Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_022583 Mesoplasma florum W37 chromosome 1, complete sequence 1 crisprs NA 0 2 0 0

Results visualization

1. NC_022583
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022583_1 667053-667402 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_022583_1 1.1|667103|25|NC_022583|PILER-CR 667103-667127 25 AP018277 Calothrix sp. NIES-4101 plasmid plasmid4 DNA, complete genome 104402-104426 3 0.88
NC_022583_1 1.3|667253|25|NC_022583|PILER-CR 667253-667277 25 NZ_CP009639 Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence 247243-247267 3 0.88
NC_022583_1 1.3|667253|25|NC_022583|PILER-CR 667253-667277 25 NZ_CP053963 Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence 6818-6842 3 0.88
NC_022583_1 1.3|667253|25|NC_022583|PILER-CR 667253-667277 25 MH355583 Enterococcus phage vB_EfaS_LM99, complete genome 33866-33890 5 0.8
NC_022583_1 1.3|667253|25|NC_022583|PILER-CR 667253-667277 25 MK721191 Enterococcus phage vB_EfaS_Ef5.4, complete genome 34857-34881 5 0.8
NC_022583_1 1.3|667253|25|NC_022583|PILER-CR 667253-667277 25 MK360024 Enterococcus phage vB_EfaS_Max, complete genome 35347-35371 5 0.8
NC_022583_1 1.3|667253|25|NC_022583|PILER-CR 667253-667277 25 CAJDJX010000002 Enterococcus phage Q69 genome assembly, contig: phageQ69-genome, whole genome shotgun sequence 37369-37393 5 0.8
NC_022583_1 1.3|667253|25|NC_022583|PILER-CR 667253-667277 25 CAJDKF010000002 Enterococcus phage vB_EfaS_159 genome assembly, contig: phage159-genome, whole genome shotgun sequence 37807-37831 5 0.8
NC_022583_1 1.3|667253|25|NC_022583|PILER-CR 667253-667277 25 JX193904 Enterococcus phage EfaCPT1, complete genome 33139-33163 5 0.8

1. spacer 1.1|667103|25|NC_022583|PILER-CR matches to AP018277 (Calothrix sp. NIES-4101 plasmid plasmid4 DNA, complete genome) position: , mismatch: 3, identity: 0.88

catgattaaaaatataggcaaatct	CRISPR spacer
cctgattaaaaatatagaaaaatct	Protospacer
* ***************. ******

2. spacer 1.3|667253|25|NC_022583|PILER-CR matches to NZ_CP009639 (Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence) position: , mismatch: 3, identity: 0.88

tgtgattaaacgcagaagcattcga	CRISPR spacer
ggtgattaaacgcaaaagcattgga	Protospacer
 *************.******* **

3. spacer 1.3|667253|25|NC_022583|PILER-CR matches to NZ_CP053963 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88

tgtgattaaacgcagaagcattcga	CRISPR spacer
ggtgattaaacgcaaaagcattgga	Protospacer
 *************.******* **

4. spacer 1.3|667253|25|NC_022583|PILER-CR matches to MH355583 (Enterococcus phage vB_EfaS_LM99, complete genome) position: , mismatch: 5, identity: 0.8

tgtgattaaacgcagaagcattcga	CRISPR spacer
atggattaaacgcagaagcattagc	Protospacer
   ******************* * 

5. spacer 1.3|667253|25|NC_022583|PILER-CR matches to MK721191 (Enterococcus phage vB_EfaS_Ef5.4, complete genome) position: , mismatch: 5, identity: 0.8

tgtgattaaacgcagaagcattcga	CRISPR spacer
atggattaaacgcagaagcattagc	Protospacer
   ******************* * 

6. spacer 1.3|667253|25|NC_022583|PILER-CR matches to MK360024 (Enterococcus phage vB_EfaS_Max, complete genome) position: , mismatch: 5, identity: 0.8

tgtgattaaacgcagaagcattcga	CRISPR spacer
atggattaaacgcagaagcattagc	Protospacer
   ******************* * 

7. spacer 1.3|667253|25|NC_022583|PILER-CR matches to CAJDJX010000002 (Enterococcus phage Q69 genome assembly, contig: phageQ69-genome, whole genome shotgun sequence) position: , mismatch: 5, identity: 0.8

tgtgattaaacgcagaagcattcga	CRISPR spacer
acggattaaacgcagaagcattagc	Protospacer
   ******************* * 

8. spacer 1.3|667253|25|NC_022583|PILER-CR matches to CAJDKF010000002 (Enterococcus phage vB_EfaS_159 genome assembly, contig: phage159-genome, whole genome shotgun sequence) position: , mismatch: 5, identity: 0.8

tgtgattaaacgcagaagcattcga	CRISPR spacer
acggattaaacgcagaagcattagc	Protospacer
   ******************* * 

9. spacer 1.3|667253|25|NC_022583|PILER-CR matches to JX193904 (Enterococcus phage EfaCPT1, complete genome) position: , mismatch: 5, identity: 0.8

tgtgattaaacgcagaagcattcga	CRISPR spacer
atggattaaacgcagaagcattagc	Protospacer
   ******************* * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage