Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_022910 Zymomonas mobilis subsp. mobilis str. CP4 = NRRL B-14023 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
NC_022900 Zymomonas mobilis subsp. mobilis str. CP4 = NRRL B-14023, complete sequence 3 crisprs cas6f,cas7f,cas5f,cas8f,cas3f,cas1,DEDDh,csa3 0 7 2 0
NC_022913 Zymomonas mobilis subsp. mobilis str. CP4 = NRRL B-14023 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
NC_022902 Zymomonas mobilis subsp. mobilis str. CP4 = NRRL B-14023 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
NC_022901 Zymomonas mobilis subsp. mobilis str. CP4 = NRRL B-14023 plasmid unnamed, complete sequence 0 crisprs NA 0 0 1 0
NC_022903 Zymomonas mobilis subsp. mobilis str. CP4 = NRRL B-14023 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_022900
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022900_1 131785-132245 Orphan I-F
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022900_2 1255390-1255659 Orphan I-F
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022900_3 1794552-1794880 Orphan I-F
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_022900_1 1.2|131884|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR 131884-131915 32 NC_013784 Zymomonas mobilis subsp. mobilis ZM4 plasmid pZZM401, complete sequence 18200-18231 4 0.875
NC_022900_1 1.2|131884|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR 131884-131915 32 NZ_CP023686 Zymomonas mobilis subsp. mobilis strain ZM4 substr. 8b plasmid pZM41, complete sequence 817-848 4 0.875
NC_022900_1 1.2|131884|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR 131884-131915 32 NZ_CP023680 Zymomonas mobilis subsp. mobilis strain ZM4 substr. 2032 plasmid pZM36, complete sequence 817-848 4 0.875
NC_022900_1 1.2|131884|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR 131884-131915 32 NZ_CP003712 Zymomonas mobilis subsp. mobilis NRRL B-12526 plasmid pZM1252603, complete sequence 28495-28526 4 0.875
NC_022900_1 1.2|131884|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR 131884-131915 32 NZ_CP003718 Zymomonas mobilis subsp. mobilis str. CP4 = NRRL B-14023 plasmid pZM1402303, complete sequence 18200-18231 4 0.875
NC_022900_1 1.2|131884|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR 131884-131915 32 CP036464 Zymomonas mobilis strain ZM4* plasmid pZM36o, complete sequence 817-848 4 0.875
NC_022900_1 1.2|131884|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR 131884-131915 32 CP036460 Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821 strain ZM4 plasmid pER79ap36, complete sequence 817-848 4 0.875
NC_022900_3 3.3|1794700|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR 1794700-1794731 32 HQ317387 Sulfitobacter phage phiCB2047-B genomic sequence 46059-46090 6 0.812
NC_022900_1 1.7|132185|33|NC_022900|CRISPRCasFinder,CRT,PILER-CR 132185-132217 33 MK415408 CrAssphage GF1-2_000079F, complete genome 42652-42684 7 0.788
NC_022900_1 1.7|132185|33|NC_022900|CRISPRCasFinder,CRT,PILER-CR 132185-132217 33 MW067001 CrAssphage sp. C0521BW15, complete genome 36380-36412 7 0.788
NC_022900_1 1.7|132185|33|NC_022900|CRISPRCasFinder,CRT,PILER-CR 132185-132217 33 MW067000 CrAssphage sp. C0521BD4, complete genome 36380-36412 7 0.788
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 AP018278 Calothrix sp. NIES-4101 plasmid plasmid5 DNA, complete genome 31242-31272 7 0.774
NC_022900_3 3.4|1794760|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR 1794760-1794791 32 NZ_CP049808 Acinetobacter pittii strain A1254 plasmid pA1254_2, complete sequence 31674-31705 7 0.781
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NZ_AP018205 Leptolyngbya boryana NIES-2135 plasmid plasmid2 DNA, complete genome 56641-56671 8 0.742
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NZ_AP014640 Leptolyngbya boryana IAM M-101 plasmid pLBX 448755-448785 8 0.742
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 AP018278 Calothrix sp. NIES-4101 plasmid plasmid5 DNA, complete genome 31241-31272 8 0.75
NC_022900_3 3.4|1794760|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR 1794760-1794791 32 NZ_CP040856 Lactobacillus johnsonii strain G2A plasmid unnamed2, complete sequence 54491-54522 8 0.75
NC_022900_1 1.7|132185|33|NC_022900|CRISPRCasFinder,CRT,PILER-CR 132185-132217 33 MK800154 Enterococcus phage Entf1, complete genome 37521-37553 9 0.727
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NC_004041 Rhizobium etli CFN 42 plasmid p42d, complete sequence 208348-208378 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NZ_CP013633 Rhizobium sp. N324 plasmid pRspN324c, complete sequence 281867-281897 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NZ_CP013555 Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence 298599-298629 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 311621-311651 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NZ_CP013587 Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence 242082-242112 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NZ_CP013550 Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence 275430-275460 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NZ_CP013530 Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence 267827-267857 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NZ_CP013535 Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence 275430-275460 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NZ_CP013540 Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence 287326-287356 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NZ_CP013566 Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence 298312-298342 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NZ_CP013583 Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence 267827-267857 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NZ_CP021125 Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence 274743-274773 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 1010981-1011011 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 274731-274761 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 1221098-1221128 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NZ_CP017243 Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence 279494-279524 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 268735-268765 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 NZ_CP013635 Rhizobium sp. N324 plasmid pRspN324e, complete sequence 165420-165450 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 CP047389 Agrobacterium sp. CGMCC 11546 plasmid pA 113488-113518 9 0.71
NC_022900_2 2.3|1255540|31|NC_022900|PILER-CR,CRT 1255540-1255570 31 CP047390 Agrobacterium sp. CGMCC 11546 plasmid pB 155821-155851 9 0.71
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NC_004041 Rhizobium etli CFN 42 plasmid p42d, complete sequence 208347-208378 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 268735-268766 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NZ_CP013633 Rhizobium sp. N324 plasmid pRspN324c, complete sequence 281866-281897 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NZ_CP013635 Rhizobium sp. N324 plasmid pRspN324e, complete sequence 165420-165451 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NZ_CP013555 Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence 298598-298629 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 311620-311651 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 CP047389 Agrobacterium sp. CGMCC 11546 plasmid pA 113488-113519 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 CP047390 Agrobacterium sp. CGMCC 11546 plasmid pB 155821-155852 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NZ_CP013587 Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence 242081-242112 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NZ_CP013550 Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence 275429-275460 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NZ_CP013530 Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence 267826-267857 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NZ_CP013535 Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence 275429-275460 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NZ_CP013540 Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence 287325-287356 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NZ_CP013566 Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence 298311-298342 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NZ_CP013583 Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence 267826-267857 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NZ_CP021125 Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence 274742-274773 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 1010980-1011011 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 274730-274761 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 1221097-1221128 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NZ_CP017243 Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence 279493-279524 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NZ_AP014640 Leptolyngbya boryana IAM M-101 plasmid pLBX 448755-448786 9 0.719
NC_022900_2 2.7|1255540|32|NC_022900|CRISPRCasFinder 1255540-1255571 32 NZ_AP018205 Leptolyngbya boryana NIES-2135 plasmid plasmid2 DNA, complete genome 56640-56671 9 0.719
NC_022900_1 1.4|132004|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR 132004-132035 32 KC595511 Bacillus phage Basilisk, complete genome 4616-4647 11 0.656

1. spacer 1.2|131884|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR matches to NC_013784 (Zymomonas mobilis subsp. mobilis ZM4 plasmid pZZM401, complete sequence) position: , mismatch: 4, identity: 0.875

gtatgctgatgattgccccatgcccacaatcc	CRISPR spacer
gtatgctgatgattgccccatacccaagaacc	Protospacer
*********************.**** .* **

2. spacer 1.2|131884|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023686 (Zymomonas mobilis subsp. mobilis strain ZM4 substr. 8b plasmid pZM41, complete sequence) position: , mismatch: 4, identity: 0.875

gtatgctgatgattgccccatgcccacaatcc	CRISPR spacer
gtatgctgatgattgccccatacccaagaacc	Protospacer
*********************.**** .* **

3. spacer 1.2|131884|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023680 (Zymomonas mobilis subsp. mobilis strain ZM4 substr. 2032 plasmid pZM36, complete sequence) position: , mismatch: 4, identity: 0.875

gtatgctgatgattgccccatgcccacaatcc	CRISPR spacer
gtatgctgatgattgccccatacccaagaacc	Protospacer
*********************.**** .* **

4. spacer 1.2|131884|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP003712 (Zymomonas mobilis subsp. mobilis NRRL B-12526 plasmid pZM1252603, complete sequence) position: , mismatch: 4, identity: 0.875

gtatgctgatgattgccccatgcccacaatcc	CRISPR spacer
gtatgctgatgattgccccatacccaagaacc	Protospacer
*********************.**** .* **

5. spacer 1.2|131884|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP003718 (Zymomonas mobilis subsp. mobilis str. CP4 = NRRL B-14023 plasmid pZM1402303, complete sequence) position: , mismatch: 4, identity: 0.875

gtatgctgatgattgccccatgcccacaatcc	CRISPR spacer
gtatgctgatgattgccccatacccaagaacc	Protospacer
*********************.**** .* **

6. spacer 1.2|131884|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR matches to CP036464 (Zymomonas mobilis strain ZM4* plasmid pZM36o, complete sequence) position: , mismatch: 4, identity: 0.875

gtatgctgatgattgccccatgcccacaatcc	CRISPR spacer
gtatgctgatgattgccccatacccaagaacc	Protospacer
*********************.**** .* **

7. spacer 1.2|131884|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR matches to CP036460 (Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821 strain ZM4 plasmid pER79ap36, complete sequence) position: , mismatch: 4, identity: 0.875

gtatgctgatgattgccccatgcccacaatcc	CRISPR spacer
gtatgctgatgattgccccatacccaagaacc	Protospacer
*********************.**** .* **

8. spacer 3.3|1794700|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR matches to HQ317387 (Sulfitobacter phage phiCB2047-B genomic sequence) position: , mismatch: 6, identity: 0.812

aaggtaatattatcgtcactgacaagcaaggt	CRISPR spacer
agggtaattttatcctcactgacaagcataga	Protospacer
*.****** ***** ************* .* 

9. spacer 1.7|132185|33|NC_022900|CRISPRCasFinder,CRT,PILER-CR matches to MK415408 (CrAssphage GF1-2_000079F, complete genome) position: , mismatch: 7, identity: 0.788

agcgttattagattctttaacaatttcaaatta	CRISPR spacer
agtttcattagcttctttaacattttcaaagtt	Protospacer
**. *.***** ********** ******* * 

10. spacer 1.7|132185|33|NC_022900|CRISPRCasFinder,CRT,PILER-CR matches to MW067001 (CrAssphage sp. C0521BW15, complete genome) position: , mismatch: 7, identity: 0.788

agcgttattagattctttaacaatttcaaatta	CRISPR spacer
agtttcattagcttctttaacattttcaaagtt	Protospacer
**. *.***** ********** ******* * 

11. spacer 1.7|132185|33|NC_022900|CRISPRCasFinder,CRT,PILER-CR matches to MW067000 (CrAssphage sp. C0521BD4, complete genome) position: , mismatch: 7, identity: 0.788

agcgttattagattctttaacaatttcaaatta	CRISPR spacer
agtttcattagcttctttaacattttcaaagtt	Protospacer
**. *.***** ********** ******* * 

12. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to AP018278 (Calothrix sp. NIES-4101 plasmid plasmid5 DNA, complete genome) position: , mismatch: 7, identity: 0.774

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
ctaaactgcaagaagcgatcgcaactgcacg	Protospacer
  ***** ******* *********.* .**

13. spacer 3.4|1794760|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049808 (Acinetobacter pittii strain A1254 plasmid pA1254_2, complete sequence) position: , mismatch: 7, identity: 0.781

-tcttgtgacattgctggctttgcttgagcatt	CRISPR spacer
aatttataa-attgctggcattgctttagcatt	Protospacer
  .**.*.* ********* ****** ******

14. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NZ_AP018205 (Leptolyngbya boryana NIES-2135 plasmid plasmid2 DNA, complete genome) position: , mismatch: 8, identity: 0.742

agaaactccaagaagagatcgcaa---ccgagcg	CRISPR spacer
ggaaactccaagaacagaacgcaaaatctaa---	Protospacer
.************* *** *****   *..*   

15. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NZ_AP014640 (Leptolyngbya boryana IAM M-101 plasmid pLBX) position: , mismatch: 8, identity: 0.742

agaaactccaagaagagatcgcaa---ccgagcg	CRISPR spacer
ggaaactccaagaacagaacgcaaaatctaa---	Protospacer
.************* *** *****   *..*   

16. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to AP018278 (Calothrix sp. NIES-4101 plasmid plasmid5 DNA, complete genome) position: , mismatch: 8, identity: 0.75

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
ctaaactgcaagaagcgatcgcaactgcacgt	Protospacer
  ***** ******* *********.* .** 

17. spacer 3.4|1794760|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040856 (Lactobacillus johnsonii strain G2A plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

tcttgtgacattgctggctttgcttgagcatt	CRISPR spacer
attggtgaaattgctgcctttgcttgatctgt	Protospacer
 .* **** ******* ********** *  *

18. spacer 1.7|132185|33|NC_022900|CRISPRCasFinder,CRT,PILER-CR matches to MK800154 (Enterococcus phage Entf1, complete genome) position: , mismatch: 9, identity: 0.727

agcgttattagattctttaacaatttcaaatta	CRISPR spacer
ttctttattggattctttagcaatttcaacaac	Protospacer
  * *****.*********.*********    

19. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NC_004041 (Rhizobium etli CFN 42 plasmid p42d, complete sequence) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagca	Protospacer
   . .********* ******.*******.

20. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NZ_CP013633 (Rhizobium sp. N324 plasmid pRspN324c, complete sequence) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagca	Protospacer
   . .********* ******.*******.

21. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagca	Protospacer
   . .********* ******.*******.

22. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagca	Protospacer
   . .********* ******.*******.

23. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagca	Protospacer
   . .********* ******.*******.

24. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NZ_CP013550 (Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagca	Protospacer
   . .********* ******.*******.

25. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NZ_CP013530 (Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagca	Protospacer
   . .********* ******.*******.

26. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NZ_CP013535 (Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagca	Protospacer
   . .********* ******.*******.

27. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NZ_CP013540 (Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagca	Protospacer
   . .********* ******.*******.

28. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagca	Protospacer
   . .********* ******.*******.

29. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NZ_CP013583 (Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagca	Protospacer
   . .********* ******.*******.

30. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NZ_CP021125 (Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagca	Protospacer
   . .********* ******.*******.

31. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
ctcgtttccaagaagcgatcgcagccgagca	Protospacer
   . .********* *******.******.

32. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagca	Protospacer
   . .********* ******.*******.

33. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcacaaccgagca	Protospacer
   . .********* ****.*********.

34. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NZ_CP017243 (Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagca	Protospacer
   . .********* ******.*******.

35. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagca	Protospacer
   . .********* ******.*******.

36. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagca	Protospacer
   . .********* ******.*******.

37. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to CP047389 (Agrobacterium sp. CGMCC 11546 plasmid pA) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagca	Protospacer
   . .********* ******.*******.

38. spacer 2.3|1255540|31|NC_022900|PILER-CR,CRT matches to CP047390 (Agrobacterium sp. CGMCC 11546 plasmid pB) position: , mismatch: 9, identity: 0.71

agaaactccaagaagagatcgcaaccgagcg	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagca	Protospacer
   . .********* ******.*******.

39. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NC_004041 (Rhizobium etli CFN 42 plasmid p42d, complete sequence) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagcaa	Protospacer
   . .********* ******.*******.*

40. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagcaa	Protospacer
   . .********* ******.*******.*

41. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NZ_CP013633 (Rhizobium sp. N324 plasmid pRspN324c, complete sequence) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagcaa	Protospacer
   . .********* ******.*******.*

42. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagcaa	Protospacer
   . .********* ******.*******.*

43. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagcaa	Protospacer
   . .********* ******.*******.*

44. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagcaa	Protospacer
   . .********* ******.*******.*

45. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to CP047389 (Agrobacterium sp. CGMCC 11546 plasmid pA) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagcaa	Protospacer
   . .********* ******.*******.*

46. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to CP047390 (Agrobacterium sp. CGMCC 11546 plasmid pB) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagcaa	Protospacer
   . .********* ******.*******.*

47. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagcaa	Protospacer
   . .********* ******.*******.*

48. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NZ_CP013550 (Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagcaa	Protospacer
   . .********* ******.*******.*

49. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NZ_CP013530 (Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagcaa	Protospacer
   . .********* ******.*******.*

50. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NZ_CP013535 (Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagcaa	Protospacer
   . .********* ******.*******.*

51. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NZ_CP013540 (Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagcaa	Protospacer
   . .********* ******.*******.*

52. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagcaa	Protospacer
   . .********* ******.*******.*

53. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NZ_CP013583 (Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagcaa	Protospacer
   . .********* ******.*******.*

54. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NZ_CP021125 (Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagcaa	Protospacer
   . .********* ******.*******.*

55. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
ctcgtttccaagaagcgatcgcagccgagcaa	Protospacer
   . .********* *******.******.*

56. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagcaa	Protospacer
   . .********* ******.*******.*

57. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcacaaccgagcaa	Protospacer
   . .********* ****.*********.*

58. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NZ_CP017243 (Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgcaaccgagcga	CRISPR spacer
cttgtttccaagaagcgatcgcgaccgagcaa	Protospacer
   . .********* ******.*******.*

59. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NZ_AP014640 (Leptolyngbya boryana IAM M-101 plasmid pLBX) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgc--aaccgagcga	CRISPR spacer
ggaaactccaagaacagaacgcaaaatctaat--	Protospacer
.************* *** ***  **.* *..  

60. spacer 2.7|1255540|32|NC_022900|CRISPRCasFinder matches to NZ_AP018205 (Leptolyngbya boryana NIES-2135 plasmid plasmid2 DNA, complete genome) position: , mismatch: 9, identity: 0.719

agaaactccaagaagagatcgc--aaccgagcga	CRISPR spacer
ggaaactccaagaacagaacgcaaaatctaat--	Protospacer
.************* *** ***  **.* *..  

61. spacer 1.4|132004|32|NC_022900|CRISPRCasFinder,CRT,PILER-CR matches to KC595511 (Bacillus phage Basilisk, complete genome) position: , mismatch: 11, identity: 0.656

ccaatcgattaaagcatcgacaaaagcacgct	CRISPR spacer
gtaatcgattaaatcatctacaaaactttctg	Protospacer
 .*********** **** ****** . . . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 155325 : 168548 9 Thermus_phage(12.5%) NA NA
DBSCAN-SWA_2 979395 : 989879 10 Sinorhizobium_phage(33.33%) terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_022901
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 19644 : 36882 23 Burkholderia_phage(31.25%) tail,head,capsid,terminase,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage