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
67. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP035548 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
68. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052485 (Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
69. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
70. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
71. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_KT347600 (Escherichia coli strain EC5207 plasmid pEC5207, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
72. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP042628 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-1_MCR3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
73. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
74. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
75. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
76. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
77. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
78. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
79. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP044528 (Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
80. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052163 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
81. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
82. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to KY486279 (Salmonella sp. strain SH-01 plasmid pSH-01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
83. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
84. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
85. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
86. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP019561 (Escherichia coli strain KSC1031 plasmid pMRGN1031, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
87. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
88. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
89. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP012256 (Cronobacter sakazakii strain NCTC 8155 plasmid pCS3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
90. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
91. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
92. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
93. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
94. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
95. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
96. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
97. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
98. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
99. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
100. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
101. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP044256 (Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
102. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
103. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP035215 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
104. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
105. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
106. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052159 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
107. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
108. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP040652 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 plasmid pSA20070548.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
109. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
110. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
111. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
112. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_014107 (Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
113. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
114. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
115. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052572 (Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
116. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
117. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
118. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
119. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
120. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
121. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
122. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
123. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
124. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP035636 (Enterobacter cloacae strain EN3600 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
125. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
126. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP053738 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
127. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP042507 (Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
128. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
129. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
130. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP019559 (Escherichia coli strain KSC207 plasmid pMRGN207, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
131. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP047092 (Salmonella sp. S13 plasmid pS13-3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
132. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
133. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to KX023259 (Escherichia coli plasmid pSCE516-4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
134. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026170 (Leclercia sp. LSNIH1 plasmid pLEC-000f, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
135. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP051431 (Escherichia sp. SCLE84 plasmid pSCLE1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
136. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
137. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052144 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
138. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
139. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
140. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_020261 (Cronobacter sakazakii SP291 plasmid pSP291-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
141. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
142. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP024882 (Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
143. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
144. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP021103 (Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
145. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP006642 (Escherichia coli PCN061 plasmid PCN061p6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
146. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP008789 (Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
147. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
148. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
149. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
150. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
151. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
152. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
153. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
154. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
155. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP012682 (Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33676_IncA/C, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
156. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
157. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
158. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
159. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
160. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
161. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP031547 (Escherichia coli strain cq9 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
162. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
163. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
164. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
165. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MK347229 (Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
166. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
167. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
168. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
169. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
170. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
171. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
172. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
173. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
174. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
175. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
176. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
177. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
178. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
179. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
180. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP042639 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
181. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
182. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP045662 (Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
183. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
184. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
185. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP044301 (Escherichia coli strain P59A plasmid pP59A-3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
186. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
187. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP025277 (Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60984 plasmid pSJO-60984, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
188. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP017182 (Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
189. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP013942 (Cronobacter malonaticus LMG 23826 plasmid pCMA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
190. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
191. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052357 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
192. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
193. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
194. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP041645 (Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
195. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
196. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
197. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP031569 (Enterobacter hormaechei strain 2013_1a plasmid pIncFIB-1301491, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
198. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
199. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
200. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
201. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
202. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052445 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
203. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
204. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
205. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP040894 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
206. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP035380 (Leclercia adecarboxylata strain R25 plasmid pLA-109, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
207. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
208. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
209. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MN310373 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
210. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MN310374 (Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
211. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
212. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MN310380 (Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
213. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
214. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
215. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MH909331 (Leclercia adecarboxylata plasmid p707804-NDM, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
216. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
217. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
218. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP034251 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
219. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP035916 (Salmonella enterica strain S61394 plasmid pLS61394-MCR, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
220. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP039577 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014856 plasmid p10-3857.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
221. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
222. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
223. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP018818 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
224. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
225. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
226. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
227. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
228. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP019019 (Escherichia coli strain Ecol_244 plasmid pEC244_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
229. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
230. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
231. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
232. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP042616 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
233. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
234. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
235. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
236. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP050011 (Citrobacter sp. Y3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
237. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
238. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052559 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
239. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052270 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
240. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
241. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
242. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP031284 (Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
243. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
244. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
245. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
246. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
247. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
248. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
249. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
250. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
251. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
252. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
253. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
254. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
255. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_008573 (Shewanella sp. ANA-3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
256. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
257. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052232 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
258. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP052873 (Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
259. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
260. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP040546 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
261. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP028792 (Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
262. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
263. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
264. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
265. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
266. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
267. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP046273 (Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
268. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
269. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP047460 (Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
270. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP047466 (Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
271. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
272. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052193 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
273. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
274. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_LT991959 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p2) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
275. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to LC511658 (Escherichia coli 2017.03.03CC plasmid p2017_03_03CC DNA, complete genome) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
276. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP029037 (Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
277. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
278. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP043854 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
279. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
280. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
281. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP039857 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014876 plasmid p15-0756.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
282. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
283. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
284. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
285. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP036191 (Klebsiella pneumoniae strain BA34918 plasmid pvirulence_VBA34918, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
286. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
287. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
288. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052561 (Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
289. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052209 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
290. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
291. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP022734 (Escherichia coli strain SA186 plasmid pSA186_5, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
292. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
293. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
294. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
295. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
296. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026185 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9a0d, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
297. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
298. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
299. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
300. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
301. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
302. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
303. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
304. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP043751 (Escherichia coli strain CVM N62675 plasmid pN62675, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
305. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
306. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
307. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
308. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
309. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP019214 (Escherichia coli strain WCHEC050613 plasmid pMCR_WCHEC050613, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
310. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
311. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
312. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
313. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP043545 (Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
314. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP012169 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
315. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
316. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
317. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP022149 (Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
318. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
319. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP036176 (Klebsiella huaxiensis strain WCHKl090001 plasmid p1_090001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
320. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
321. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052563 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
322. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
323. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
324. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP030003 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
325. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP030066 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
326. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
327. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
328. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
329. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
330. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
331. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
332. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
333. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
334. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP046940 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
335. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP006927 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
336. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
337. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
338. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
339. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP006663 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
340. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP009855 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
341. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP024144 (Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
342. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026390 (Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
343. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP008907 (Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-4bd, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
344. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP029143 (Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
345. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
346. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP030920 (Escherichia coli strain KL53 plasmid pKL53-L, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
347. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
348. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
349. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
350. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026058 (Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
351. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
352. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
353. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
354. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
355. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
356. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
357. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
358. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
359. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
360. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
361. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
362. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
363. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP010154 (Escherichia coli strain D9 plasmid B, complete genome) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
364. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
365. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
366. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
367. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
368. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
369. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP035906 (Klebsiella pneumoniae strain BA4656 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
370. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
371. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
372. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
373. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
374. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
375. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP024130 (Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
376. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP034416 (Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
377. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP011429 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 plasmid pYU39_IncA/C, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
378. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
379. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
380. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
381. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
382. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
383. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
384. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
385. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP032491 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
386. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP032495 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_118, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
387. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
388. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
389. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP050373 (Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
390. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
391. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
392. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
393. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
394. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_005211 (Serratia marcescens plasmid R478, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
395. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
396. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
397. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026661 (Salmonella enterica subsp. enterica strain 15-SA01028 plasmid pSE15-SA01028, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
398. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
399. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
400. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
401. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
402. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
403. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
404. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026151 (Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
405. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
406. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
407. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
408. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
409. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
410. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MF116002 (Uncultured bacterium plasmid pLGP4 clone J53, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
411. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
412. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP011641 (Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
413. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
414. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
415. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
416. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP047678 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVF1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
417. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP028181 (Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
418. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP032173 (Klebsiella pneumoniae strain AR_0160 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
419. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026166 (Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
420. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP031103 (Leclercia sp. W17 plasmid pW17-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
421. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
422. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
423. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
424. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_006671 (Escherichia coli A2363 plasmid pAPEC-O2-R, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
425. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
426. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP017991 (Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-1ac, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
427. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
428. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP042546 (Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
429. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
430. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP021856 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000001_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
431. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP024500 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
432. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
433. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP047676 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVL1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
434. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
435. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
436. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
437. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
438. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
439. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
440. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052304 (Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
441. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052370 (Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
442. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP051274 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Partridge_SW-37 plasmid pSW37-267109, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
443. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP033347 (Salmonella enterica subsp. enterica strain CFSA1096 plasmid pCFSA1096, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
444. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP011634 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
445. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
446. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP042541 (Enterobacter hormaechei strain C4 plasmid pC4_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
447. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP024508 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
448. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
449. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
450. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
451. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
452. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
453. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
454. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
455. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
456. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052214 (Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
457. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP051271 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Quail_SW-70 plasmid pSW37-267106, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
458. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
459. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
460. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
461. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
462. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052204 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
463. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
464. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
465. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
466. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
467. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP033743 (Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
468. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
469. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
470. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
471. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP011577 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
472. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
473. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_023025 (Cronobacter malonaticus plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
474. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP027161 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
475. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
476. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
477. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP033798 (Enterobacter roggenkampii strain FDAARGOS_523 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
478. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
479. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP035197 (Klebsiella pneumoniae strain LH375 plasmid pLH375_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
480. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP025009 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
481. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
482. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
483. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
484. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052237 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
485. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
486. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052178 (Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
487. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
488. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
489. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP047573 (Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
490. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
491. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
492. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
493. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP035209 (Klebsiella quasipneumoniae strain TH114 plasmid pTH114-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
494. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP024133 (Escherichia coli strain 14EC007 plasmid p14EC007b, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
495. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
496. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
497. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
498. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
499. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP041629 (Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
500. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
501. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
502. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
503. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
504. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP028543 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
505. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
506. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP032842 (Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
507. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP018338 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
508. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
509. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP024483 (Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
510. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP024484 (Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
511. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
512. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026851 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
513. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
514. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
515. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP054265 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
516. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP025340 (Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p220k, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
517. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
518. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
519. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP028781 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
520. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
521. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
522. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
523. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
524. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
525. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
526. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP050784 (Salmonella enterica subsp. enterica serovar Indiana strain SI67 plasmid pSI67-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
527. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
528. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052477 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
529. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
530. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
531. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
532. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP025006 (Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
533. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
534. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
535. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026716 (Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
536. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
537. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP054734 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
538. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
539. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MH884652 (Salmonella sp. strain Sa27 plasmid pSa27-CIP, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
540. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MH884653 (Salmonella sp. strain Sa27 plasmid pSa27-TC-CIP, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
541. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
542. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
543. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
544. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
545. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
546. spacer 3.3|2962535|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP026937 (Escherichia coli strain CFS3292 plasmid pCFS3292-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
547. spacer 3.4|2962596|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_KX015668 (Enterobacter cloacae strain CY01 plasmid pCY-CTX, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
548. spacer 3.4|2962596|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP033346 (Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN076210 plasmid pCFSAN076210, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
549. spacer 3.4|2962596|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP010386 (Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-121.660kb, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
550. spacer 3.4|2962596|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP030078 (Enterobacter hormaechei strain 20710 plasmid p4-20710, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
551. spacer 3.4|2962596|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP029247 (Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_F, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
552. spacer 3.4|2962596|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP048417 (Citrobacter freundii strain CitB plasmid pA_CitB, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
553. spacer 3.4|2962596|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP042573 (Enterobacter hormaechei strain E5 plasmid pE5_002, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
554. spacer 3.4|2962596|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP027605 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
555. spacer 3.4|2962596|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP051133 (Enterobacter hormaechei strain AMS-38 plasmid pAMS-38a, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
556. spacer 3.4|2962596|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP014995 (Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN001387 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
557. spacer 3.4|2962596|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP053193 (Enterobacter hormaechei strain EGYMCRVIM plasmid pMS-37c, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
558. spacer 3.4|2962596|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aagacggcgtgatccgcgaagtccggctcgct Protospacer
******.**********.***** .. *.*
559. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
560. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
561. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
562. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
563. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP032995 (Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
564. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
565. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
566. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_KX710093 (Leclercia adecarboxylata strain pP10164 plasmid pP10164-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
567. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_KY271405 (Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
568. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
569. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
570. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
571. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MN783747 (Klebsiella oxytoca plasmid pIron_OXY, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
572. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
573. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
574. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP050847 (Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
575. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
576. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
577. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
578. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
579. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
580. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP035548 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
581. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052485 (Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
582. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
583. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
584. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_KT347600 (Escherichia coli strain EC5207 plasmid pEC5207, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
585. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP042628 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-1_MCR3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
586. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
587. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
588. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
589. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
590. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
591. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
592. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP044528 (Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
593. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052163 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
594. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
595. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to KY486279 (Salmonella sp. strain SH-01 plasmid pSH-01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
596. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
597. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
598. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
599. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP019561 (Escherichia coli strain KSC1031 plasmid pMRGN1031, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
600. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
601. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
602. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP012256 (Cronobacter sakazakii strain NCTC 8155 plasmid pCS3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
603. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
604. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
605. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
606. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
607. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
608. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
609. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
610. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
611. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
612. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
613. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
614. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP044256 (Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
615. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
616. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP035215 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
617. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
618. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
619. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052159 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
620. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
621. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP040652 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 plasmid pSA20070548.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
622. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
623. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
624. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
625. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_014107 (Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
626. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
627. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
628. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052572 (Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
629. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
630. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
631. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
632. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
633. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
634. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
635. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
636. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
637. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP035636 (Enterobacter cloacae strain EN3600 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
638. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
639. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP053738 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
640. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP042507 (Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
641. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
642. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
643. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP019559 (Escherichia coli strain KSC207 plasmid pMRGN207, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
644. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP047092 (Salmonella sp. S13 plasmid pS13-3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
645. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
646. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to KX023259 (Escherichia coli plasmid pSCE516-4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
647. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026170 (Leclercia sp. LSNIH1 plasmid pLEC-000f, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
648. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP051431 (Escherichia sp. SCLE84 plasmid pSCLE1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
649. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
650. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052144 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
651. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
652. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
653. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_020261 (Cronobacter sakazakii SP291 plasmid pSP291-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
654. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
655. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP024882 (Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
656. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
657. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP021103 (Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
658. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP006642 (Escherichia coli PCN061 plasmid PCN061p6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
659. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP008789 (Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
660. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
661. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
662. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
663. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
664. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
665. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
666. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
667. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
668. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP012682 (Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33676_IncA/C, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
669. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
670. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
671. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
672. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
673. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
674. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP031547 (Escherichia coli strain cq9 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
675. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
676. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
677. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
678. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MK347229 (Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
679. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
680. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
681. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
682. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
683. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
684. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
685. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
686. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
687. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
688. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
689. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
690. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
691. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
692. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
693. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP042639 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
694. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
695. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP045662 (Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
696. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
697. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
698. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP044301 (Escherichia coli strain P59A plasmid pP59A-3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
699. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
700. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP025277 (Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60984 plasmid pSJO-60984, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
701. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP017182 (Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
702. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP013942 (Cronobacter malonaticus LMG 23826 plasmid pCMA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
703. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
704. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052357 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
705. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
706. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
707. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP041645 (Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
708. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
709. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
710. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP031569 (Enterobacter hormaechei strain 2013_1a plasmid pIncFIB-1301491, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
711. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
712. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
713. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
714. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
715. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052445 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
716. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
717. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
718. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP040894 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
719. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP035380 (Leclercia adecarboxylata strain R25 plasmid pLA-109, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
720. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
721. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
722. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MN310373 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
723. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MN310374 (Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
724. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
725. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MN310380 (Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
726. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
727. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
728. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MH909331 (Leclercia adecarboxylata plasmid p707804-NDM, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
729. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
730. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
731. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP034251 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
732. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP035916 (Salmonella enterica strain S61394 plasmid pLS61394-MCR, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
733. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP039577 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014856 plasmid p10-3857.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
734. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
735. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
736. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP018818 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
737. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
738. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
739. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
740. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
741. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP019019 (Escherichia coli strain Ecol_244 plasmid pEC244_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
742. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
743. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
744. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
745. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP042616 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
746. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
747. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
748. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
749. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP050011 (Citrobacter sp. Y3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
750. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
751. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052559 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
752. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052270 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
753. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
754. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
755. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP031284 (Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
756. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
757. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
758. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
759. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
760. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
761. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
762. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
763. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
764. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
765. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
766. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
767. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
768. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_008573 (Shewanella sp. ANA-3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
769. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
770. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052232 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
771. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP052873 (Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
772. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
773. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP040546 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
774. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP028792 (Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
775. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
776. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
777. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
778. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
779. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
780. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP046273 (Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
781. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
782. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP047460 (Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
783. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP047466 (Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
784. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
785. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052193 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
786. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
787. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_LT991959 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p2) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
788. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to LC511658 (Escherichia coli 2017.03.03CC plasmid p2017_03_03CC DNA, complete genome) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
789. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP029037 (Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
790. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
791. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP043854 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
792. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
793. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
794. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP039857 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014876 plasmid p15-0756.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
795. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
796. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
797. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
798. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP036191 (Klebsiella pneumoniae strain BA34918 plasmid pvirulence_VBA34918, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
799. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
800. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
801. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052561 (Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
802. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052209 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
803. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
804. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP022734 (Escherichia coli strain SA186 plasmid pSA186_5, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
805. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
806. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
807. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
808. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
809. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026185 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9a0d, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
810. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
811. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
812. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
813. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
814. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
815. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
816. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
817. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP043751 (Escherichia coli strain CVM N62675 plasmid pN62675, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
818. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
819. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
820. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
821. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
822. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP019214 (Escherichia coli strain WCHEC050613 plasmid pMCR_WCHEC050613, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
823. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
824. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
825. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
826. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP043545 (Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
827. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP012169 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
828. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
829. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
830. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP022149 (Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
831. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
832. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP036176 (Klebsiella huaxiensis strain WCHKl090001 plasmid p1_090001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
833. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
834. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052563 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
835. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
836. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
837. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP030003 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
838. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP030066 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
839. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
840. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
841. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
842. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
843. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
844. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
845. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
846. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
847. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP046940 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
848. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP006927 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
849. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
850. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
851. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
852. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP006663 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
853. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP009855 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
854. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP024144 (Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
855. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026390 (Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
856. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP008907 (Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-4bd, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
857. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP029143 (Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
858. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
859. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP030920 (Escherichia coli strain KL53 plasmid pKL53-L, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
860. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
861. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
862. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
863. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026058 (Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
864. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
865. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
866. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
867. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
868. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
869. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
870. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
871. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
872. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
873. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
874. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
875. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
876. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP010154 (Escherichia coli strain D9 plasmid B, complete genome) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
877. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
878. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
879. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
880. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
881. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
882. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP035906 (Klebsiella pneumoniae strain BA4656 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
883. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
884. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
885. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
886. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
887. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
888. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP024130 (Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
889. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP034416 (Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
890. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP011429 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 plasmid pYU39_IncA/C, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
891. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
892. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
893. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
894. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
895. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
896. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
897. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
898. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP032491 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
899. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP032495 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_118, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
900. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
901. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
902. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP050373 (Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
903. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
904. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
905. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
906. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
907. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_005211 (Serratia marcescens plasmid R478, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
908. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
909. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
910. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026661 (Salmonella enterica subsp. enterica strain 15-SA01028 plasmid pSE15-SA01028, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
911. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
912. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
913. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
914. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
915. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
916. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
917. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026151 (Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
918. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
919. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
920. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
921. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
922. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
923. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MF116002 (Uncultured bacterium plasmid pLGP4 clone J53, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
924. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
925. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP011641 (Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
926. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
927. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
928. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
929. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP047678 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVF1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
930. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP028181 (Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
931. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP032173 (Klebsiella pneumoniae strain AR_0160 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
932. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026166 (Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
933. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP031103 (Leclercia sp. W17 plasmid pW17-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
934. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
935. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
936. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
937. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_006671 (Escherichia coli A2363 plasmid pAPEC-O2-R, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
938. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
939. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP017991 (Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-1ac, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
940. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
941. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP042546 (Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
942. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
943. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP021856 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000001_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
944. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP024500 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
945. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
946. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP047676 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVL1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
947. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
948. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
949. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
950. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
951. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
952. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
953. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052304 (Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
954. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052370 (Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
955. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP051274 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Partridge_SW-37 plasmid pSW37-267109, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
956. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP033347 (Salmonella enterica subsp. enterica strain CFSA1096 plasmid pCFSA1096, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
957. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP011634 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
958. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
959. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP042541 (Enterobacter hormaechei strain C4 plasmid pC4_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
960. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP024508 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
961. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
962. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
963. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
964. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
965. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
966. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
967. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
968. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
969. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052214 (Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
970. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP051271 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Quail_SW-70 plasmid pSW37-267106, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
971. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
972. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
973. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
974. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
975. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052204 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
976. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
977. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
978. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
979. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
980. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP033743 (Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
981. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
982. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
983. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
984. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP011577 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
985. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
986. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_023025 (Cronobacter malonaticus plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
987. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP027161 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
988. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
989. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
990. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP033798 (Enterobacter roggenkampii strain FDAARGOS_523 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
991. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
992. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP035197 (Klebsiella pneumoniae strain LH375 plasmid pLH375_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
993. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP025009 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
994. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
995. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
996. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
997. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052237 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
998. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
999. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052178 (Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1000. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1001. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1002. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP047573 (Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1003. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1004. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1005. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1006. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP035209 (Klebsiella quasipneumoniae strain TH114 plasmid pTH114-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1007. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP024133 (Escherichia coli strain 14EC007 plasmid p14EC007b, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1008. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1009. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1010. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1011. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1012. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP041629 (Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1013. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1014. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1015. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1016. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1017. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP028543 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1018. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1019. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP032842 (Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1020. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP018338 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1021. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1022. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP024483 (Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1023. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP024484 (Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1024. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1025. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026851 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1026. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1027. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1028. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP054265 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1029. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP025340 (Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p220k, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1030. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1031. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1032. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP028781 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1033. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1034. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1035. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1036. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1037. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1038. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1039. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP050784 (Salmonella enterica subsp. enterica serovar Indiana strain SI67 plasmid pSI67-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1040. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1041. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052477 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1042. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1043. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1044. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1045. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP025006 (Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1046. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1047. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1048. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026716 (Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1049. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1050. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP054734 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1051. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1052. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MH884652 (Salmonella sp. strain Sa27 plasmid pSa27-CIP, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1053. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MH884653 (Salmonella sp. strain Sa27 plasmid pSa27-TC-CIP, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1054. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1055. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1056. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1057. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1058. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1059. spacer 3.13|2962536|32|NC_022364|PILER-CR matches to NZ_CP026937 (Escherichia coli strain CFS3292 plasmid pCFS3292-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1060. spacer 3.14|2962597|32|NC_022364|PILER-CR matches to NZ_KX015668 (Enterobacter cloacae strain CY01 plasmid pCY-CTX, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
1061. spacer 3.14|2962597|32|NC_022364|PILER-CR matches to NZ_CP033346 (Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN076210 plasmid pCFSAN076210, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
1062. spacer 3.14|2962597|32|NC_022364|PILER-CR matches to NZ_CP010386 (Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-121.660kb, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
1063. spacer 3.14|2962597|32|NC_022364|PILER-CR matches to NZ_CP030078 (Enterobacter hormaechei strain 20710 plasmid p4-20710, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
1064. spacer 3.14|2962597|32|NC_022364|PILER-CR matches to NZ_CP029247 (Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_F, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
1065. spacer 3.14|2962597|32|NC_022364|PILER-CR matches to NZ_CP048417 (Citrobacter freundii strain CitB plasmid pA_CitB, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
1066. spacer 3.14|2962597|32|NC_022364|PILER-CR matches to NZ_CP042573 (Enterobacter hormaechei strain E5 plasmid pE5_002, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
1067. spacer 3.14|2962597|32|NC_022364|PILER-CR matches to NZ_CP027605 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
1068. spacer 3.14|2962597|32|NC_022364|PILER-CR matches to NZ_CP051133 (Enterobacter hormaechei strain AMS-38 plasmid pAMS-38a, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
1069. spacer 3.14|2962597|32|NC_022364|PILER-CR matches to NZ_CP014995 (Salmonella enterica subsp. enterica serovar Tennessee strain CFSAN001387 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
1070. spacer 3.14|2962597|32|NC_022364|PILER-CR matches to NZ_CP053193 (Enterobacter hormaechei strain EGYMCRVIM plasmid pMS-37c, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aaaacgacgtgatccgcaatgtcgtcaaagcc Protospacer
**.**************** **** .. .*
1071. spacer 3.14|2962597|32|NC_022364|PILER-CR matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.719
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
aagacggcgtgatccgcgaagtccggctcgct Protospacer
******.**********.***** .. *.*
1072. spacer 2.8|2936254|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009059 (Borreliella afzelii K78 plasmid lp54, complete sequence) position: , mismatch: 10, identity: 0.688
ggttttacaagcttaaatgattttaaattttg CRISPR spacer
acctttagaagattaaatgattttaaaaaaat Protospacer
. .**** *** ***************
1073. spacer 2.9|2936315|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 10, identity: 0.688
tctttggtatgagtgacaaagagtttgacgcc CRISPR spacer
gttttggtatgagtgataaagagttctggaaa Protospacer
.**************.********. . .
1074. spacer 3.4|2962596|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 10, identity: 0.688
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
ggctcgacgtgatcggcaaaggcgaagacggc Protospacer
.. ********** ****** *****.*.
1075. spacer 3.14|2962597|32|NC_022364|PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 10, identity: 0.688
aagacgacgtgatccgcaaagtcgaaggcacg CRISPR spacer
ggctcgacgtgatcggcaaaggcgaagacggc Protospacer
.. ********** ****** *****.*.
1076. spacer 2.4|2936010|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014639 (Leptolyngbya boryana IAM M-101 plasmid pLBA) position: , mismatch: 11, identity: 0.656
gctggttttgaatcgtcccgcgctcgagacgc CRISPR spacer
caatgttttgactcgccccgcgctcgaagaag Protospacer
******* ***.***********.. .
1077. spacer 2.12|2936498|32|NC_022364|PILER-CR,CRISPRCasFinder,CRT matches to NC_047816 (Ralstonia phage RS-PI-1, complete genome) position: , mismatch: 11, identity: 0.656
ccgtgtgacgctcagcggcagagagtaaaaac CRISPR spacer
ccgtgcgacgctcagcggtagagcactgcctt Protospacer
*****.************.**** .. . .
1078. spacer 3.6|2962718|32|NC_022364|CRISPRCasFinder,CRT matches to NZ_CP029988 (Sphingomonas sp. FARSPH plasmid p03, complete sequence) position: , mismatch: 11, identity: 0.656
aaacgggaccagtgctgcgatagcctggaggg CRISPR spacer
tgcttcctccagtactgcgatcgcctggagga Protospacer
. . *****.******* *********.
1079. spacer 3.16|2962719|32|NC_022364|PILER-CR matches to NZ_CP029988 (Sphingomonas sp. FARSPH plasmid p03, complete sequence) position: , mismatch: 11, identity: 0.656
aaacgggaccagtgctgcgatagcctggaggg CRISPR spacer
tgcttcctccagtactgcgatcgcctggagga Protospacer
. . *****.******* *********.