Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_022808 Pseudomonas aeruginosa PA1, complete sequence 2 crisprs csa3,DEDDh,cas3,DinG,WYL 1 0 7 0

Results visualization

1. NC_022808
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022808_1 339823-339936 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022808_2 3542657-3542770 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_022808_2 2.1|3542685|58|NC_022808|CRISPRCasFinder 3542685-3542742 58 NC_022808.2 792455-792512 0 1.0

1. spacer 2.1|3542685|58|NC_022808|CRISPRCasFinder matches to position: 792455-792512, mismatch: 0, identity: 1.0

cggataacgccggtggcgttattcgccctacggcccgactccggggccgcgggacgca	CRISPR spacer
cggataacgccggtggcgttattcgccctacggcccgactccggggccgcgggacgca	Protospacer
**********************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 60524 : 117686 53 Shigella_phage(20.0%) transposase,plate NA
DBSCAN-SWA_2 637842 : 718394 86 Pseudomonas_phage(35.9%) tRNA,plate,tail NA
DBSCAN-SWA_3 1187238 : 1281610 104 Pseudomonas_phage(57.14%) tRNA,integrase,capsid,tail,holin,terminase,portal,protease,head attL 1203681:1203701|attR 1286977:1286997
DBSCAN-SWA_4 1422634 : 1486013 84 Pseudomonas_phage(85.0%) tRNA,integrase,capsid,tail,holin,terminase,portal,protease,head attL 1443197:1443215|attR 1493340:1493358
DBSCAN-SWA_5 1530728 : 1539757 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_6 2630530 : 2637424 9 uncultured_Caudovirales_phage(83.33%) tRNA NA
DBSCAN-SWA_7 3464484 : 3502925 50 Pseudomonas_phage(35.0%) integrase,plate,capsid,transposase,lysis,tail attL 3452464:3452480|attR 3482831:3482847
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage