Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP016357 Salmonella enterica subsp. enterica serovar Newport str. WA_14882 chromosome, complete genome 2 crisprs WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,DEDDh,cas14j,DinG,c2c9_V-U4 0 28 8 0

Results visualization

1. NZ_CP016357
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016357_1 941222-942408 TypeI-E I-E
19 spacers
cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016357_2 959077-960630 TypeI-E I-E
25 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP016357_2 2.25|960569|33|NZ_CP016357|PILER-CR 960569-960601 33 NC_004313 Salmonella phage ST64B, complete genome 31960-31992 1 0.97
NZ_CP016357_2 2.25|960569|33|NZ_CP016357|PILER-CR 960569-960601 33 KU927493 Salmonella phage 118970_sal3, complete genome 69572-69604 1 0.97
NZ_CP016357_2 2.25|960569|33|NZ_CP016357|PILER-CR 960569-960601 33 AY055382 Salmonella typhimurium phage ST64B complete sequence 31960-31992 1 0.97
NZ_CP016357_2 2.50|960570|32|NZ_CP016357|CRISPRCasFinder,CRT 960570-960601 32 NC_004313 Salmonella phage ST64B, complete genome 31961-31992 1 0.969
NZ_CP016357_2 2.50|960570|32|NZ_CP016357|CRISPRCasFinder,CRT 960570-960601 32 KU927493 Salmonella phage 118970_sal3, complete genome 69573-69604 1 0.969
NZ_CP016357_2 2.50|960570|32|NZ_CP016357|CRISPRCasFinder,CRT 960570-960601 32 AY055382 Salmonella typhimurium phage ST64B complete sequence 31961-31992 1 0.969
NZ_CP016357_1 1.20|942348|31|NZ_CP016357|CRT 942348-942378 31 NZ_CP044082 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence 90793-90823 4 0.871
NZ_CP016357_1 1.20|942348|31|NZ_CP016357|CRT 942348-942378 31 NZ_CP024424 Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence 112052-112082 4 0.871
NZ_CP016357_1 1.20|942348|31|NZ_CP016357|CRT 942348-942378 31 NZ_CP020440 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence 224971-225001 4 0.871
NZ_CP016357_1 1.13|941983|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 941983-942014 32 MG592428 Vibrio phage 1.046.O._10N.286.52.E3, partial genome 57601-57632 5 0.844
NZ_CP016357_1 1.19|942348|32|NZ_CP016357|CRISPRCasFinder 942348-942379 32 NZ_CP024424 Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence 112052-112083 5 0.844
NZ_CP016357_1 1.19|942348|32|NZ_CP016357|CRISPRCasFinder 942348-942379 32 NZ_CP020440 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence 224971-225002 5 0.844
NZ_CP016357_1 1.19|942348|32|NZ_CP016357|CRISPRCasFinder 942348-942379 32 NZ_CP044082 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence 90792-90823 5 0.844
NZ_CP016357_1 1.20|942348|31|NZ_CP016357|CRT 942348-942378 31 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 271401-271431 5 0.839
NZ_CP016357_2 2.35|959655|32|NZ_CP016357|CRISPRCasFinder,CRT 959655-959686 32 MK448237 Klebsiella phage ST974-OXA48phi18.2, complete genome 10331-10362 5 0.844
NZ_CP016357_1 1.11|941861|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 941861-941892 32 MK448383 Streptococcus satellite phage Javan248, complete genome 4976-5007 6 0.812
NZ_CP016357_1 1.13|941983|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 941983-942014 32 MG592476 Vibrio phage 1.104.O._10N.286.49.A12, partial genome 53397-53428 6 0.812
NZ_CP016357_1 1.13|941983|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 941983-942014 32 MG592538 Vibrio phage 1.171.O._10N.261.52.F12, partial genome 52151-52182 6 0.812
NZ_CP016357_1 1.18|942288|31|NZ_CP016357|CRISPRCasFinder,CRT 942288-942318 31 AP014010 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C97-MedDCM-OCT-S27-C11, *** SEQUENCING IN PROGRESS *** 33568-33598 6 0.806
NZ_CP016357_1 1.19|942348|32|NZ_CP016357|CRISPRCasFinder 942348-942379 32 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 271400-271431 6 0.812
NZ_CP016357_2 2.10|959654|33|NZ_CP016357|PILER-CR 959654-959686 33 MK448237 Klebsiella phage ST974-OXA48phi18.2, complete genome 10331-10363 6 0.818
NZ_CP016357_2 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT 959411-959442 32 MH319741 Marine virus AG-345-E15 Ga0172270_11 genomic sequence 30961-30992 6 0.812
NZ_CP016357_2 2.35|959655|32|NZ_CP016357|CRISPRCasFinder,CRT 959655-959686 32 MK448230 Klebsiella phage ST16-OXA48phi5.2, complete genome 5451-5482 6 0.812
NZ_CP016357_1 1.2|941312|32|NZ_CP016357|CRISPRCasFinder,CRT 941312-941343 32 NZ_CP024891 Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence 51303-51334 7 0.781
NZ_CP016357_1 1.13|941983|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 941983-942014 32 MG592417 Vibrio phage 1.033.O._10N.222.49.B8, partial genome 52046-52077 7 0.781
NZ_CP016357_1 1.15|942105|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 942105-942136 32 NZ_CP016366 Phaeobacter porticola strain P97 plasmid pP97_b, complete sequence 126588-126619 7 0.781
NZ_CP016357_1 1.15|942105|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 942105-942136 32 NZ_CP010602 Phaeobacter inhibens strain P83 plasmid pP83_c, complete sequence 115384-115415 7 0.781
NZ_CP016357_1 1.15|942105|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 942105-942136 32 NZ_CP010769 Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence 133543-133574 7 0.781
NZ_CP016357_1 1.15|942105|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 942105-942136 32 NZ_CP010708 Phaeobacter inhibens strain P66 plasmid pP66_c, complete sequence 115381-115412 7 0.781
NZ_CP016357_1 1.15|942105|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 942105-942136 32 NZ_CP010737 Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence 183735-183766 7 0.781
NZ_CP016357_1 1.19|942348|32|NZ_CP016357|CRISPRCasFinder 942348-942379 32 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 343727-343758 7 0.781
NZ_CP016357_1 1.19|942348|32|NZ_CP016357|CRISPRCasFinder 942348-942379 32 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 654402-654433 7 0.781
NZ_CP016357_1 1.20|942348|31|NZ_CP016357|CRT 942348-942378 31 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 2052296-2052326 7 0.774
NZ_CP016357_1 1.20|942348|31|NZ_CP016357|CRT 942348-942378 31 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 343728-343758 7 0.774
NZ_CP016357_1 1.21|942288|32|NZ_CP016357|PILER-CR 942288-942319 32 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 4747-4778 7 0.781
NZ_CP016357_1 1.21|942288|32|NZ_CP016357|PILER-CR 942288-942319 32 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 389262-389293 7 0.781
NZ_CP016357_1 1.21|942288|32|NZ_CP016357|PILER-CR 942288-942319 32 AP014010 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C97-MedDCM-OCT-S27-C11, *** SEQUENCING IN PROGRESS *** 33568-33599 7 0.781
NZ_CP016357_2 2.6|959410|33|NZ_CP016357|PILER-CR 959410-959442 33 MH319741 Marine virus AG-345-E15 Ga0172270_11 genomic sequence 30961-30993 7 0.788
NZ_CP016357_2 2.10|959654|33|NZ_CP016357|PILER-CR 959654-959686 33 MK448230 Klebsiella phage ST16-OXA48phi5.2, complete genome 5451-5483 7 0.788
NZ_CP016357_2 2.20|960264|33|NZ_CP016357|PILER-CR 960264-960296 33 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 304163-304195 7 0.788
NZ_CP016357_2 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT 959411-959442 32 NZ_CP045273 Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence 294630-294661 7 0.781
NZ_CP016357_2 2.45|960265|32|NZ_CP016357|CRISPRCasFinder,CRT 960265-960296 32 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 304164-304195 7 0.781
NZ_CP016357_2 2.45|960265|32|NZ_CP016357|CRISPRCasFinder,CRT 960265-960296 32 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 194506-194537 7 0.781
NZ_CP016357_1 1.8|941678|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 941678-941709 32 CP047389 Agrobacterium sp. CGMCC 11546 plasmid pA 272606-272637 8 0.75
NZ_CP016357_1 1.13|941983|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 941983-942014 32 KC206276 Escherichia phage EC1-UPM, complete genome 16171-16202 8 0.75
NZ_CP016357_1 1.15|942105|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 942105-942136 32 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 276525-276556 8 0.75
NZ_CP016357_1 1.15|942105|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 942105-942136 32 AY639599 Bacteriophage TP Ogr (ogr) and putative protease genes, complete cds 1396-1427 8 0.75
NZ_CP016357_1 1.16|942166|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 942166-942197 32 NC_019364 Sulfitobacter guttiformis plasmid pSD118, complete sequence 10703-10734 8 0.75
NZ_CP016357_1 1.19|942348|32|NZ_CP016357|CRISPRCasFinder 942348-942379 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 2052295-2052326 8 0.75
NZ_CP016357_1 1.20|942348|31|NZ_CP016357|CRT 942348-942378 31 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 654402-654432 8 0.742
NZ_CP016357_2 2.5|959349|33|NZ_CP016357|PILER-CR 959349-959381 33 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1888410-1888442 8 0.758
NZ_CP016357_2 2.5|959349|33|NZ_CP016357|PILER-CR 959349-959381 33 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1888408-1888440 8 0.758
NZ_CP016357_2 2.6|959410|33|NZ_CP016357|PILER-CR 959410-959442 33 NZ_CP045273 Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence 294630-294662 8 0.758
NZ_CP016357_2 2.20|960264|33|NZ_CP016357|PILER-CR 960264-960296 33 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 194506-194538 8 0.758
NZ_CP016357_2 2.45|960265|32|NZ_CP016357|CRISPRCasFinder,CRT 960265-960296 32 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 1756038-1756069 8 0.75
NZ_CP016357_2 2.45|960265|32|NZ_CP016357|CRISPRCasFinder,CRT 960265-960296 32 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 1879010-1879041 8 0.75
NZ_CP016357_1 1.11|941861|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 941861-941892 32 MK250029 Prevotella phage Lak-C1, complete genome 220147-220178 9 0.719
NZ_CP016357_1 1.11|941861|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 941861-941892 32 MK250016 Prevotella phage Lak-A1, complete genome 256365-256396 9 0.719
NZ_CP016357_1 1.11|941861|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 941861-941892 32 MK250019 Prevotella phage Lak-A2, complete genome 177499-177530 9 0.719
NZ_CP016357_1 1.13|941983|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 941983-942014 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3375065-3375096 9 0.719
NZ_CP016357_1 1.18|942288|31|NZ_CP016357|CRISPRCasFinder,CRT 942288-942318 31 NZ_CP053971 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence 72031-72061 9 0.71
NZ_CP016357_1 1.18|942288|31|NZ_CP016357|CRISPRCasFinder,CRT 942288-942318 31 NZ_CP013278 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence 3414-3444 9 0.71
NZ_CP016357_1 1.18|942288|31|NZ_CP016357|CRISPRCasFinder,CRT 942288-942318 31 NC_018509 Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence 232723-232753 9 0.71
NZ_CP016357_1 1.18|942288|31|NZ_CP016357|CRISPRCasFinder,CRT 942288-942318 31 NZ_CP039724 Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence 129890-129920 9 0.71
NZ_CP016357_1 1.18|942288|31|NZ_CP016357|CRISPRCasFinder,CRT 942288-942318 31 NZ_CP051859 Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence 109942-109972 9 0.71
NZ_CP016357_1 1.18|942288|31|NZ_CP016357|CRISPRCasFinder,CRT 942288-942318 31 NZ_CP009347 Bacillus thuringiensis HD1002 plasmid 3, complete sequence 148698-148728 9 0.71
NZ_CP016357_1 1.18|942288|31|NZ_CP016357|CRISPRCasFinder,CRT 942288-942318 31 NZ_CP045025 Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence 3414-3444 9 0.71
NZ_CP016357_2 2.2|959166|33|NZ_CP016357|PILER-CR 959166-959198 33 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 616323-616355 9 0.727
NZ_CP016357_2 2.20|960264|33|NZ_CP016357|PILER-CR 960264-960296 33 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 1756037-1756069 9 0.727
NZ_CP016357_2 2.20|960264|33|NZ_CP016357|PILER-CR 960264-960296 33 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 1879010-1879042 9 0.727
NZ_CP016357_2 2.26|959106|32|NZ_CP016357|CRISPRCasFinder,CRT 959106-959137 32 NZ_CP047227 Moraxella osloensis strain YV1 plasmid p1, complete sequence 115808-115839 9 0.719
NZ_CP016357_2 2.27|959167|32|NZ_CP016357|CRISPRCasFinder,CRT 959167-959198 32 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 616323-616354 9 0.719
NZ_CP016357_2 2.27|959167|32|NZ_CP016357|CRISPRCasFinder,CRT 959167-959198 32 NC_024369 Vibrio phage X29, complete genome 16391-16422 9 0.719
NZ_CP016357_2 2.27|959167|32|NZ_CP016357|CRISPRCasFinder,CRT 959167-959198 32 MK575466 Vibrio phage Rostov 7, complete genome 37606-37637 9 0.719
NZ_CP016357_2 2.27|959167|32|NZ_CP016357|CRISPRCasFinder,CRT 959167-959198 32 KJ545483 Vibrio phage phi 2, complete genome 16391-16422 9 0.719
NZ_CP016357_2 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT 959411-959442 32 MN693555 Marine virus AFVG_25M96, complete genome 8842-8873 9 0.719
NZ_CP016357_2 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT 959411-959442 32 MN693550 Marine virus AFVG_25M93, complete genome 10730-10761 9 0.719
NZ_CP016357_2 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT 959411-959442 32 MN693245 Marine virus AFVG_25M69, complete genome 11115-11146 9 0.719
NZ_CP016357_2 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT 959411-959442 32 MN693208 Marine virus AFVG_25M383, complete genome 25882-25913 9 0.719
NZ_CP016357_2 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT 959411-959442 32 MN693436 Marine virus AFVG_25M57, complete genome 28024-28055 9 0.719
NZ_CP016357_2 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT 959411-959442 32 MN693515 Marine virus AFVG_25M70, complete genome 10467-10498 9 0.719
NZ_CP016357_2 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT 959411-959442 32 MN693320 Marine virus AFVG_25M58, complete genome 28018-28049 9 0.719
NZ_CP016357_2 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT 959411-959442 32 MN693286 Marine virus AFVG_25M92, complete genome 9636-9667 9 0.719
NZ_CP016357_2 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT 959411-959442 32 MN693549 Marine virus AFVG_25M89, complete genome 11533-11564 9 0.719
NZ_CP016357_2 2.37|959777|32|NZ_CP016357|CRISPRCasFinder,CRT 959777-959808 32 NZ_CP013139 Pseudoalteromonas sp. Bsw20308 plasmid pPBSW1, complete sequence 213856-213887 9 0.719
NZ_CP016357_2 2.43|960143|32|NZ_CP016357|CRISPRCasFinder,CRT 960143-960174 32 NZ_CP054046 Yersinia massiliensis strain 2011N-4075 plasmid unnamed1, complete sequence 90958-90989 9 0.719
NZ_CP016357_2 2.50|960570|32|NZ_CP016357|CRISPRCasFinder,CRT 960570-960601 32 NZ_CP015221 Rhodococcus sp. PBTS 2 plasmid unnamed1, complete sequence 111308-111339 9 0.719
NZ_CP016357_1 1.6|941556|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 941556-941587 32 MG945729 UNVERIFIED: Microviridae sp. isolate 2292-1801, complete genome 1763-1794 10 0.688
NZ_CP016357_1 1.13|941983|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 941983-942014 32 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 429215-429246 10 0.688
NZ_CP016357_1 1.16|942166|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 942166-942197 32 AP022645 Bacillus wiedmannii PL1 plasmid pBwiPL1-2 DNA, complete sequence 62931-62962 10 0.688
NZ_CP016357_1 1.17|942227|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 942227-942258 32 NZ_CP024657 Bacillus cereus strain MLY1 plasmid pMLY1.1, complete sequence 129540-129571 10 0.688
NZ_CP016357_1 1.17|942227|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 942227-942258 32 NZ_CP015354 Bacillus thuringiensis strain MYBT18246 plasmid p120416, complete sequence 111984-112015 10 0.688
NZ_CP016357_1 1.17|942227|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 942227-942258 32 NC_047948 Staphylococcus phage phiSA_BS2, complete genome 46996-47027 10 0.688
NZ_CP016357_1 1.17|942227|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR 942227-942258 32 MH078572 Staphylococcus phage phiSA_BS1, complete genome 1850-1881 10 0.688
NZ_CP016357_1 1.18|942288|31|NZ_CP016357|CRISPRCasFinder,CRT 942288-942318 31 NC_011246 Borrelia recurrentis A1 plasmid pl124, complete sequence 78356-78386 10 0.677
NZ_CP016357_1 1.21|942288|32|NZ_CP016357|PILER-CR 942288-942319 32 NC_011246 Borrelia recurrentis A1 plasmid pl124, complete sequence 78355-78386 10 0.688
NZ_CP016357_1 1.21|942288|32|NZ_CP016357|PILER-CR 942288-942319 32 NZ_CP053971 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence 72031-72062 10 0.688
NZ_CP016357_1 1.21|942288|32|NZ_CP016357|PILER-CR 942288-942319 32 NZ_CP013278 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence 3413-3444 10 0.688
NZ_CP016357_1 1.21|942288|32|NZ_CP016357|PILER-CR 942288-942319 32 NC_018509 Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence 232722-232753 10 0.688
NZ_CP016357_1 1.21|942288|32|NZ_CP016357|PILER-CR 942288-942319 32 NZ_CP039724 Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence 129890-129921 10 0.688
NZ_CP016357_1 1.21|942288|32|NZ_CP016357|PILER-CR 942288-942319 32 NZ_CP051859 Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence 109941-109972 10 0.688
NZ_CP016357_1 1.21|942288|32|NZ_CP016357|PILER-CR 942288-942319 32 NZ_CP009347 Bacillus thuringiensis HD1002 plasmid 3, complete sequence 148697-148728 10 0.688
NZ_CP016357_1 1.21|942288|32|NZ_CP016357|PILER-CR 942288-942319 32 NZ_CP045025 Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence 3413-3444 10 0.688
NZ_CP016357_2 2.2|959166|33|NZ_CP016357|PILER-CR 959166-959198 33 NC_024369 Vibrio phage X29, complete genome 16391-16423 10 0.697
NZ_CP016357_2 2.2|959166|33|NZ_CP016357|PILER-CR 959166-959198 33 MK575466 Vibrio phage Rostov 7, complete genome 37606-37638 10 0.697
NZ_CP016357_2 2.2|959166|33|NZ_CP016357|PILER-CR 959166-959198 33 KJ545483 Vibrio phage phi 2, complete genome 16391-16423 10 0.697
NZ_CP016357_2 2.30|959350|32|NZ_CP016357|CRISPRCasFinder,CRT 959350-959381 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1888410-1888441 10 0.688
NZ_CP016357_2 2.30|959350|32|NZ_CP016357|CRISPRCasFinder,CRT 959350-959381 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1888408-1888439 10 0.688
NZ_CP016357_2 2.36|959716|32|NZ_CP016357|CRISPRCasFinder,CRT 959716-959747 32 MK047641 Phage NV21, complete genome 23610-23641 10 0.688
NZ_CP016357_2 2.45|960265|32|NZ_CP016357|CRISPRCasFinder,CRT 960265-960296 32 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 91874-91905 10 0.688

1. spacer 2.25|960569|33|NZ_CP016357|PILER-CR matches to NC_004313 (Salmonella phage ST64B, complete genome) position: , mismatch: 1, identity: 0.97

gtaagttacgccagtgcgggcgtgttgctcatc	CRISPR spacer
gtaagttacgccagtgcaggcgtgttgctcatc	Protospacer
*****************.***************

2. spacer 2.25|960569|33|NZ_CP016357|PILER-CR matches to KU927493 (Salmonella phage 118970_sal3, complete genome) position: , mismatch: 1, identity: 0.97

gtaagttacgccagtgcgggcgtgttgctcatc	CRISPR spacer
gtaagttacgccagtgcaggcgtgttgctcatc	Protospacer
*****************.***************

3. spacer 2.25|960569|33|NZ_CP016357|PILER-CR matches to AY055382 (Salmonella typhimurium phage ST64B complete sequence) position: , mismatch: 1, identity: 0.97

gtaagttacgccagtgcgggcgtgttgctcatc	CRISPR spacer
gtaagttacgccagtgcaggcgtgttgctcatc	Protospacer
*****************.***************

4. spacer 2.50|960570|32|NZ_CP016357|CRISPRCasFinder,CRT matches to NC_004313 (Salmonella phage ST64B, complete genome) position: , mismatch: 1, identity: 0.969

taagttacgccagtgcgggcgtgttgctcatc	CRISPR spacer
taagttacgccagtgcaggcgtgttgctcatc	Protospacer
****************.***************

5. spacer 2.50|960570|32|NZ_CP016357|CRISPRCasFinder,CRT matches to KU927493 (Salmonella phage 118970_sal3, complete genome) position: , mismatch: 1, identity: 0.969

taagttacgccagtgcgggcgtgttgctcatc	CRISPR spacer
taagttacgccagtgcaggcgtgttgctcatc	Protospacer
****************.***************

6. spacer 2.50|960570|32|NZ_CP016357|CRISPRCasFinder,CRT matches to AY055382 (Salmonella typhimurium phage ST64B complete sequence) position: , mismatch: 1, identity: 0.969

taagttacgccagtgcgggcgtgttgctcatc	CRISPR spacer
taagttacgccagtgcaggcgtgttgctcatc	Protospacer
****************.***************

7. spacer 1.20|942348|31|NZ_CP016357|CRT matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.871

gggatcgcgctggcggtcgcatccgttgccg-	CRISPR spacer
gagatcgcgctggcggcctcatccg-tgccgc	Protospacer
*.**************.* ****** ***** 

8. spacer 1.20|942348|31|NZ_CP016357|CRT matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 4, identity: 0.871

gggatcgcgctggcggtcgcatccgttgccg-	CRISPR spacer
gagatcgcgctggcggcctcatccg-tgccgc	Protospacer
*.**************.* ****** ***** 

9. spacer 1.20|942348|31|NZ_CP016357|CRT matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.871

gggatcgcgctggcggtcgcatccgttgccg-	CRISPR spacer
gagatcgcgctggcggcctcatccg-tgccgc	Protospacer
*.**************.* ****** ***** 

10. spacer 1.13|941983|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to MG592428 (Vibrio phage 1.046.O._10N.286.52.E3, partial genome) position: , mismatch: 5, identity: 0.844

ggcgcccgcgtttctcggctcggcgcaatatc	CRISPR spacer
tcttcccccgtttctcggctcggcgcaatatc	Protospacer
  . *** ************************

11. spacer 1.19|942348|32|NZ_CP016357|CRISPRCasFinder matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 5, identity: 0.844

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
gagatcgcgctggcggcctcatccg-tgccgca	Protospacer
*.**************.* ****** *****. 

12. spacer 1.19|942348|32|NZ_CP016357|CRISPRCasFinder matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
gagatcgcgctggcggcctcatccg-tgccgca	Protospacer
*.**************.* ****** *****. 

13. spacer 1.19|942348|32|NZ_CP016357|CRISPRCasFinder matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.844

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
gagatcgcgctggcggcctcatccg-tgccgca	Protospacer
*.**************.* ****** *****. 

14. spacer 1.20|942348|31|NZ_CP016357|CRT matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 5, identity: 0.839

gggatcgcgctggcggtcgcatccgttgccg-	CRISPR spacer
cagatcgcgctggcggcctcatccg-tgccgc	Protospacer
 .**************.* ****** ***** 

15. spacer 2.35|959655|32|NZ_CP016357|CRISPRCasFinder,CRT matches to MK448237 (Klebsiella phage ST974-OXA48phi18.2, complete genome) position: , mismatch: 5, identity: 0.844

cctggcgatcgcatttgggtgcgggaaacatt	CRISPR spacer
ccaggcgatcgcatctgggtgcgggaggcctt	Protospacer
** ***********.***********..* **

16. spacer 1.11|941861|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to MK448383 (Streptococcus satellite phage Javan248, complete genome) position: , mismatch: 6, identity: 0.812

taaaaatcttctttcatataaccgtaagggtt	CRISPR spacer
tgaaaatcttctttcatagaaacgtatgtatt	Protospacer
*.**************** ** **** * .**

17. spacer 1.13|941983|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to MG592476 (Vibrio phage 1.104.O._10N.286.49.A12, partial genome) position: , mismatch: 6, identity: 0.812

ggcgcccgcgtttctcggctcggcgcaatatc	CRISPR spacer
tcttgcctcgtttctcggctcggcgcaatatc	Protospacer
  .  ** ************************

18. spacer 1.13|941983|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to MG592538 (Vibrio phage 1.171.O._10N.261.52.F12, partial genome) position: , mismatch: 6, identity: 0.812

ggcgcccgcgtttctcggctcggcgcaatatc	CRISPR spacer
tcttcccccgtttctcggctcggcgcagtatc	Protospacer
  . *** *******************.****

19. spacer 1.18|942288|31|NZ_CP016357|CRISPRCasFinder,CRT matches to AP014010 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C97-MedDCM-OCT-S27-C11, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.806

agcacaatcattattagatgaactt--tcatca	CRISPR spacer
aacacaagaattattagatgaacttggtgat--	Protospacer
*.*****  ****************  * **  

20. spacer 1.19|942348|32|NZ_CP016357|CRISPRCasFinder matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 6, identity: 0.812

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
cagatcgcgctggcggcctcatccg-tgccgca	Protospacer
 .**************.* ****** *****. 

21. spacer 2.10|959654|33|NZ_CP016357|PILER-CR matches to MK448237 (Klebsiella phage ST974-OXA48phi18.2, complete genome) position: , mismatch: 6, identity: 0.818

gcctggcgatcgcatttgggtgcgggaaacatt	CRISPR spacer
accaggcgatcgcatctgggtgcgggaggcctt	Protospacer
.** ***********.***********..* **

22. spacer 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT matches to MH319741 (Marine virus AG-345-E15 Ga0172270_11 genomic sequence) position: , mismatch: 6, identity: 0.812

ggaataaaaatgaatttgagtcaact-ctataa	CRISPR spacer
ataataaaaaagtatttgagtcaactgatata-	Protospacer
. ******** * *************  **** 

23. spacer 2.35|959655|32|NZ_CP016357|CRISPRCasFinder,CRT matches to MK448230 (Klebsiella phage ST16-OXA48phi5.2, complete genome) position: , mismatch: 6, identity: 0.812

cctggcgatcgcatttgggtgcgggaaacatt	CRISPR spacer
gtcggcgatcgcatctgggtgcgtgaaacatg	Protospacer
 ..***********.******** ******* 

24. spacer 1.2|941312|32|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 7, identity: 0.781

cagtgcggcagcgcgcaatcgagacacgccat	CRISPR spacer
cggtgcgacagcgagcaatcgagacgggctct	Protospacer
*.*****.***** ***********. **. *

25. spacer 1.13|941983|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to MG592417 (Vibrio phage 1.033.O._10N.222.49.B8, partial genome) position: , mismatch: 7, identity: 0.781

ggcgcccgcgtttctcggctcggcgcaatatc	CRISPR spacer
tcttgccccgtttctcggctcggcgcagtatc	Protospacer
  .  ** *******************.****

26. spacer 1.15|942105|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016366 (Phaeobacter porticola strain P97 plasmid pP97_b, complete sequence) position: , mismatch: 7, identity: 0.781

gtgcaacagtttcttaccgcaagcagtttgaa	CRISPR spacer
tggcaacagattcttaccgaaagcagataaaa	Protospacer
  ******* ********* ****** * .**

27. spacer 1.15|942105|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010602 (Phaeobacter inhibens strain P83 plasmid pP83_c, complete sequence) position: , mismatch: 7, identity: 0.781

gtgcaacagtttcttaccgcaagcagtttgaa	CRISPR spacer
tggcaacagattcttaccacaagcaggcagaa	Protospacer
  ******* ********.******* . ***

28. spacer 1.15|942105|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010769 (Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence) position: , mismatch: 7, identity: 0.781

gtgcaacagtttcttaccgcaagcagtttgaa	CRISPR spacer
tggcaacagattcttaccacaagcaggcagaa	Protospacer
  ******* ********.******* . ***

29. spacer 1.15|942105|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010708 (Phaeobacter inhibens strain P66 plasmid pP66_c, complete sequence) position: , mismatch: 7, identity: 0.781

gtgcaacagtttcttaccgcaagcagtttgaa	CRISPR spacer
tggcaacagattcttaccacaagcaggcagaa	Protospacer
  ******* ********.******* . ***

30. spacer 1.15|942105|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010737 (Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence) position: , mismatch: 7, identity: 0.781

gtgcaacagtttcttaccgcaagcagtttgaa	CRISPR spacer
tggcaacagattcttaccacaagcaggcagaa	Protospacer
  ******* ********.******* . ***

31. spacer 1.19|942348|32|NZ_CP016357|CRISPRCasFinder matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 7, identity: 0.781

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
gggatcgcggtggcggtcgc-ttcgaggaagtt	Protospacer
********* ********** *.**  *  ** 

32. spacer 1.19|942348|32|NZ_CP016357|CRISPRCasFinder matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 7, identity: 0.781

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
cggctcgcgctggcggtcgcttcc-tcggcgcg	Protospacer
 ** **************** *** *.* **. 

33. spacer 1.20|942348|31|NZ_CP016357|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.774

gggatcgcgctggcggtcgcatccgttgccg	CRISPR spacer
cggctcgcgctcgcggtcgcatcctcggccc	Protospacer
 ** ******* ************ . *** 

34. spacer 1.20|942348|31|NZ_CP016357|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 7, identity: 0.774

gggatcgcgctggcggtcgcatccgttgccg-	CRISPR spacer
gggatcgcggtggcggtcgc-ttcgaggaagt	Protospacer
********* ********** *.**  *  * 

35. spacer 1.21|942288|32|NZ_CP016357|PILER-CR matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 7, identity: 0.781

agcac-aatcattattagatgaactttcatcaa	CRISPR spacer
-ttacgaaagatttttagatgaacttgcatcaa	Protospacer
  .** **  *** ************ ******

36. spacer 1.21|942288|32|NZ_CP016357|PILER-CR matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 7, identity: 0.781

agcac-aatcattattagatgaactttcatcaa	CRISPR spacer
-ttacgaaagatttttagatgaacttgcatcaa	Protospacer
  .** **  *** ************ ******

37. spacer 1.21|942288|32|NZ_CP016357|PILER-CR matches to AP014010 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C97-MedDCM-OCT-S27-C11, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.781

agcacaatcattattagatgaactt--tcatcaa	CRISPR spacer
aacacaagaattattagatgaacttggtgatg--	Protospacer
*.*****  ****************  * **   

38. spacer 2.6|959410|33|NZ_CP016357|PILER-CR matches to MH319741 (Marine virus AG-345-E15 Ga0172270_11 genomic sequence) position: , mismatch: 7, identity: 0.788

gggaataaaaatgaatttgagtcaact-ctataa	CRISPR spacer
tataataaaaaagtatttgagtcaactgatata-	Protospacer
 . ******** * *************  **** 

39. spacer 2.10|959654|33|NZ_CP016357|PILER-CR matches to MK448230 (Klebsiella phage ST16-OXA48phi5.2, complete genome) position: , mismatch: 7, identity: 0.788

gcctggcgatcgcatttgggtgcgggaaacatt	CRISPR spacer
cgtcggcgatcgcatctgggtgcgtgaaacatg	Protospacer
  ..***********.******** ******* 

40. spacer 2.20|960264|33|NZ_CP016357|PILER-CR matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 7, identity: 0.788

ggcgatgtatgccgcgacgatcgagagcgaact	CRISPR spacer
ggcgatgtatgccgcgacgattgaatccacgct	Protospacer
*********************.**.  *. .**

41. spacer 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP045273 (Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence) position: , mismatch: 7, identity: 0.781

ggaataaaaatgaatttgagtcaactctataa	CRISPR spacer
tgtataaaaatgaatttgaggtaactccctac	Protospacer
 * ***************** .*****. ** 

42. spacer 2.45|960265|32|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 7, identity: 0.781

gcgatgtatgccgcgacgatcgagagcgaact	CRISPR spacer
gcgatgtatgccgcgacgattgaatccacgct	Protospacer
********************.**.  *. .**

43. spacer 2.45|960265|32|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 7, identity: 0.781

gcgatgtatgccgcgacgatcgagagcgaact	CRISPR spacer
accattcatgccgcgacgaacaagagcgaaca	Protospacer
.* ** .************ *.********* 

44. spacer 1.8|941678|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to CP047389 (Agrobacterium sp. CGMCC 11546 plasmid pA) position: , mismatch: 8, identity: 0.75

caataggacagccattcgagcgcccagagttt	CRISPR spacer
tcacaggacagctattcgagcgcccagtccgt	Protospacer
. *.********.**************  . *

45. spacer 1.13|941983|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to KC206276 (Escherichia phage EC1-UPM, complete genome) position: , mismatch: 8, identity: 0.75

ggcgcccgcgtttctcggctcggcgcaatatc	CRISPR spacer
ttagacagcgtttctcggctaggagcaatagc	Protospacer
   * * ************* ** ****** *

46. spacer 1.15|942105|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

gtgcaacagtttcttaccgcaagcagtttgaa	CRISPR spacer
ttgcaacagtttctttccgcatgcagctgctt	Protospacer
 ************** ***** ****.*    

47. spacer 1.15|942105|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to AY639599 (Bacteriophage TP Ogr (ogr) and putative protease genes, complete cds) position: , mismatch: 8, identity: 0.75

gtgcaacagtttcttaccgcaagcagtttgaa	CRISPR spacer
gttattcagtttctgaccgccagcagtttgtt	Protospacer
**    ******** ***** *********  

48. spacer 1.16|942166|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to NC_019364 (Sulfitobacter guttiformis plasmid pSD118, complete sequence) position: , mismatch: 8, identity: 0.75

atcatcgggattcattttgttgt--ccgggtggc	CRISPR spacer
gtcatcgtgatgcattttgttgtcccctaatg--	Protospacer
.****** *** ***********  ** ..**  

49. spacer 1.19|942348|32|NZ_CP016357|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.75

gggatcgcgctggcggtcgcatccgttgccgt	CRISPR spacer
cggctcgcgctcgcggtcgcatcctcggcccg	Protospacer
 ** ******* ************ . ***  

50. spacer 1.20|942348|31|NZ_CP016357|CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 8, identity: 0.742

gggatcgcgctggcggtcgcatccgttgccg	CRISPR spacer
cggctcgcgctggcggtcgcttcctcggcgc	Protospacer
 ** **************** *** . **  

51. spacer 2.5|959349|33|NZ_CP016357|PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gcgc-ggggctggtattcgatacagacccggcta	CRISPR spacer
-cgctcgggctggtattcgattccgacccgcgcc	Protospacer
 ***  *************** * ******  . 

52. spacer 2.5|959349|33|NZ_CP016357|PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

gcgc-ggggctggtattcgatacagacccggcta	CRISPR spacer
-cgctcgggctggtattcgattccgacccgcgcc	Protospacer
 ***  *************** * ******  . 

53. spacer 2.6|959410|33|NZ_CP016357|PILER-CR matches to NZ_CP045273 (Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence) position: , mismatch: 8, identity: 0.758

gggaataaaaatgaatttgagtcaactctataa	CRISPR spacer
ttgtataaaaatgaatttgaggtaactccctac	Protospacer
  * ***************** .*****. ** 

54. spacer 2.20|960264|33|NZ_CP016357|PILER-CR matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 8, identity: 0.758

ggcgatgtatgccgcgacgatcgagagcgaact	CRISPR spacer
caccattcatgccgcgacgaacaagagcgaaca	Protospacer
 .* ** .************ *.********* 

55. spacer 2.45|960265|32|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgatgtatgccgcgacgatcgagagcgaact	CRISPR spacer
gaaccttatgccacgacgatcgagaacgaaca	Protospacer
* . . ******.************.***** 

56. spacer 2.45|960265|32|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgatgtatgccgcgacgatcgagagcgaact	CRISPR spacer
gaaccttatgccacgacgatcgagaacgaaca	Protospacer
* . . ******.************.***** 

57. spacer 1.11|941861|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 9, identity: 0.719

taaaaatcttctttcatataaccgtaagggtt	CRISPR spacer
gtattatcttctttcacataacggtaagcaat	Protospacer
  *  ***********.***** ***** . *

58. spacer 1.11|941861|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to MK250016 (Prevotella phage Lak-A1, complete genome) position: , mismatch: 9, identity: 0.719

taaaaatcttctttcatataaccgtaagggtt	CRISPR spacer
gtattatcttctttcacataacggtaagcaat	Protospacer
  *  ***********.***** ***** . *

59. spacer 1.11|941861|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to MK250019 (Prevotella phage Lak-A2, complete genome) position: , mismatch: 9, identity: 0.719

taaaaatcttctttcatataaccgtaagggtt	CRISPR spacer
gtattatcttctttcacataacggtaagcaat	Protospacer
  *  ***********.***** ***** . *

60. spacer 1.13|941983|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

ggcgcccgcgtttctcggctcggcgcaatatc	CRISPR spacer
cacgcccgagcttctcggctcggcgcggggtg	Protospacer
 .****** *.***************.. .* 

61. spacer 1.18|942288|31|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP053971 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

agcacaatcattattagatgaactttcatca	CRISPR spacer
ccaacatgcattattagatgaacttttcttt	Protospacer
   ***  ******************. *. 

62. spacer 1.18|942288|31|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP013278 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence) position: , mismatch: 9, identity: 0.71

agcacaatcattattagatgaactttcatca	CRISPR spacer
ccaacatgcattattagatgaacttttcttt	Protospacer
   ***  ******************. *. 

63. spacer 1.18|942288|31|NZ_CP016357|CRISPRCasFinder,CRT matches to NC_018509 (Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence) position: , mismatch: 9, identity: 0.71

agcacaatcattattagatgaactttcatca	CRISPR spacer
ccaacatgcattattagatgaacttttcttt	Protospacer
   ***  ******************. *. 

64. spacer 1.18|942288|31|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP039724 (Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71

agcacaatcattattagatgaactttcatca	CRISPR spacer
ccaacatgcattattagatgaacttttcttt	Protospacer
   ***  ******************. *. 

65. spacer 1.18|942288|31|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP051859 (Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence) position: , mismatch: 9, identity: 0.71

agcacaatcattattagatgaactttcatca	CRISPR spacer
ccaacatgcattattagatgaacttttcttt	Protospacer
   ***  ******************. *. 

66. spacer 1.18|942288|31|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP009347 (Bacillus thuringiensis HD1002 plasmid 3, complete sequence) position: , mismatch: 9, identity: 0.71

agcacaatcattattagatgaactttcatca	CRISPR spacer
ccaacatgcattattagatgaacttttcttt	Protospacer
   ***  ******************. *. 

67. spacer 1.18|942288|31|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP045025 (Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71

agcacaatcattattagatgaactttcatca	CRISPR spacer
ccaacatgcattattagatgaacttttcttt	Protospacer
   ***  ******************. *. 

68. spacer 2.2|959166|33|NZ_CP016357|PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.727

gtgggcgcccggattgtttgcgtgcggcgacgg	CRISPR spacer
gccattggtcggattgtttgcgtgcggggccgg	Protospacer
*. . .* .****************** * ***

69. spacer 2.20|960264|33|NZ_CP016357|PILER-CR matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 9, identity: 0.727

ggcgatgtatgccgcgacgatcgagagcgaact	CRISPR spacer
tgaaccttatgccacgacgatcgagaacgaaca	Protospacer
 * . . ******.************.***** 

70. spacer 2.20|960264|33|NZ_CP016357|PILER-CR matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 9, identity: 0.727

ggcgatgtatgccgcgacgatcgagagcgaact	CRISPR spacer
tgaaccttatgccacgacgatcgagaacgaaca	Protospacer
 * . . ******.************.***** 

71. spacer 2.26|959106|32|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP047227 (Moraxella osloensis strain YV1 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

ctggaacggcagtatttaaaaggggttattga	CRISPR spacer
cgtaaacggcagtaattaaaagcggtttgcaa	Protospacer
*  .********** ******* ****  ..*

72. spacer 2.27|959167|32|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.719

tgggcgcccggattgtttgcgtgcggcgacgg	CRISPR spacer
ccattggtcggattgtttgcgtgcggggccgg	Protospacer
. . .* .****************** * ***

73. spacer 2.27|959167|32|NZ_CP016357|CRISPRCasFinder,CRT matches to NC_024369 (Vibrio phage X29, complete genome) position: , mismatch: 9, identity: 0.719

tgggcgcccggattgtttgcgtgcggcgacgg	CRISPR spacer
cccaagcccggcttttttgcgtgcggcgaatg	Protospacer
.  . ****** ** **************  *

74. spacer 2.27|959167|32|NZ_CP016357|CRISPRCasFinder,CRT matches to MK575466 (Vibrio phage Rostov 7, complete genome) position: , mismatch: 9, identity: 0.719

tgggcgcccggattgtttgcgtgcggcgacgg	CRISPR spacer
cccaagcccggcttttttgcgtgcggcgaatg	Protospacer
.  . ****** ** **************  *

75. spacer 2.27|959167|32|NZ_CP016357|CRISPRCasFinder,CRT matches to KJ545483 (Vibrio phage phi 2, complete genome) position: , mismatch: 9, identity: 0.719

tgggcgcccggattgtttgcgtgcggcgacgg	CRISPR spacer
cccaagcccggcttttttgcgtgcggcgaatg	Protospacer
.  . ****** ** **************  *

76. spacer 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT matches to MN693555 (Marine virus AFVG_25M96, complete genome) position: , mismatch: 9, identity: 0.719

ggaataaaaatgaatttgagtcaactctataa	CRISPR spacer
ttctaataaatgaaattgattcaactctatga	Protospacer
     * ******* **** **********.*

77. spacer 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT matches to MN693550 (Marine virus AFVG_25M93, complete genome) position: , mismatch: 9, identity: 0.719

ggaataaaaatgaatttgagtcaactctataa	CRISPR spacer
ttctaataaatgaaattgattcaactctatga	Protospacer
     * ******* **** **********.*

78. spacer 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT matches to MN693245 (Marine virus AFVG_25M69, complete genome) position: , mismatch: 9, identity: 0.719

ggaataaaaatgaatttgagtcaactctataa	CRISPR spacer
ttctaataaatgaaattgattcaactctatga	Protospacer
     * ******* **** **********.*

79. spacer 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT matches to MN693208 (Marine virus AFVG_25M383, complete genome) position: , mismatch: 9, identity: 0.719

ggaataaaaatgaatttgagtcaactctataa	CRISPR spacer
ttttaataaatgaaattgattcaactctatga	Protospacer
     * ******* **** **********.*

80. spacer 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT matches to MN693436 (Marine virus AFVG_25M57, complete genome) position: , mismatch: 9, identity: 0.719

ggaataaaaatgaatttgagtcaactctataa	CRISPR spacer
ttctaataaatgaaattgattcaactctatga	Protospacer
     * ******* **** **********.*

81. spacer 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT matches to MN693515 (Marine virus AFVG_25M70, complete genome) position: , mismatch: 9, identity: 0.719

ggaataaaaatgaatttgagtcaactctataa	CRISPR spacer
ttctaataaatgaaattgattcaactctatga	Protospacer
     * ******* **** **********.*

82. spacer 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT matches to MN693320 (Marine virus AFVG_25M58, complete genome) position: , mismatch: 9, identity: 0.719

ggaataaaaatgaatttgagtcaactctataa	CRISPR spacer
ttttaataaatgaaattgattcaactctatga	Protospacer
     * ******* **** **********.*

83. spacer 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT matches to MN693286 (Marine virus AFVG_25M92, complete genome) position: , mismatch: 9, identity: 0.719

ggaataaaaatgaatttgagtcaactctataa	CRISPR spacer
ttctaataaatgaaattgattcaactctatga	Protospacer
     * ******* **** **********.*

84. spacer 2.31|959411|32|NZ_CP016357|CRISPRCasFinder,CRT matches to MN693549 (Marine virus AFVG_25M89, complete genome) position: , mismatch: 9, identity: 0.719

ggaataaaaatgaatttgagtcaactctataa	CRISPR spacer
ttttaataaatgaaattgattcaactctatga	Protospacer
     * ******* **** **********.*

85. spacer 2.37|959777|32|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP013139 (Pseudoalteromonas sp. Bsw20308 plasmid pPBSW1, complete sequence) position: , mismatch: 9, identity: 0.719

gactcggcctgttttttgattttgacaatcag	CRISPR spacer
ccgtcggcctgttctttcattttgacttacac	Protospacer
   **********.*** ********   ** 

86. spacer 2.43|960143|32|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP054046 (Yersinia massiliensis strain 2011N-4075 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ccaataaccgaaatatccacggtggaaatttc	CRISPR spacer
ctttttacaggaatatccacggtggaaatagt	Protospacer
*.  * ** *.******************  .

87. spacer 2.50|960570|32|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP015221 (Rhodococcus sp. PBTS 2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

taagttac---gccagtgcgggcgtgttgctcatc	CRISPR spacer
---actgcgcggcgagtgcgggcgcgttgctcatg	Protospacer
   ..*.*   ** **********.********* 

88. spacer 1.6|941556|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to MG945729 (UNVERIFIED: Microviridae sp. isolate 2292-1801, complete genome) position: , mismatch: 10, identity: 0.688

aaaataacaacattatcagtgtgaaaagtctc	CRISPR spacer
gcaataacaaccttatcagtgtcaactttaat	Protospacer
. ********* ********** **   *  .

89. spacer 1.13|941983|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 10, identity: 0.688

ggcgcccgcgtttctcggctcggcgcaatatc	CRISPR spacer
ggcgcccgcgttactcgcctcgggatcgtcaa	Protospacer
************ **** ***** .. .*   

90. spacer 1.16|942166|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to AP022645 (Bacillus wiedmannii PL1 plasmid pBwiPL1-2 DNA, complete sequence) position: , mismatch: 10, identity: 0.688

atcatcgggattcattttgttgtccgggtggc	CRISPR spacer
attatcaggattcattttgttgtattcatcaa	Protospacer
**.***.**************** .  .* . 

91. spacer 1.17|942227|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024657 (Bacillus cereus strain MLY1 plasmid pMLY1.1, complete sequence) position: , mismatch: 10, identity: 0.688

cggtgctctatgtctaaaaataaaagcggttc	CRISPR spacer
tgcatttctatgtcgaaaaataaaaacggcag	Protospacer
.*   .******** **********.***.  

92. spacer 1.17|942227|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015354 (Bacillus thuringiensis strain MYBT18246 plasmid p120416, complete sequence) position: , mismatch: 10, identity: 0.688

cggtgctctatgtctaaaaataaaagcggttc	CRISPR spacer
tgcatttctatgtcgaaaaataaaaacggcag	Protospacer
.*   .******** **********.***.  

93. spacer 1.17|942227|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to NC_047948 (Staphylococcus phage phiSA_BS2, complete genome) position: , mismatch: 10, identity: 0.688

cggtgctctatgtctaaaaataaaagcggttc	CRISPR spacer
tagatacctatgtctaaaaatgaaaggggtat	Protospacer
..*   .**************.**** *** .

94. spacer 1.17|942227|32|NZ_CP016357|CRISPRCasFinder,CRT,PILER-CR matches to MH078572 (Staphylococcus phage phiSA_BS1, complete genome) position: , mismatch: 10, identity: 0.688

cggtgctctatgtctaaaaataaaagcggttc	CRISPR spacer
tagatacctatgtctaaaaatgaaaggggtat	Protospacer
..*   .**************.**** *** .

95. spacer 1.18|942288|31|NZ_CP016357|CRISPRCasFinder,CRT matches to NC_011246 (Borrelia recurrentis A1 plasmid pl124, complete sequence) position: , mismatch: 10, identity: 0.677

agcacaatcattattagatgaactttcatca	CRISPR spacer
tcttatggcattattagatgaattttcaaca	Protospacer
  .   . **************.***** **

96. spacer 1.21|942288|32|NZ_CP016357|PILER-CR matches to NC_011246 (Borrelia recurrentis A1 plasmid pl124, complete sequence) position: , mismatch: 10, identity: 0.688

agcacaatcattattagatgaactttcatcaa	CRISPR spacer
tcttatggcattattagatgaattttcaacaa	Protospacer
  .   . **************.***** ***

97. spacer 1.21|942288|32|NZ_CP016357|PILER-CR matches to NZ_CP053971 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

agcacaatcattattagatgaactttcatcaa	CRISPR spacer
ccaacatgcattattagatgaacttttctttt	Protospacer
   ***  ******************. *.  

98. spacer 1.21|942288|32|NZ_CP016357|PILER-CR matches to NZ_CP013278 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence) position: , mismatch: 10, identity: 0.688

agcacaatcattattagatgaactttcatcaa	CRISPR spacer
ccaacatgcattattagatgaacttttctttt	Protospacer
   ***  ******************. *.  

99. spacer 1.21|942288|32|NZ_CP016357|PILER-CR matches to NC_018509 (Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence) position: , mismatch: 10, identity: 0.688

agcacaatcattattagatgaactttcatcaa	CRISPR spacer
ccaacatgcattattagatgaacttttctttt	Protospacer
   ***  ******************. *.  

100. spacer 1.21|942288|32|NZ_CP016357|PILER-CR matches to NZ_CP039724 (Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688

agcacaatcattattagatgaactttcatcaa	CRISPR spacer
ccaacatgcattattagatgaacttttctttt	Protospacer
   ***  ******************. *.  

101. spacer 1.21|942288|32|NZ_CP016357|PILER-CR matches to NZ_CP051859 (Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence) position: , mismatch: 10, identity: 0.688

agcacaatcattattagatgaactttcatcaa	CRISPR spacer
ccaacatgcattattagatgaacttttctttt	Protospacer
   ***  ******************. *.  

102. spacer 1.21|942288|32|NZ_CP016357|PILER-CR matches to NZ_CP009347 (Bacillus thuringiensis HD1002 plasmid 3, complete sequence) position: , mismatch: 10, identity: 0.688

agcacaatcattattagatgaactttcatcaa	CRISPR spacer
ccaacatgcattattagatgaacttttctttt	Protospacer
   ***  ******************. *.  

103. spacer 1.21|942288|32|NZ_CP016357|PILER-CR matches to NZ_CP045025 (Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688

agcacaatcattattagatgaactttcatcaa	CRISPR spacer
ccaacatgcattattagatgaacttttctttt	Protospacer
   ***  ******************. *.  

104. spacer 2.2|959166|33|NZ_CP016357|PILER-CR matches to NC_024369 (Vibrio phage X29, complete genome) position: , mismatch: 10, identity: 0.697

gtgggcgcccggattgtttgcgtgcggcgacgg	CRISPR spacer
tcccaagcccggcttttttgcgtgcggcgaatg	Protospacer
 .  . ****** ** **************  *

105. spacer 2.2|959166|33|NZ_CP016357|PILER-CR matches to MK575466 (Vibrio phage Rostov 7, complete genome) position: , mismatch: 10, identity: 0.697

gtgggcgcccggattgtttgcgtgcggcgacgg	CRISPR spacer
tcccaagcccggcttttttgcgtgcggcgaatg	Protospacer
 .  . ****** ** **************  *

106. spacer 2.2|959166|33|NZ_CP016357|PILER-CR matches to KJ545483 (Vibrio phage phi 2, complete genome) position: , mismatch: 10, identity: 0.697

gtgggcgcccggattgtttgcgtgcggcgacgg	CRISPR spacer
tcccaagcccggcttttttgcgtgcggcgaatg	Protospacer
 .  . ****** ** **************  *

107. spacer 2.30|959350|32|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cgcggggctggtattcgatacagacccggcta	CRISPR spacer
gctcgggctggtattcgattccgacccgcgcc	Protospacer
  . *************** * ******  . 

108. spacer 2.30|959350|32|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cgcggggctggtattcgatacagacccggcta	CRISPR spacer
gctcgggctggtattcgattccgacccgcgcc	Protospacer
  . *************** * ******  . 

109. spacer 2.36|959716|32|NZ_CP016357|CRISPRCasFinder,CRT matches to MK047641 (Phage NV21, complete genome) position: , mismatch: 10, identity: 0.688

ccgaatatggtgataatgttgcaccttcgctc	CRISPR spacer
ctacttatggtgataatgtttcaccgtcttgg	Protospacer
*..  *************** **** ** .  

110. spacer 2.45|960265|32|NZ_CP016357|CRISPRCasFinder,CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 10, identity: 0.688

gcgatgtatgccgcgacgatcgagagcgaact	CRISPR spacer
tttgtccatgccgcgacgatcgataccgaaaa	Protospacer
 . .* .**************** * ****  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1126940 : 1135877 11 Enterobacteria_phage(83.33%) integrase attL 1129470:1129484|attR 1148209:1148223
DBSCAN-SWA_2 1661926 : 1671097 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_3 1739187 : 1749694 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_4 1846225 : 1853476 8 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_5 1956151 : 2044862 96 Enterobacteria_phage(32.69%) integrase,transposase,terminase,head,protease,portal,tail,holin,lysis,capsid attL 1958361:1958383|attR 2019923:2019945
DBSCAN-SWA_6 2804716 : 2845113 40 Escherichia_phage(23.08%) tail,plate,protease NA
DBSCAN-SWA_7 2855126 : 2881689 33 Salmonella_phage(70.97%) holin,lysis,terminase NA
DBSCAN-SWA_8 4302934 : 4347710 47 Burkholderia_phage(40.91%) tail,plate,holin,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage