Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_022660 Campylobacter coli 15-537360, complete genome 0 crisprs DEDDh,cas14j,csa3 0 0 2 0
NC_022656 Campylobacter coli 15-537360 plasmid pCC42yr, complete sequence 1 crisprs NA 0 1 0 0

Results visualization

1. NC_022656
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022656_1 2554-2662 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_022656_1 1.1|2581|55|NC_022656|CRISPRCasFinder 2581-2635 55 NZ_CP017876 Campylobacter coli strain ZV1224 plasmid pCCDM224S, complete sequence 10967-11021 0 1.0
NC_022656_1 1.1|2581|55|NC_022656|CRISPRCasFinder 2581-2635 55 NZ_CP040242 Campylobacter coli strain S9 plasmid pCcS9_3, complete sequence 11797-11851 0 1.0
NC_022656_1 1.1|2581|55|NC_022656|CRISPRCasFinder 2581-2635 55 NC_022656 Campylobacter coli 15-537360 plasmid pCC42yr, complete sequence 2581-2635 0 1.0
NC_022656_1 1.1|2581|55|NC_022656|CRISPRCasFinder 2581-2635 55 NZ_CP011016 Campylobacter coli strain FB1 plasmid pCC42, complete sequence 12284-12338 1 0.982
NC_022656_1 1.1|2581|55|NC_022656|CRISPRCasFinder 2581-2635 55 CP013736 Campylobacter coli strain OR12 plasmid pOR12CC42, complete sequence 18107-18161 1 0.982

1. spacer 1.1|2581|55|NC_022656|CRISPRCasFinder matches to NZ_CP017876 (Campylobacter coli strain ZV1224 plasmid pCCDM224S, complete sequence) position: , mismatch: 0, identity: 1.0

taaacattcaaatgttaaaaatgtatcatattttgagacaaaagcaaaaaatcta	CRISPR spacer
taaacattcaaatgttaaaaatgtatcatattttgagacaaaagcaaaaaatcta	Protospacer
*******************************************************

2. spacer 1.1|2581|55|NC_022656|CRISPRCasFinder matches to NZ_CP040242 (Campylobacter coli strain S9 plasmid pCcS9_3, complete sequence) position: , mismatch: 0, identity: 1.0

taaacattcaaatgttaaaaatgtatcatattttgagacaaaagcaaaaaatcta	CRISPR spacer
taaacattcaaatgttaaaaatgtatcatattttgagacaaaagcaaaaaatcta	Protospacer
*******************************************************

3. spacer 1.1|2581|55|NC_022656|CRISPRCasFinder matches to NC_022656 (Campylobacter coli 15-537360 plasmid pCC42yr, complete sequence) position: , mismatch: 0, identity: 1.0

taaacattcaaatgttaaaaatgtatcatattttgagacaaaagcaaaaaatcta	CRISPR spacer
taaacattcaaatgttaaaaatgtatcatattttgagacaaaagcaaaaaatcta	Protospacer
*******************************************************

4. spacer 1.1|2581|55|NC_022656|CRISPRCasFinder matches to NZ_CP011016 (Campylobacter coli strain FB1 plasmid pCC42, complete sequence) position: , mismatch: 1, identity: 0.982

taaacattcaaatgttaaaaatgtatcatattttgagacaaaagcaaaaaatcta	CRISPR spacer
taaacattcaattgttaaaaatgtatcatattttgagacaaaagcaaaaaatcta	Protospacer
*********** *******************************************

5. spacer 1.1|2581|55|NC_022656|CRISPRCasFinder matches to CP013736 (Campylobacter coli strain OR12 plasmid pOR12CC42, complete sequence) position: , mismatch: 1, identity: 0.982

taaacattcaaatgttaaaaatgtatcatattttgagacaaaagcaaaaaatcta	CRISPR spacer
taaacattcaattgttaaaaatgtatcatattttgagacaaaagcaaaaaatcta	Protospacer
*********** *******************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_022660
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1086473 : 1100301 13 Synechococcus_phage(22.22%) NA NA
DBSCAN-SWA_2 1392393 : 1403623 11 Escherichia_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage