Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_022909 Lactobacillus johnsonii N6.2, complete sequence 1 crisprs cas2,cas3,RT,cas14j,c2c9_V-U4,DEDDh,DinG,csa3 0 1 5 0

Results visualization

1. NC_022909
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022909_1 849205-849294 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_022909_1 1.1|849234|32|NC_022909|CRISPRCasFinder 849234-849265 32 MG765278 Lactobacillus phage Silenus, complete genome 16728-16759 6 0.812
NC_022909_1 1.1|849234|32|NC_022909|CRISPRCasFinder 849234-849265 32 MH809528 Lactobacillus phage Sabazios, complete genome 16741-16772 6 0.812
NC_022909_1 1.1|849234|32|NC_022909|CRISPRCasFinder 849234-849265 32 NC_015464 Campylobacter phage NCTC12673, complete genome 46970-47001 7 0.781
NC_022909_1 1.1|849234|32|NC_022909|CRISPRCasFinder 849234-849265 32 KX236333 Campylobacter phage PC14, complete genome 81963-81994 7 0.781
NC_022909_1 1.1|849234|32|NC_022909|CRISPRCasFinder 849234-849265 32 MN657033 Psychrobacter sp. strain ANT_P15B plasmid pA15BP3, complete sequence 2-33 9 0.719
NC_022909_1 1.1|849234|32|NC_022909|CRISPRCasFinder 849234-849265 32 MN657085 Psychrobacter sp. strain ANT_H3 plasmid pA3H5, complete sequence 11-42 9 0.719
NC_022909_1 1.1|849234|32|NC_022909|CRISPRCasFinder 849234-849265 32 AP014290 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S24-C92, *** SEQUENCING IN PROGRESS *** 15628-15659 9 0.719
NC_022909_1 1.1|849234|32|NC_022909|CRISPRCasFinder 849234-849265 32 AP013374 Uncultured Mediterranean phage uvMED DNA, complete genome, group G13, isolate: uvMED-CGR-C78-MedDCM-OCT-S42-C9 18930-18961 9 0.719
NC_022909_1 1.1|849234|32|NC_022909|CRISPRCasFinder 849234-849265 32 AP013577 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C78-MedDCM-OCT-S37-C5, *** SEQUENCING IN PROGRESS *** 6650-6681 9 0.719

1. spacer 1.1|849234|32|NC_022909|CRISPRCasFinder matches to MG765278 (Lactobacillus phage Silenus, complete genome) position: , mismatch: 6, identity: 0.812

---ctgaacctagctttttctttagataactaaaa	CRISPR spacer
tcattgaa---agctttttcttttgataaataaaa	Protospacer
   .****   ************ ***** *****

2. spacer 1.1|849234|32|NC_022909|CRISPRCasFinder matches to MH809528 (Lactobacillus phage Sabazios, complete genome) position: , mismatch: 6, identity: 0.812

---ctgaacctagctttttctttagataactaaaa	CRISPR spacer
tcattgaa---agctttttcttttgataaataaaa	Protospacer
   .****   ************ ***** *****

3. spacer 1.1|849234|32|NC_022909|CRISPRCasFinder matches to NC_015464 (Campylobacter phage NCTC12673, complete genome) position: , mismatch: 7, identity: 0.781

ctgaacctagctttttctttagataactaaaa	CRISPR spacer
ataaacctaacttttcctttagataaatttaa	Protospacer
 *.******.*****.********** *  **

4. spacer 1.1|849234|32|NC_022909|CRISPRCasFinder matches to KX236333 (Campylobacter phage PC14, complete genome) position: , mismatch: 7, identity: 0.781

ctgaacctagctttttctttagataactaaaa	CRISPR spacer
ataaacctaacttttcctttagataaatttaa	Protospacer
 *.******.*****.********** *  **

5. spacer 1.1|849234|32|NC_022909|CRISPRCasFinder matches to MN657033 (Psychrobacter sp. strain ANT_P15B plasmid pA15BP3, complete sequence) position: , mismatch: 9, identity: 0.719

ctgaacctagctttttctttagataactaaaa	CRISPR spacer
tattattttgctttttctttagttaattaaaa	Protospacer
.   *..* ************* ***.*****

6. spacer 1.1|849234|32|NC_022909|CRISPRCasFinder matches to MN657085 (Psychrobacter sp. strain ANT_H3 plasmid pA3H5, complete sequence) position: , mismatch: 9, identity: 0.719

ctgaacctagctttttctttagataactaaaa	CRISPR spacer
tattattttgctttttctttagttaattaaaa	Protospacer
.   *..* ************* ***.*****

7. spacer 1.1|849234|32|NC_022909|CRISPRCasFinder matches to AP014290 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S24-C92, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719

ctgaacctagctttttctttagataactaaaa	CRISPR spacer
attttattagcttcttctttagataacaaaga	Protospacer
 *    .******.************* **.*

8. spacer 1.1|849234|32|NC_022909|CRISPRCasFinder matches to AP013374 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G13, isolate: uvMED-CGR-C78-MedDCM-OCT-S42-C9) position: , mismatch: 9, identity: 0.719

ctgaacctagctttttctttagataactaaaa	CRISPR spacer
tttttcctagctttttctttagctgacttagg	Protospacer
.*   ***************** *.*** *..

9. spacer 1.1|849234|32|NC_022909|CRISPRCasFinder matches to AP013577 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C78-MedDCM-OCT-S37-C5, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719

ctgaacctagctttttctttagataactaaaa	CRISPR spacer
tttttcctagctttttctttagctgacttagg	Protospacer
.*   ***************** *.*** *..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 528524 : 580646 45 Bacillus_phage(16.67%) transposase,protease,tRNA NA
DBSCAN-SWA_2 614294 : 625856 14 Lactobacillus_virus(33.33%) transposase,bacteriocin,protease NA
DBSCAN-SWA_3 771655 : 779135 8 Bacillus_phage(33.33%) transposase NA
DBSCAN-SWA_4 1083183 : 1093546 9 Erwinia_phage(16.67%) protease,tRNA NA
DBSCAN-SWA_5 1761866 : 1827097 54 unidentified_phage(23.53%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage