1. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047430 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-2, complete sequence) position: , mismatch: 4, identity: 0.867
ataactttaaaaaa-tattgacaattattat CRISPR spacer
-tatttttaaaaaactattgacaattatttt Protospacer
** .********* ************** *
2. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047434 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-6) position: , mismatch: 4, identity: 0.867
ataactttaaaaaa-tattgacaattattat CRISPR spacer
-tatttttaaaaaactattgacaattatttt Protospacer
** .********* ************** *
3. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013198 (Spiroplasma citri strain R8-A2 plasmid pSCI26, complete sequence) position: , mismatch: 4, identity: 0.867
ataactttaaaaaa-tattgacaattattat CRISPR spacer
-tatttttaaaaaactattgacaattatttt Protospacer
** .********* ************** *
4. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013199 (Spiroplasma citri strain R8-A2 plasmid pSCI15, complete sequence) position: , mismatch: 4, identity: 0.867
ataactttaaaaaa-tattgacaattattat CRISPR spacer
-tatttttaaaaaactattgacaattatttt Protospacer
** .********* ************** *
5. spacer 1.16|502876|30|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP011156 (Bacillus cereus strain HN001 plasmid pRML01, complete sequence) position: , mismatch: 4, identity: 0.867
tttttcaataactaatatttttattagttg CRISPR spacer
ttgctaaatatctaatatttttattagttg Protospacer
** .* **** *******************
6. spacer 1.16|502876|30|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP014283 (Bacillus thuringiensis strain Bt185 plasmid pBT1850636, complete sequence) position: , mismatch: 4, identity: 0.867
tttttcaataactaatatttttattagttg CRISPR spacer
ttgctaaatatctaatatttttattagttg Protospacer
** .* **** *******************
7. spacer 1.16|502876|30|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP032614 (Bacillus thuringiensis strain QZL38 plasmid p.1, complete sequence) position: , mismatch: 4, identity: 0.867
tttttcaataactaatatttttattagttg CRISPR spacer
ttgctaaatatctaatatttttattagttg Protospacer
** .* **** *******************
8. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046373 (Spiroplasma citri strain LB 319 plasmid pScpLB319-2, complete sequence) position: , mismatch: 4, identity: 0.867
attaaaattgaaattaataatcatatttga- CRISPR spacer
attaaaattgaaattaataatt-tatacgaa Protospacer
*********************. *** .**
9. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020413 (Leptospira interrogans serovar Copenhageni strain FDAARGOS_203 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.867
attaaaattgaaattaataatcat--atttga CRISPR spacer
attaatattgaaatttataatcatccattt-- Protospacer
***** ********* ******** ****
10. spacer 1.45|504786|30|NC_022998|CRISPRCasFinder,CRT matches to NC_016138 (Pseudomonas aeruginosa plasmid pUM505, complete sequence) position: , mismatch: 4, identity: 0.867
acttgctgaaggctttgaccaaggtacggg CRISPR spacer
agtcgctgaaggccttgagcaaggtacggg Protospacer
* *.*********.**** ***********
11. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053838 (Aliiarcobacter faecis strain CCUG 66484 plasmid pAFAEC, complete sequence) position: , mismatch: 4, identity: 0.867
tttttcattaactaatatttttattggtca-- CRISPR spacer
attttcattaactaatattcttatt--tcatt Protospacer
******************.***** ***
12. spacer 1.59|503010|26|NC_022998|PILER-CR matches to NZ_CP031226 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence) position: , mismatch: 4, identity: 0.846
ttttttctcgtgtacgatttcgttca CRISPR spacer
ttttttctcgggtaccatttcgtcaa Protospacer
********** **** *******. *
13. spacer 1.60|503074|26|NC_022998|PILER-CR matches to NZ_CP031226 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence) position: , mismatch: 4, identity: 0.846
ttttttctcgtgtacgatttcgttca CRISPR spacer
ttttttctcgggtaccatttcgtcaa Protospacer
********** **** *******. *
14. spacer 1.7|502281|30|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP047096 (Bacillus marisflavi strain 151-25 plasmid p25, complete sequence) position: , mismatch: 5, identity: 0.833
gaaatgtatttcaatagttat-attataaca CRISPR spacer
gaaacgtatttcaatagttatcaatacaat- Protospacer
****.**************** * **.**.
15. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to AP014106 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C34-MedDCM-OCT-S43-C23, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 5, identity: 0.833
ataactttaaaaaatattgacaatt-attat CRISPR spacer
gttactttaaaaaatatttacaattcacta- Protospacer
.* *************** ****** *.**
16. spacer 1.11|502545|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_018878 (Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence) position: , mismatch: 5, identity: 0.833
attattgtaatactcgcttgcttgtaccaa CRISPR spacer
tttatagtaatactcgcttgattgtaaaaa Protospacer
**** ************** ***** **
17. spacer 1.16|502876|30|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP042838 (Enterococcus sp. DA9 plasmid unnamed3) position: , mismatch: 5, identity: 0.833
tttttcaataactaatatttttattagttg CRISPR spacer
gttgacaataactaatatttttattagtat Protospacer
** ***********************
18. spacer 1.16|502876|30|NC_022998|CRISPRCasFinder,CRT matches to MN693193 (Marine virus AFVG_25M440, complete genome) position: , mismatch: 5, identity: 0.833
tttttcaataactaatatttttattagttg CRISPR spacer
taataaaaaaactaatatttttattagttg Protospacer
* * ** *********************
19. spacer 1.16|502876|30|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP039840 (Escherichia coli O157:H7 strain USDA5905 plasmid pUSDA5905_4, complete sequence) position: , mismatch: 5, identity: 0.833
tttttcaataactaata-tttttattagttg CRISPR spacer
attttccataactaatattttttgttcgtt- Protospacer
***** ********** *****.** ***
20. spacer 1.16|502876|30|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP051742 (Escherichia coli strain SCU-105 plasmid pSCU-105-4, complete sequence) position: , mismatch: 5, identity: 0.833
tttttcaataactaata-tttttattagttg CRISPR spacer
attttccataactaatattttttgttcgtt- Protospacer
***** ********** *****.** ***
21. spacer 1.20|503136|30|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP054658 (Lactobacillus reuteri strain AN417 plasmid pAN417A, complete sequence) position: , mismatch: 5, identity: 0.833
atattcttgatcgacaagattgttaaaagt CRISPR spacer
ataatcttgatcgacaagattattatcaat Protospacer
*** *****************.*** *.*
22. spacer 1.26|503532|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_019538 (Aeromonas phage CC2, complete genome) position: , mismatch: 5, identity: 0.833
atcagt-ccgagagacttaaaacaaaggagt CRISPR spacer
-ccagtaccgggagacttagaacaaaggaga Protospacer
.**** ***.********.**********
23. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047429 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-1, complete sequence) position: , mismatch: 5, identity: 0.833
attaaaattgaaattaataatcatatttga CRISPR spacer
attaaaattgaaattaataatattaataca Protospacer
********************* ** * *
24. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047434 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-6) position: , mismatch: 5, identity: 0.833
attaaaattgaaattaataatcatatttga CRISPR spacer
attaaaattgaaattaataatattaataca Protospacer
********************* ** * *
25. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047434 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-6) position: , mismatch: 5, identity: 0.833
attaaaattgaaattaataatcatatttga CRISPR spacer
attaaaattgaaattaataatattaataca Protospacer
********************* ** * *
26. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 5, identity: 0.833
attaaaattgaaattaataatcatatttga CRISPR spacer
atagatattgatattaataatcatattaga Protospacer
** .* ***** *************** **
27. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT584805 (Bacillus phage Tomato, complete genome) position: , mismatch: 5, identity: 0.833
aataaagaaatagtaaaaattgaaattata CRISPR spacer
aaacaagaaaaagtaaaaagtgaaattaga Protospacer
** ****** ******** ******** *
28. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KX349902 (Bacillus phage Kida, complete genome) position: , mismatch: 5, identity: 0.833
aataaagaaatagtaaaaattgaaattata CRISPR spacer
aaacaagaaaaagtaaaaagtgaaattaga Protospacer
** ****** ******** ******** *
29. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MF288917 (Bacillus phage PPIsBest, complete genome) position: , mismatch: 5, identity: 0.833
aataaagaaatagtaaaaattgaaattata CRISPR spacer
aaacaagaaaaagtaaaaagtgaaattaga Protospacer
** ****** ******** ******** *
30. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_049832 (Escherichia phage vB_EcoS-DELF2 DNA, complete genome) position: , mismatch: 5, identity: 0.833
aataaagaaatagtaaaaattgaaattata CRISPR spacer
aaagatgaaacagtaaaaattgaaattaaa Protospacer
** .* ****.***************** *
31. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN038179 (Bacillus phage ALPS, complete genome) position: , mismatch: 5, identity: 0.833
aataaagaaatagtaaaaattgaaattata CRISPR spacer
aaacaagaaaaagtaaaaagtgaaattaga Protospacer
** ****** ******** ******** *
32. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KU737351 (Bacillus phage NotTheCreek, complete genome) position: , mismatch: 5, identity: 0.833
aataaagaaatagtaaaaattgaaattata CRISPR spacer
aaacaagaaaaagtaaaaagtgaaattaga Protospacer
** ****** ******** ******** *
33. spacer 1.36|504192|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN694628 (Marine virus AFVG_250M527, complete genome) position: , mismatch: 5, identity: 0.833
gaacctattaaaaatagtacaactaataga CRISPR spacer
aaacctgttaaaattagtacaactaatact Protospacer
.*****.****** **************
34. spacer 1.36|504192|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to CP013001 (Bacillus thuringiensis strain XL6 plasmid, complete sequence) position: , mismatch: 5, identity: 0.833
gaaccta--ttaaaaatagtacaactaataga CRISPR spacer
--gcctagtttaaaaattgtactactaataga Protospacer
.**** ******** **** *********
35. spacer 1.36|504192|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KF356199 (Microcystis phage MaMV-DC, complete genome) position: , mismatch: 5, identity: 0.833
gaacctatt--aaaaatagtacaactaataga CRISPR spacer
--ccctatccaaaaaatagtgcaactaataga Protospacer
*****. *********.***********
36. spacer 1.36|504192|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_008562 (Microcystis phage Ma-LMM01 DNA, complete genome) position: , mismatch: 5, identity: 0.833
gaacctatt--aaaaatagtacaactaataga CRISPR spacer
--ccctatccgaaaaatagtgcaactaataga Protospacer
*****. *********.***********
37. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017027 (Campylobacter coli plasmid pCC14983A-2, complete sequence) position: , mismatch: 5, identity: 0.833
tttttttcattttaaaacctttccatttct CRISPR spacer
tttttttcattttaaaccctttctatagat Protospacer
**************** ******.** *
38. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045047 (Campylobacter jejuni subsp. jejuni strain NADC 20827 plasmid p20827S, complete sequence) position: , mismatch: 5, identity: 0.833
tttttttcattttaaaacctttccatttct CRISPR spacer
tttttttcattttaaaccctttctatagat Protospacer
**************** ******.** *
39. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_008052 (Campylobacter jejuni plasmid pCJ1170, complete sequence) position: , mismatch: 5, identity: 0.833
tttttttcattttaaaacctttccatttct CRISPR spacer
tttttttcattttaaaccctttctatagat Protospacer
**************** ******.** *
40. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048766 (Campylobacter jejuni strain ZJB023 plasmid pCJ4K-03, complete sequence) position: , mismatch: 5, identity: 0.833
tttttttcattttaaaacctttccatttct CRISPR spacer
tttttttcattttaaaccctttctatagat Protospacer
**************** ******.** *
41. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH634989 (Campylobacter coli strain P118 plasmid pCCDM18S1, complete sequence) position: , mismatch: 5, identity: 0.833
tttttttcattttaaaacctttccatttct CRISPR spacer
tttttttcattttaaaccctttctatagat Protospacer
**************** ******.** *
42. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028875 (Borreliella bavariensis PBi plasmid lp28-4_cp32-1, complete sequence) position: , mismatch: 5, identity: 0.833
tttttcattaactaatattttt-attggtca CRISPR spacer
tttttaattaattaatatttttaattaatc- Protospacer
***** *****.********** ***..**
43. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028875 (Borreliella bavariensis PBi plasmid lp28-4_cp32-1, complete sequence) position: , mismatch: 5, identity: 0.833
tttttcattaactaatattttt-attggtca CRISPR spacer
tttttaattaattaatatttttaattaatc- Protospacer
***** *****.********** ***..**
44. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_017240 (Borreliella afzelii PKo plasmid lp32-10, complete sequence) position: , mismatch: 5, identity: 0.833
tttttcattaactaatattttt-attggtca CRISPR spacer
tttttaattaattaatatttttaattaatc- Protospacer
***** *****.********** ***..**
45. spacer 1.54|505382|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021661 (Candidatus Fukatsuia symbiotica strain 5D plasmid p5D_Fsymbiotica-2) position: , mismatch: 5, identity: 0.833
ttagatt--taaataattacgaaacaaataat CRISPR spacer
--aggttactaaataatgacaaaacaaataat Protospacer
**.** ******** **.***********
46. spacer 1.61|503138|28|NC_022998|PILER-CR matches to NZ_CP054658 (Lactobacillus reuteri strain AN417 plasmid pAN417A, complete sequence) position: , mismatch: 5, identity: 0.821
attcttgatcgacaagattgttaaaagt CRISPR spacer
aatcttgatcgacaagattattatcaat Protospacer
* *****************.*** *.*
47. spacer 1.6|502215|30|NC_022998|CRISPRCasFinder,CRT matches to MK562502 (Shigella phage KPS64, complete genome) position: , mismatch: 6, identity: 0.8
attttgccgataaaggatttgcaagttgaa CRISPR spacer
gtcttgctgataaaggttttgcaagttcta Protospacer
.*.****.******** ********** *
48. spacer 1.6|502215|30|NC_022998|CRISPRCasFinder,CRT matches to NC_041977 (Citrobacter phage Mordin, complete genome) position: , mismatch: 6, identity: 0.8
attttgccgataaaggatttgcaagttgaa CRISPR spacer
gtcttgctgataaaggttttgcaagttcta Protospacer
.*.****.******** ********** *
49. spacer 1.6|502215|30|NC_022998|CRISPRCasFinder,CRT matches to MF158043 (Shigella phage Sf16, complete genome) position: , mismatch: 6, identity: 0.8
attttgccgataaaggatttgcaagttgaa CRISPR spacer
gtcttgctgataaaggttttgcaagttcta Protospacer
.*.****.******** ********** *
50. spacer 1.6|502215|30|NC_022998|CRISPRCasFinder,CRT matches to NC_028247 (Citrobacter phage Michonne, complete genome) position: , mismatch: 6, identity: 0.8
attttgccgataaaggatttgcaagttgaa CRISPR spacer
gtcttgctgataaaggttttgcaagttcta Protospacer
.*.****.******** ********** *
51. spacer 1.6|502215|30|NC_022998|CRISPRCasFinder,CRT matches to MF158044 (Shigella phage Sf18, complete genome) position: , mismatch: 6, identity: 0.8
attttgccgataaaggatttgcaagttgaa CRISPR spacer
gtcttgctgataaaggttttgcaagttcta Protospacer
.*.****.******** ********** *
52. spacer 1.6|502215|30|NC_022998|CRISPRCasFinder,CRT matches to MF158040 (Shigella phage Sf13, complete genome) position: , mismatch: 6, identity: 0.8
attttgccgataaaggatttgcaagttgaa CRISPR spacer
gtcttgctgataaaggttttgcaagttcta Protospacer
.*.****.******** ********** *
53. spacer 1.6|502215|30|NC_022998|CRISPRCasFinder,CRT matches to MF158041 (Shigella phage Sf15, complete genome) position: , mismatch: 6, identity: 0.8
attttgccgataaaggatttgcaagttgaa CRISPR spacer
gtcttgctgataaaggttttgcaagttcta Protospacer
.*.****.******** ********** *
54. spacer 1.6|502215|30|NC_022998|CRISPRCasFinder,CRT matches to MH920362 (Citrobacter phage Maleficent, complete genome) position: , mismatch: 6, identity: 0.8
attttgccgataaaggatttgcaagttgaa CRISPR spacer
gtcttgctgataaaggttttgcaagttcta Protospacer
.*.****.******** ********** *
55. spacer 1.6|502215|30|NC_022998|CRISPRCasFinder,CRT matches to MN342151 (Escherichia phage vB_EcoM_3HA14, complete genome) position: , mismatch: 6, identity: 0.8
attttgccgataaaggatttgcaagttgaa CRISPR spacer
gtcttgctgataaaggttttgcaagttcta Protospacer
.*.****.******** ********** *
56. spacer 1.6|502215|30|NC_022998|CRISPRCasFinder,CRT matches to MF327003 (Shigella phage Sf14, complete genome) position: , mismatch: 6, identity: 0.8
attttgccgataaaggatttgcaagttgaa CRISPR spacer
gtcttgctgataaaggttttgcaagttcta Protospacer
.*.****.******** ********** *
57. spacer 1.6|502215|30|NC_022998|CRISPRCasFinder,CRT matches to NC_028808 (Escherichia phage SUSP1, complete genome) position: , mismatch: 6, identity: 0.8
attttgccgataaaggatttgcaagttgaa CRISPR spacer
gtcttgctgataaaggttttgcaagttcta Protospacer
.*.****.******** ********** *
58. spacer 1.6|502215|30|NC_022998|CRISPRCasFinder,CRT matches to MF327005 (Shigella phage Sf19, complete genome) position: , mismatch: 6, identity: 0.8
attttgccgataaaggatttgcaagttgaa CRISPR spacer
gtcttgctgataaaggttttgcaagttcta Protospacer
.*.****.******** ********** *
59. spacer 1.6|502215|30|NC_022998|CRISPRCasFinder,CRT matches to NC_042076 (Shigella phage Sf17, complete genome) position: , mismatch: 6, identity: 0.8
attttgccgataaaggatttgcaagttgaa CRISPR spacer
gtcttgctgataaaggttttgcaagttcta Protospacer
.*.****.******** ********** *
60. spacer 1.7|502281|30|NC_022998|CRISPRCasFinder,CRT matches to MN694670 (Marine virus AFVG_250M589, complete genome) position: , mismatch: 6, identity: 0.8
gaaatgtatttcaatagttatattataaca- CRISPR spacer
taaatctatttcaatagttaaatta-gccat Protospacer
**** ************** **** . **
61. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK978160 (Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence) position: , mismatch: 6, identity: 0.8
ataactttaaaaaatattgacaattattat CRISPR spacer
ttatatgtaataaatattgacaagtattat Protospacer
** * *** ************ ******
62. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026424 (Acinetobacter sp. ACNIH1 plasmid pACI-148e, complete sequence) position: , mismatch: 6, identity: 0.8
ataactttaaaaaatattgacaattattat CRISPR spacer
ttatatgtaataaatattgacaagtattat Protospacer
** * *** ************ ******
63. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN694157 (Marine virus AFVG_250M658, complete genome) position: , mismatch: 6, identity: 0.8
ataactttaaaaaatattgacaattattat CRISPR spacer
atgtatttaaaaagtattaacaattattct Protospacer
**. ********.****.********* *
64. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693515 (Marine virus AFVG_25M70, complete genome) position: , mismatch: 6, identity: 0.8
ataactttaaaaaatattgacaattattat CRISPR spacer
aaaactttaaaaaatattgccaaagatcag Protospacer
* ***************** *** **.*
65. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032113 (Acinetobacter lwoffii strain ED23-35 plasmid pALWED1.4, complete sequence) position: , mismatch: 6, identity: 0.8
ataactttaaaaaatattgacaattattat CRISPR spacer
ttatatgtaataaatattgacaagtattat Protospacer
** * *** ************ ******
66. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032102 (Acinetobacter lwoffii strain EK30A plasmid pALWEK1.1, complete sequence) position: , mismatch: 6, identity: 0.8
ataactttaaaaaatattgacaattattat CRISPR spacer
ttatatgtaataaatattgacaagtattat Protospacer
** * *** ************ ******
67. spacer 1.14|502744|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 6, identity: 0.8
gattttgtcatcatagacataatcgttgta CRISPR spacer
gtttttgtcatcatagacataataatttcc Protospacer
* ********************* .** .
68. spacer 1.14|502744|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 6, identity: 0.8
gattttgtcatcatagacataatcgttgta CRISPR spacer
gtttttgtcatcatagacataataatttcc Protospacer
* ********************* .** .
69. spacer 1.14|502744|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 6, identity: 0.8
gattttgtcatcatagacataatcgttgta CRISPR spacer
gtttttgtcatcatagacataataatttcc Protospacer
* ********************* .** .
70. spacer 1.15|502810|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN694745 (Marine virus AFVG_250M427, complete genome) position: , mismatch: 6, identity: 0.8
tgaaaagggaaaagaaatgtcacgtcctat CRISPR spacer
tgaaaaggaaaaagaaatgccacttaatct Protospacer
********.**********.*** * * *
71. spacer 1.18|503008|28|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP031226 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence) position: , mismatch: 6, identity: 0.786
ttttttttctcgtgtacgatttcgttca CRISPR spacer
acttttttctcgggtaccatttcgtcaa Protospacer
.********** **** *******. *
72. spacer 1.19|503072|28|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP031226 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence) position: , mismatch: 6, identity: 0.786
ttttttttctcgtgtacgatttcgttca CRISPR spacer
acttttttctcgggtaccatttcgtcaa Protospacer
.********** **** *******. *
73. spacer 1.22|503268|29|NC_022998|CRISPRCasFinder,CRT matches to NC_014390 (Butyrivibrio proteoclasticus B316 plasmid pCY186, complete sequence) position: , mismatch: 6, identity: 0.793
aaaatatgaatacaatgcagacggaaaag CRISPR spacer
caaatatgattacaaagcagacggatata Protospacer
******** ***** ********* * .
74. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047438 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-1, complete sequence) position: , mismatch: 6, identity: 0.8
attaaaattgaaattaataatcatatttga CRISPR spacer
attaaaattgaaattaataatattaatacg Protospacer
********************* ** * .
75. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047444 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-7) position: , mismatch: 6, identity: 0.8
attaaaattgaaattaataatcatatttga CRISPR spacer
attaaaattgaaattaataatattaatacg Protospacer
********************* ** * .
76. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.8
attaaaattgaaattaataatcatatttga CRISPR spacer
attaatattgaaataaataatcatttagaa Protospacer
***** ******** ********* * .*
77. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033050 (Virgibacillus halodenitrificans strain Bac324 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
attaaaattgaaattaataatcatatttga CRISPR spacer
atggaaaatgaaattaataattatattaaa Protospacer
** .*** *************.***** .*
78. spacer 1.30|503796|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039853 (Salinimonas sp. KX18D6 plasmid plas12, complete sequence) position: , mismatch: 6, identity: 0.8
atggga-gatcctgattgaaaggggagttta CRISPR spacer
-tgtaattatcctgattggagggggagttta Protospacer
** .* **********.*.**********
79. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT074137 (Bacteroides phage DAC16, complete genome) position: , mismatch: 6, identity: 0.8
aataaagaaatagtaaaaattgaaattata CRISPR spacer
aaaaaagaattagtaaaaattgaaaatcag Protospacer
** ****** *************** * .
80. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT074142 (Bacteroides phage DAC23, complete genome) position: , mismatch: 6, identity: 0.8
aataaagaaatagtaaaaattgaaattata CRISPR spacer
aaaaaagaattagtaaaaattgaaaatcag Protospacer
** ****** *************** * .
81. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041064 (Bacillus megaterium strain KNU-01 plasmid pKNU_01_1, complete sequence) position: , mismatch: 6, identity: 0.8
aataaagaaatagtaaaaattgaaattata CRISPR spacer
tttcatgatataataaaaattgaaattata Protospacer
* * ** ***.*****************
82. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to CP041518 (Bacillus aryabhattai strain KNU10 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
aataaagaaatagtaaaaattgaaattata CRISPR spacer
tttcatgatataataaaaattgaaattata Protospacer
* * ** ***.*****************
83. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018876 (Bacillus megaterium strain JX285 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.8
aataaagaaatagtaaaaattgaaattata CRISPR spacer
tttcatgatataataaaaattgaaattata Protospacer
* * ** ***.*****************
84. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to CP003671 (Staphylococcus warneri SG1 plasmid clone pvSw2 genomic sequence) position: , mismatch: 6, identity: 0.8
aataaagaaatagtaaaaattgaaattata CRISPR spacer
attgaagaattagaaaaaattgaaattgaa Protospacer
* *.***** *** *************. *
85. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041954 (Klebsiella pneumoniae strain KP2 plasmid pKP2_8, complete sequence) position: , mismatch: 6, identity: 0.8
aataaagaaatagtaaaaattgaaattata CRISPR spacer
aataaagaaatagtaaatattttaaatgaa Protospacer
***************** *** ** *. *
86. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028885 (Borrelia turcica IST7 plasmid lp129, complete sequence) position: , mismatch: 6, identity: 0.8
aataaagaaatagtaaaaattgaaattata CRISPR spacer
aaaaccaaaacattaaaaattgaaattata Protospacer
** * .***.* *****************
87. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_011422 (Salmonella enterica subsp. enterica serovar Typhi str. 404ty plasmid pBSSB1, complete sequence) position: , mismatch: 6, identity: 0.8
aataaagaaatagtaaaaattgaaattata CRISPR spacer
aataaagaaatagtaaatattttaaatgaa Protospacer
***************** *** ** *. *
88. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014283 (Bacillus thuringiensis strain Bt185 plasmid pBT1850636, complete sequence) position: , mismatch: 6, identity: 0.8
tttttcattaactaatatttttattggttg CRISPR spacer
aacttcattaactaatatttctatttgttt Protospacer
.*****************.**** ***
89. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053838 (Aliiarcobacter faecis strain CCUG 66484 plasmid pAFAEC, complete sequence) position: , mismatch: 6, identity: 0.8
tttttcattaactaatatttttattggttg CRISPR spacer
attttcattaactaatattcttatttcatt Protospacer
******************.***** *
90. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014865 (Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK1, complete sequence) position: , mismatch: 6, identity: 0.8
tttttcattaactaatatttttattggttg CRISPR spacer
aacttcattaactaatatttctatttgttt Protospacer
.*****************.**** ***
91. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to LN835295 (Clostridium perfringens plasmid pJIR4150, complete sequence, strain JIR12708) position: , mismatch: 6, identity: 0.8
tttttcattaactaatatttttattggttg CRISPR spacer
agtcccattaataaatatttttattggttg Protospacer
*..******. *****************
92. spacer 1.39|504390|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.8
tcgtaaattgttcgttataagtcttcattt CRISPR spacer
ttagaaattgatcgttataagtcttcatca Protospacer
*.. ****** *****************.
93. spacer 1.39|504390|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR214987 (Mycoplasma cynos strain NCTC10142 plasmid 14) position: , mismatch: 6, identity: 0.8
tcgtaaattgttcgttataagtcttcattt CRISPR spacer
ttagaaattgatcgttataagtcttcatca Protospacer
*.. ****** *****************.
94. spacer 1.39|504390|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR214987 (Mycoplasma cynos strain NCTC10142 plasmid 14) position: , mismatch: 6, identity: 0.8
tcgtaaattgttcgttataagtcttcattt CRISPR spacer
ttagaaattgatcgttataagtcttcatca Protospacer
*.. ****** *****************.
95. spacer 1.43|504654|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KT070866 (Bacillus phage PBC4, complete genome) position: , mismatch: 6, identity: 0.8
gtcattgaaaaacttttattagaggtaatt CRISPR spacer
ctgattgaataacttttattacaggtattc Protospacer
* ****** *********** ***** *.
96. spacer 1.50|505116|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693447 (Marine virus AFVG_25M466, complete genome) position: , mismatch: 6, identity: 0.8
agtgaaaacaaagtatccgcatctatttga CRISPR spacer
aaagaaaacaaagtatctgcatctgattta Protospacer
*. **************.******. ** *
97. spacer 1.50|505116|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693447 (Marine virus AFVG_25M466, complete genome) position: , mismatch: 6, identity: 0.8
agtgaaaacaaagtatccgcatctatttga CRISPR spacer
aaagaaaacaaagtatctgcatctgattta Protospacer
*. **************.******. ** *
98. spacer 1.50|505116|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693479 (Marine virus AFVG_25M465, complete genome) position: , mismatch: 6, identity: 0.8
agtgaaaacaaagtatccgcatctatttga CRISPR spacer
aaagaaaacaaagtatctgcatctgattta Protospacer
*. **************.******. ** *
99. spacer 1.54|505382|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015798 (Borrelia mayonii strain MN14-1539 plasmid cp32-1, complete sequence) position: , mismatch: 6, identity: 0.8
ttagatttaaataattacgaaacaaataat CRISPR spacer
tttaatttaaataatttcgatacaaatttt Protospacer
** .************ *** ****** *
100. spacer 1.61|503138|28|NC_022998|PILER-CR matches to MN693006 (Marine virus AFVG_117M17, complete genome) position: , mismatch: 6, identity: 0.786
attcttgatcgacaagattgttaaaagt CRISPR spacer
taccctgattgacaagattgttaaaaga Protospacer
.*.****.*****************
101. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 7, identity: 0.767
ataactttaaaaaatattgacaattattat CRISPR spacer
tagaatttaaaaaatatggacaagtattaa Protospacer
.* ************ ***** *****
102. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 7, identity: 0.767
ataactttaaaaaatattgacaattattat CRISPR spacer
tagaatttaaaaaatatggacaagtattaa Protospacer
.* ************ ***** *****
103. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 7, identity: 0.767
ataactttaaaaaatattgacaattattat CRISPR spacer
tagaatttaaaaaatatggacaagtattaa Protospacer
.* ************ ***** *****
104. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 7, identity: 0.767
ataactttaaaaaatattgacaattattat CRISPR spacer
tagaatttaaaaaatatggacaagtattaa Protospacer
.* ************ ***** *****
105. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_013379 (Staphylococcus epidermidis plasmid SAP106A, complete sequence) position: , mismatch: 7, identity: 0.767
----ataactttaaaaaatattgacaattattat CRISPR spacer
tatgggaa----aaaaaatatttacaattattat Protospacer
. ** ********** ***********
106. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 7, identity: 0.767
ataactttaaaaaatattgacaattattat CRISPR spacer
tagaatttaaaaaatatggacaagtattaa Protospacer
.* ************ ***** *****
107. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047429 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-1, complete sequence) position: , mismatch: 7, identity: 0.767
ataactttaaaaaatattgacaattattat CRISPR spacer
ctatttttaaaaaatattgataatgattta Protospacer
** .***************.*** ***
108. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047429 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-1, complete sequence) position: , mismatch: 7, identity: 0.767
ataactttaaaaaatattgacaattattat CRISPR spacer
ctatttttaaaaaatattgataatgattta Protospacer
** .***************.*** ***
109. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047434 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-6) position: , mismatch: 7, identity: 0.767
ataactttaaaaaatattgacaattattat CRISPR spacer
ctatttttaaaaaatattgataatgattta Protospacer
** .***************.*** ***
110. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047438 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-1, complete sequence) position: , mismatch: 7, identity: 0.767
ataactttaaaaaatattgacaattattat CRISPR spacer
actattttaaaaaatattgataatgattta Protospacer
*. *.***************.*** ***
111. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047444 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-7) position: , mismatch: 7, identity: 0.767
ataactttaaaaaatattgacaattattat CRISPR spacer
ctatttttaaaaaatattgataatgattta Protospacer
** .***************.*** ***
112. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK275624 (Clostridium perfringens strain JXJA17 plasmid p6, complete sequence) position: , mismatch: 7, identity: 0.767
ataactttaaaaaatattgacaattattat CRISPR spacer
aagactttaaaaaatattgtgaattaagag Protospacer
* .**************** ***** *
113. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to AP013453 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-U-MedDCM-OCT-S28-C28) position: , mismatch: 7, identity: 0.767
ataactttaaaaaatattgacaattattat CRISPR spacer
gcaggtttaaaaaatgttgaaaattatttt Protospacer
..*. **********.**** ******* *
114. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to CAJDKF010000002 (Enterococcus phage vB_EfaS_159 genome assembly, contig: phage159-genome, whole genome shotgun sequence) position: , mismatch: 7, identity: 0.767
ataactttaaaaaatattgacaattattat CRISPR spacer
ataattttaaaaactattgacaaattggag Protospacer
****.******** ********* * *
115. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to AP014376 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S42-C64, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767
ataactttaaaaaatattgacaattattat CRISPR spacer
ttacctttaaaaaatattgataatccttgg Protospacer
** ****************.***. **.
116. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047445 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-8) position: , mismatch: 7, identity: 0.767
ataactttaaaaaatattgacaattattat CRISPR spacer
ctatttttaaaaaatattgataatgattta Protospacer
** .***************.*** ***
117. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053689 (Arthrobacter citreus strain NEB 577 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
ataactttaaaaaatattgacaattattat CRISPR spacer
ttttcattgaaaaatattgacaactattag Protospacer
* * **.**************.*****
118. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024394 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-2) position: , mismatch: 7, identity: 0.767
gataattacaaaaataataaaatgcgcctt CRISPR spacer
gataatttctaaaataataaaattagatta Protospacer
******* * ************* * .*
119. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024403 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-10) position: , mismatch: 7, identity: 0.767
gataattacaaaaataataaaatgcgcctt CRISPR spacer
gataatttctaaaataataaaattagatta Protospacer
******* * ************* * .*
120. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024319 (Borrelia miyamotoi strain Yekat-6 plasmid pYkt6-lp23, complete sequence) position: , mismatch: 7, identity: 0.767
gataattacaaaaataataaaatgcgcctt CRISPR spacer
gataatttctaaaataataaaattagatta Protospacer
******* * ************* * .*
121. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024393 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp41, complete sequence) position: , mismatch: 7, identity: 0.767
gataattacaaaaataataaaatgcgcctt CRISPR spacer
gataatttctaaaataataaaattagatta Protospacer
******* * ************* * .*
122. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024396 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp29, complete sequence) position: , mismatch: 7, identity: 0.767
gataattacaaaaataataaaatgcgcctt CRISPR spacer
gataatttctaaaataataaaattagatta Protospacer
******* * ************* * .*
123. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024397 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp23, complete sequence) position: , mismatch: 7, identity: 0.767
gataattacaaaaataataaaatgcgcctt CRISPR spacer
gataatttctaaaataataaaattagatta Protospacer
******* * ************* * .*
124. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024212 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-5) position: , mismatch: 7, identity: 0.767
gataattacaaaaataataaaatgcgcctt CRISPR spacer
gataatttctaaaataataaaattagatta Protospacer
******* * ************* * .*
125. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024216 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-lp23, complete sequence) position: , mismatch: 7, identity: 0.767
gataattacaaaaataataaaatgcgcctt CRISPR spacer
gataatttctaaaataataaaattagatta Protospacer
******* * ************* * .*
126. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024354 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-lp41-1, complete sequence) position: , mismatch: 7, identity: 0.767
gataattacaaaaataataaaatgcgcctt CRISPR spacer
gataatttctaaaataataaaattagatta Protospacer
******* * ************* * .*
127. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024359 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-5) position: , mismatch: 7, identity: 0.767
gataattacaaaaataataaaatgcgcctt CRISPR spacer
gataatttctaaaataataaaattagatta Protospacer
******* * ************* * .*
128. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024362 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-lp23, complete sequence) position: , mismatch: 7, identity: 0.767
gataattacaaaaataataaaatgcgcctt CRISPR spacer
gataatttctaaaataataaaattagatta Protospacer
******* * ************* * .*
129. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040855 (Lactobacillus johnsonii strain G2A plasmid unnamed1) position: , mismatch: 7, identity: 0.767
gataattacaaaaataataaaatgcgcctt CRISPR spacer
gcatattaaaaaaatattaaaatgcgcata Protospacer
* **** ******* ********** *
130. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013240 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_1, complete sequence) position: , mismatch: 7, identity: 0.767
gataattacaaaaataataaaatgcgcctt CRISPR spacer
gataattacaaaaataatgaagatagtttt Protospacer
******************.**. *..**
131. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693354 (Marine virus AFVG_25M352, complete genome) position: , mismatch: 7, identity: 0.767
gataattacaaaaataataaaatgcgcctt CRISPR spacer
catatttaaaaaaataataaaatgaatatt Protospacer
*** *** *************** .. **
132. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to AP014236 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C95A-MedDCM-OCT-S25-C36, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767
gataattacaaaaataataaa---atgcgcctt CRISPR spacer
gataattataaaaataataaagctatggat--- Protospacer
********.************ *** ..
133. spacer 1.13|502678|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to AP014378 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S43-C22, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767
acctgttttaaaaaaaccaattgaaggtgt CRISPR spacer
aaaaattttaaaaaagccaatagaaggtgg Protospacer
* .**********.***** *******
134. spacer 1.13|502678|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK715471 (Arcobacter cryaerophilus strain M830MA plasmid pM830MA, complete sequence) position: , mismatch: 7, identity: 0.767
acctgttttaaaaaaaccaattgaaggtgt CRISPR spacer
aactgttttaaaaaaagcaaatgaaatagg Protospacer
* ************** *** ****. *
135. spacer 1.13|502678|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019735 (Lactobacillus brevis strain TMW 1.2108 plasmid pl12108-1, complete sequence) position: , mismatch: 7, identity: 0.767
acctgttttaaaaaaaccaattgaaggtgt CRISPR spacer
agtggttttaaaacaaccaattgaaactat Protospacer
* . ********* ***********. *.*
136. spacer 1.13|502678|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019744 (Lactobacillus brevis strain TMW 1.2111 plasmid pl12111-1, complete sequence) position: , mismatch: 7, identity: 0.767
acctgttttaaaaaaaccaattgaaggtgt CRISPR spacer
agtggttttaaaacaaccaattgaaactat Protospacer
* . ********* ***********. *.*
137. spacer 1.15|502810|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693196 (Marine virus AFVG_25M118, complete genome) position: , mismatch: 7, identity: 0.767
tgaaaagggaaaagaaatgtcacgtcctat CRISPR spacer
tgaaaaggaaaaagaaatgccactcaatct Protospacer
********.**********.*** . * *
138. spacer 1.15|502810|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045385 (Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence) position: , mismatch: 7, identity: 0.767
tgaaaagggaaaagaaatgtca-cgtcctat CRISPR spacer
gaaaaaggcaaaagaaatgtcaccggacca- Protospacer
.****** ************* ** *.*
139. spacer 1.16|502876|30|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP053838 (Aliiarcobacter faecis strain CCUG 66484 plasmid pAFAEC, complete sequence) position: , mismatch: 7, identity: 0.767
tttttcaataactaatatttttattagttg CRISPR spacer
attttcattaactaatattcttatttcatt Protospacer
****** ***********.***** *
140. spacer 1.16|502876|30|NC_022998|CRISPRCasFinder,CRT matches to MN855981 (Bacteriophage sp. isolate 187, complete genome) position: , mismatch: 7, identity: 0.767
tttttcaataactaatatttttattagttg CRISPR spacer
tttatcaataactgatatttttataccgtc Protospacer
*** *********.********** *
141. spacer 1.16|502876|30|NC_022998|CRISPRCasFinder,CRT matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 7, identity: 0.767
tttttcaataactaatatttttattagttg CRISPR spacer
aaattcaataactaatattgtaattacatg Protospacer
**************** * **** **
142. spacer 1.16|502876|30|NC_022998|CRISPRCasFinder,CRT matches to MN694348 (Marine virus AFVG_250M382, complete genome) position: , mismatch: 7, identity: 0.767
tttttcaataactaatatttttattagttg CRISPR spacer
tttttcaataattaatctttttaacaaatt Protospacer
***********.**** ****** .*. *
143. spacer 1.17|502942|30|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP024036 (Bacillus aryabhattai strain K13 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
aaaaaggttattattagcattctacaagcc CRISPR spacer
aaaaaggttattattatccttctggataca Protospacer
**************** * ****. * .*
144. spacer 1.20|503136|30|NC_022998|CRISPRCasFinder,CRT matches to MN693006 (Marine virus AFVG_117M17, complete genome) position: , mismatch: 7, identity: 0.767
atattcttgatcgacaagattgttaaaagt CRISPR spacer
aataccctgattgacaagattgttaaaaga Protospacer
* .*.****.*****************
145. spacer 1.24|503399|31|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MF001358 (Enterococcus phage EF1, partial genome) position: , mismatch: 7, identity: 0.774
tttttttcaatacataattacttgttcataa CRISPR spacer
tttttttcaataaagaattacttgctttttt Protospacer
************ * *********.*. *
146. spacer 1.24|503399|31|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MF001361 (Enterococcus phage EF5, partial genome) position: , mismatch: 7, identity: 0.774
tttttttcaatacataattacttgttcataa CRISPR spacer
tttttttcaataaagaattacttgctttttt Protospacer
************ * *********.*. *
147. spacer 1.24|503399|31|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 7, identity: 0.774
tttttttcaatacataattacttgttcataa CRISPR spacer
attttttcaatacattattatttgtaccaag Protospacer
************** ****.**** * *.
148. spacer 1.24|503399|31|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053953 (Bacillus cereus strain FDAARGOS_798 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
tttttttcaatacataattacttgttcataa CRISPR spacer
tttttttcattagataattactttaccaata Protospacer
********* ** ********** .** *
149. spacer 1.24|503399|31|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053950 (Bacillus cereus strain FDAARGOS_799 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
tttttttcaatacataattacttgttcataa CRISPR spacer
tttttttcattagataattactttaccaata Protospacer
********* ** ********** .** *
150. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX686749 (Campylobacter coli strain Tx40 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
151. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022078 (Campylobacter jejuni strain FDAARGOS_265 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
152. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007182 (Campylobacter coli RM4661 plasmid pRM4661_48kbp, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
153. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_012216 (Pasteurella multocida plasmid pB1006, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
154. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017230 (Campylobacter jejuni strain FORC_046 isolate Not reported plasmid pFORC46.1, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
155. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_006134 (Campylobacter coli plasmid pCC31, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
156. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_006135 (Campylobacter jejuni subsp. jejuni 81-176 plasmid pTet, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
157. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007180 (Campylobacter coli RM5611 plasmid pRM5611_48kb, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
158. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017869 (Campylobacter coli strain MG1116 plasmid pCCDM116L, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
159. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
160. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045046 (Campylobacter jejuni subsp. jejuni strain NADC 20827 plasmid p20827L, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
161. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010073 (Campylobacter jejuni subsp. jejuni strain 01-1512 plasmid pCj1, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
162. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017857 (Campylobacter jejuni strain YQ2210 plasmid pCJDM210L, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
163. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023544 (Campylobacter jejuni strain CFSAN032806 plasmid pCFSAN032806, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
164. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047143 (Lactobacillus sp. C25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aacatcttcagaatcatcattatctttttt Protospacer
.*** ****.************** * *
165. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017854 (Campylobacter jejuni strain ZP3204 plasmid pCJDM204L, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
166. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to CP002030 (Campylobacter jejuni subsp. jejuni ICDCCJ07001 plasmid pTet, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
167. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028186 (Campylobacter jejuni strain CFSAN054107 plasmid pGMI16-002, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
168. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022471 (Campylobacter jejuni strain jejuni plasmid pRM1246_ERRC, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
169. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017418 (Campylobacter jejuni strain MTVDSCj13 plasmid pMTVDSCj13-1, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
170. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017419 (Campylobacter jejuni strain MTVDSCj16 plasmid pMTVDSCj16-1, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
171. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017866 (Campylobacter coli strain YF2105 plasmid pCCDM105L, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
172. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017879 (Campylobacter coli strain BG2108 plasmid pCCDM108L, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
173. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017416 (Campylobacter jejuni strain MTVDSCj07 plasmid pMTVDSCj07-1, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
174. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017872 (Campylobacter coli strain BP3183 plasmid pCCDM183, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
175. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020775 (Campylobacter jejuni strain YH002 plasmid pCJP002, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
176. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK251543 (Glaesserella parasuis strain Hps 41 plasmid pHPSO2, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
177. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK251542 (Glaesserella parasuis strain Hps 46 plasmid pHPSO1, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
178. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_022355 (Campylobacter coli CVM N29710 plasmid pN29710-1, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
179. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KJ646012 (Campylobacter jejuni strain 11601MD plasmid p11601MD, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
180. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045793 (Campylobacter coli strain CFSAN032805 plasmid p1CFSAN032805, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
181. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_017282 (Campylobacter jejuni subsp. jejuni S3 plasmid pTet, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
182. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to CP047483 (Campylobacter jejuni strain CFSAN096297 plasmid CFSAN096297, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
183. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013035 (Campylobacter coli strain HC2-48 plasmid pccdm1, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
184. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007752 (Campylobacter jejuni subsp. jejuni D42a plasmid pTet-D42a, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
185. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014745 (Campylobacter jejuni strain OD267 plasmid pCJDM67 L, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
186. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023546 (Campylobacter coli strain CFSAN032805 plasmid pCFSAN032805_1, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
187. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017026 (Campylobacter coli plasmid pCC14983A-1, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
188. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011017 (Campylobacter coli strain FB1 plasmid pFB1TET, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
189. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017030 (Campylobacter jejuni subsp. jejuni strain 14980A plasmid pCJ14980A, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
190. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014743 (Campylobacter jejuni strain WP2202 plasmid pCJDM202, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
191. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017877 (Campylobacter coli strain ZV1224 plasmid pCCDM224L, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
192. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044168 (Campylobacter jejuni strain AR-0415 plasmid pAR-0415, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
193. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040609 (Campylobacter sp. CFSAN093226 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
194. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017861 (Campylobacter jejuni strain TS1218 plasmid pCJDM218, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
195. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043764 (Campylobacter jejuni strain BfR-CA-14430 plasmid pBfR-CA-14430, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
196. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007750 (Campylobacter jejuni subsp. jejuni M129 plasmid pTet-M129, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
197. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048762 (Campylobacter jejuni strain ZS004 plasmid pCJFEX, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
198. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044170 (Campylobacter jejuni strain AR-0413 plasmid pAR-0413-1, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
199. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH760469 (Salmonella enterica strain 2016K-0796 plasmid p2016K-0796, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
200. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK541987 (Campylobacter coli strain CVM N46788F plasmid pN46788F, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
201. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK541988 (Campylobacter coli strain CVM N61740F plasmid pN61740F, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
202. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK541989 (Campylobacter coli strain CVM N61925F plasmid pN61925F, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
203. spacer 1.25|503466|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_022354 (Campylobacter jejuni subsp. jejuni 00-2544 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gacaacttcggaatcatcattatcagtagt CRISPR spacer
aaaattgtcggaatcttcattatctgtagt Protospacer
.* * . ******** ******** *****
204. spacer 1.26|503532|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MG592406 (Vibrio phage 1.022.O._10N.286.45.A10, partial genome) position: , mismatch: 7, identity: 0.767
atcagtccgagagacttaaaacaaaggagt CRISPR spacer
acatgtacgagagatttaaaacaaaggatg Protospacer
*. ** *******.*************
205. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029155 (Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
attaaaattgaaattaataatcatatttga CRISPR spacer
gtattaattgaaatcattaatcatatttgt Protospacer
.* *********.* ************
206. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029538 (Lactobacillus paracasei strain LC355 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
attaaaattgaaattaataatcatatttga CRISPR spacer
tttaaaatttaaattaataattataggagg Protospacer
******** ***********.*** *.
207. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013276 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-1-360K, complete sequence) position: , mismatch: 7, identity: 0.767
attaaaattgaaattaataatcatatttga CRISPR spacer
caaaagattgaaattaatattcatattaca Protospacer
**.************* ******* *
208. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039722 (Bacillus thuringiensis strain BT-59 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
attaaaattgaaattaataatcatatttga CRISPR spacer
caaaagattgaaattaatattcatattaca Protospacer
**.************* ******* *
209. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
attaaaattgaaattaataatcatatttga CRISPR spacer
gaggaaatagaaattaataatgatatttca Protospacer
. .**** ************ ****** *
210. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009349 (Bacillus thuringiensis HD1002 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767
attaaaattgaaattaataatcatatttga CRISPR spacer
caaaagattgaaattaatattcatattaca Protospacer
**.************* ******* *
211. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045023 (Bacillus thuringiensis strain JW-1 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
attaaaattgaaattaataatcatatttga CRISPR spacer
caaaagattgaaattaatattcatattaca Protospacer
**.************* ******* *
212. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY075650 (Escherichia coli strain GD17 plasmid pGD17-2, complete sequence) position: , mismatch: 7, identity: 0.767
attaaaattgaaattaataatcatatttga CRISPR spacer
agtaaaattgatattaataatcaagttatc Protospacer
* ********* *********** .**
213. spacer 1.29|503730|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KJ018211 (Shewanella sp. phage 1/40, complete genome) position: , mismatch: 7, identity: 0.767
atctatttcatccgtcacacttaccacatt CRISPR spacer
aagcatttcctccgtcacacttaacactgt Protospacer
* .***** ************* *** *
214. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053834 (Arcobacter cloacae strain LMG 26153 plasmid pACLO, complete sequence) position: , mismatch: 7, identity: 0.767
aataaagaaatagtaaaaattgaaattata CRISPR spacer
tctaaagaaatagtaaaaatcaaaaatcca Protospacer
******************..*** * .*
215. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_017399 (Borreliella burgdorferi N40 plasmid N40_cp9, complete sequence) position: , mismatch: 7, identity: 0.767
aataaagaaatagtaaaaattgaaattata CRISPR spacer
gttaaaaaaatagtaaaaattgcaagtcaa Protospacer
. ****.*************** ** * *
216. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031836 (Lactobacillus amylolyticus strain L5 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
aataaagaaatagtaaaaattgaaattata CRISPR spacer
gttcaagaaatagtaaaactttaaatttga Protospacer
. * ************** ** ***** *
217. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020458 (Lactobacillus amylolyticus strain L6 plasmid pL6-1, complete sequence) position: , mismatch: 7, identity: 0.767
aataaagaaatagtaaaaattgaaattata CRISPR spacer
gttcaagaaatagtaaaactttaaatttga Protospacer
. * ************** ** ***** *
218. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AF292711 (Borreliella burgdorferi N40 plasmid cp9, complete sequence) position: , mismatch: 7, identity: 0.767
aataaagaaatagtaaaaattgaaattata CRISPR spacer
gttaaaaaaatagtaaaaattgcaagtcaa Protospacer
. ****.*************** ** * *
219. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009691 (Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence) position: , mismatch: 7, identity: 0.767
aataaagaaatagtaaaaattgaaattata CRISPR spacer
aagtactcgatagtaaaaattaaaattata Protospacer
** * .************.********
220. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010092 (Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB126, complete sequence) position: , mismatch: 7, identity: 0.767
aataaagaaatagtaaaaattgaaattata CRISPR spacer
aggaaagaaaaattaaaaattgaaataact Protospacer
*. ******* * ************* *.
221. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MH617627 (Microviridae sp. isolate ctci6, complete genome) position: , mismatch: 7, identity: 0.767
aataaagaaatagtaaaaattgaaattata CRISPR spacer
aaaaaagaaatagtaaaaattatcatcaag Protospacer
** ******************. **.* .
222. spacer 1.33|503994|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN855659 (Bacteriophage sp. isolate 142, complete genome) position: , mismatch: 7, identity: 0.767
cagtatttaaaacgcaatatttttcccata CRISPR spacer
taaaatttaaaacgcaatattttgccgcga Protospacer
.*. ******************* ** *
223. spacer 1.35|504126|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MH729379 (Aerococcus phage vB_AviM_AVP, complete genome) position: , mismatch: 7, identity: 0.767
taataagttatatttcttagctaaagatgg CRISPR spacer
aataaagttatgttttttagctaaagaacg Protospacer
* *******.***.*********** *
224. spacer 1.36|504192|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015507 (Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence) position: , mismatch: 7, identity: 0.767
gaacctattaaaaatagtacaactaataga CRISPR spacer
acatttattaaaaatagtatatctaatagt Protospacer
. *..**************.* *******
225. spacer 1.36|504192|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to AP014314 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S31-C24, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767
gaacctattaaaaatagtacaactaataga CRISPR spacer
atatttattaaaaatagtacaagtagtaaa Protospacer
. *..***************** **.**.*
226. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028875 (Borreliella bavariensis PBi plasmid lp28-4_cp32-1, complete sequence) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttaattaattaatatttttaattaatc Protospacer
***** *****.*********** * . *
227. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028875 (Borreliella bavariensis PBi plasmid lp28-4_cp32-1, complete sequence) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttaattaattaatatttttaattaatc Protospacer
***** *****.*********** * . *
228. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_017240 (Borreliella afzelii PKo plasmid lp32-10, complete sequence) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttaattaattaatatttttaattaatc Protospacer
***** *****.*********** * . *
229. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN539736 (UNVERIFIED: Staphylococcus phage vB_SauM-A, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
230. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KY581279 (Staphylococcus phage pSa-3, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
231. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT411892 (Staphylococcus phage Metroid, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacaaataattttactttatt Protospacer
************ **** *****.* *
232. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KJ206562 (Staphylococcus phage 812 isolate host-range mutant 812F1, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
233. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK417514 (Staphylococcus virus Sa83, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
234. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN336263 (Staphylococcus phage Sb1M_9832, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
235. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MH107769 (Staphylococcus phage vB_SauM_0414_108, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
236. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN336262 (Staphylococcus phage Sb1M_6168, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
237. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to AY954969 (Bacteriophage G1, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
238. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK331931 (Staphylococcus phage Sa30, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
239. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KJ206563 (Staphylococcus phage 812 isolate host-range mutant K1/420, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
240. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to JX181825 (Salmonella phage STML-198, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
ttcttcattaactaatattttctctgttat Protospacer
**.******************. .** *
241. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to JX080302 (Staphylococcus phage 676Z, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
242. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN045228 (Staphylococcus phage Maine, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
243. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN047438 (Staphylococcus phage vB_SauM-515A1) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
244. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MF405094 (Staphylococcus phage JA1, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
245. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KY779849 (Staphylococcus phage qdsa002, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
246. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN336261 (Staphylococcus phage Sb1_8383, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
247. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN539737 (UNVERIFIED: Staphylococcus phage vB_SauM-C, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
248. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to EU418428 (Staphylococcus phage A5W, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
249. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KP687431 (Staphylococcus phage IME-SA1, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
250. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK417516 (Staphylococcus virus J-Sa36, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
251. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT080602 (UNVERIFIED: Staphylococcus phage vB_SauM_EW74, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
252. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KJ206561 (Staphylococcus phage 812 isolate host-range mutant K1, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
253. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KP687432 (Staphylococcus phage IME-SA2, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
254. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_047722 (Staphylococcus phage Staph1N, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
255. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_047723 (Staphylococcus phage A3R, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
256. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_047720 (Staphylococcus phage ISP complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
257. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to JX080303 (Staphylococcus phage Fi200W, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
258. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MG656408 (Staphylococcus phage B1, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
259. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KF766114 (Staphylococcus phage K, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
260. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to LR215719 (Staphylococcus phage Stab21 genome assembly, chromosome: I) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacaaataattttactttatt Protospacer
************ **** *****.* *
261. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KR902361 (Staphylococcus phage IME-SA118, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
262. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to AB853331 (Staphylococcus phage S25-4 DNA, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacaaataattttactttatt Protospacer
************ **** *****.* *
263. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MH844529 (Staphylococcus phage 812h1, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
264. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KC012913 (Staphylococcus phage Team1, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
265. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK331930 (Staphylococcus phage CH1, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
266. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to JX080305 (Staphylococcus phage P4W, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
267. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KJ206560 (Staphylococcus phage 812 isolate host-range mutant 812a, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
268. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MF398190 (Staphylococcus phage vB_SauM-fRuSau02, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
269. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to EF136589 (Staphylococcus phage 812 strain phi812 putative exonuclease, hypothetical protein, putative nuclease, hypothetical protein, putative primase, hypothetical proteins, putative ribonucleotide reduction-related protein, putative ribonucleotide reductase large subunit, putative ribonucleotide reductase minor subunit, hypothetical protein, putative oxidoreductase, hypothetical protein, and putative integration host factor genes, complete cds; and hypothetical protein gene, partial cds) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
270. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_042044 (Salmonella phage Melville, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
ttcttcattaactaatattttctctgttat Protospacer
**.******************. .** *
271. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT554104 (Staphylococcus phage ESa1, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
272. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK417515 (Staphylococcus virus Sa87, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
273. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MH844528 (Staphylococcus phage 812, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
274. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_007066 (Staphylococcus phage G1, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
275. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_022920 (Staphylococcus phage S25-3 DNA, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacaaataattttactttatt Protospacer
************ **** *****.* *
276. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to JX080304 (Staphylococcus phage MSA6, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
277. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_023573 (Staphylococcus phage phiSA012 DNA, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacaaataattttactttatt Protospacer
************ **** *****.* *
278. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_019448 (Staphylococcus phage GH15, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
279. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_023009 (Staphylococcus phage Sb-1, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
280. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053316 (Bacillus circulans strain GN03 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacaaatattttaaagtatag Protospacer
************ ******** * .* *
281. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042838 (Enterococcus sp. DA9 plasmid unnamed3) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
gttgacaataactaatatttttattagtat Protospacer
** ** *****************.**
282. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK584893 (Staphylococcus phage vBSM-A1, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
283. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN694094 (Marine virus AFVG_250M290, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttctttacctaatatttttaaagaatt Protospacer
****** *** ************ *. *
284. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693193 (Marine virus AFVG_25M440, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
taataaaaaaactaatatttttattagttg Protospacer
* * * ****************.****
285. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN539738 (UNVERIFIED: Staphylococcus phage vB_SauM-D, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
286. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT080600 (UNVERIFIED: Staphylococcus phage vB_SauM_EW71, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
287. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_019726 (Staphylococcus phage JD007, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacaaataattttactttatt Protospacer
************ **** *****.* *
288. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_047721 (Staphylococcus phage SA5, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
289. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK656892 (Staphylococcus phage vBSP-A20, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
290. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KR908644 (Staphylococcus phage IME-SA119, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
291. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MH136584 (Staphylococcus phage HYZ21, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* *
292. spacer 1.41|504522|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_018878 (Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence) position: , mismatch: 7, identity: 0.767
tcaacaaaagtcttatcatatggcattcaa CRISPR spacer
tatatattcgtattatcatatggcattcaa Protospacer
* *.* ** ******************
293. spacer 1.46|504852|30|NC_022998|CRISPRCasFinder,CRT matches to NC_012654 (Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence) position: , mismatch: 7, identity: 0.767
gtattgacatacatattttttacctataag CRISPR spacer
agattgacatacatattttttacgtttctt Protospacer
. ********************* * *
294. spacer 1.46|504852|30|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP031095 (Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence) position: , mismatch: 7, identity: 0.767
gtattgacatacatattttttacctataag CRISPR spacer
agattgacatacatattttttacgtttctt Protospacer
. ********************* * *
295. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_048827 (Vibrio phage vB_VchM_Kuja, complete genome) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
ccctcatcattttaaaaactttccatttat Protospacer
...*. *********** ********** *
296. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693393 (Marine virus AFVG_25M434, complete genome) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
atgctttaattttaaaacctttcaattttc Protospacer
* .*** *************** ****..
297. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693377 (Marine virus AFVG_25M301, complete genome) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
atgctttaattttaaaacctttcaattttc Protospacer
* .*** *************** ****..
298. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693079 (Marine virus AFVG_25M302, complete genome) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
atgctttaattttaaaacctttcaattttc Protospacer
* .*** *************** ****..
299. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP004873 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB65, complete sequence) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
attttttcattttaaaaccctttcctaatt Protospacer
******************.**.* * .*
300. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024099 (Bacillus cytotoxicus strain CH_38 plasmid pCh38_53, complete sequence) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
attttttcattttaaaaccctttcctaatt Protospacer
******************.**.* * .*
301. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047088 (Bacillus paranthracis strain BC307 plasmid pCE3, complete sequence) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
attttttcattttaaaaccctttcctaatt Protospacer
******************.**.* * .*
302. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP004862 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB53, complete sequence) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
attttttcattttaaaaccctttcctaatt Protospacer
******************.**.* * .*
303. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024105 (Bacillus cytotoxicus strain CH_23 plasmid pCh23_53, complete sequence) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
attttttcattttaaaaccctttcctaatt Protospacer
******************.**.* * .*
304. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024117 (Bacillus cytotoxicus strain CH_2 plasmid pCh2_53, complete sequence) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
attttttcattttaaaaccctttcctaatt Protospacer
******************.**.* * .*
305. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010094 (Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB55, complete sequence) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
attttttcattttaaaaccctttcctaatt Protospacer
******************.**.* * .*
306. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_020249 (Bacillus thuringiensis serovar kurstaki str. HD73 plasmid pHT73, complete sequence) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
attttttcattttaaaaccctttcctaatt Protospacer
******************.**.* * .*
307. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KF926093 (Lactococcus phage phiL47, complete genome) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
tttttgtcattttaaatcctttcaaatata Protospacer
***** ********** ****** * * .
308. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016361 (Bacillus cereus strain M13 plasmid pBCM1301, complete sequence) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
attttttcattttaaaaccctttcctaatt Protospacer
******************.**.* * .*
309. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012100 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
tatatttcatcttaaaacatttccattatc Protospacer
* * ******.******* ******** ..
310. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024121 (Bacillus cytotoxicus strain CH_1 plasmid pCh1_53, complete sequence) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
attttttcattttaaaaccctttcctaatt Protospacer
******************.**.* * .*
311. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024114 (Bacillus cytotoxicus strain CH_3 plasmid pCh3_53, complete sequence) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
attttttcattttaaaaccctttcctaatt Protospacer
******************.**.* * .*
312. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007613 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB69, complete sequence) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
attttttcattttaaaaccctttcctaatt Protospacer
******************.**.* * .*
313. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014868 (Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK4, complete sequence) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
attttttcattttaaaaccctttcctaatt Protospacer
******************.**.* * .*
314. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
tatatttcatcttaaaacatttccattatc Protospacer
* * ******.******* ******** ..
315. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011156 (Bacillus cereus strain HN001 plasmid pRML01, complete sequence) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
tatatttcatcttaaaacatttccattatc Protospacer
* * ******.******* ******** ..
316. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_020392 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-63, complete sequence) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
attttttcattttaaaaccctttcctaatt Protospacer
******************.**.* * .*
317. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024102 (Bacillus cytotoxicus strain CH_25 plasmid pCh25_53, complete sequence) position: , mismatch: 7, identity: 0.767
tttttttcattttaaaacctttccatttct CRISPR spacer
attttttcattttaaaaccctttcctaatt Protospacer
******************.**.* * .*
318. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014283 (Bacillus thuringiensis strain Bt185 plasmid pBT1850636, complete sequence) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggtca CRISPR spacer
aacttcattaactaatatttctatttgttt Protospacer
.*****************.**** **.
319. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014865 (Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK1, complete sequence) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggtca CRISPR spacer
aacttcattaactaatatttctatttgttt Protospacer
.*****************.**** **.
320. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to AP013399 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G15, isolate: uvMED-CGR-U-MedDCM-OCT-S40-C42) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggtca CRISPR spacer
gagcacattagataatatttttattggtca Protospacer
. *****. ******************
321. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007000 (Campylobacter fetus subsp. venerealis cfvi03/293 plasmid pCfviMP1, complete sequence) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattgactaatttttttagttcttg Protospacer
*********.****** ****** * *..
322. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042838 (Enterococcus sp. DA9 plasmid unnamed3) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggtca CRISPR spacer
gttgacaataactaatatttttattagtat Protospacer
** ** *****************.**
323. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_021277 (Fusobacterium nucleatum subsp. animalis 4_8 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tttttcattaactaatattttta-----ttggtca CRISPR spacer
tttttcatctactaatatttttaaattctt----- Protospacer
********. ************* **
324. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to JX181825 (Salmonella phage STML-198, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggtca CRISPR spacer
ttcttcattaactaatattttctctgttat Protospacer
**.******************. .** *
325. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693957 (Marine virus AFVG_250M449, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaactaaaattttagtatgacc Protospacer
*************** ***** .* * *
326. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_042044 (Salmonella phage Melville, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttattggtca CRISPR spacer
ttcttcattaactaatattttctctgttat Protospacer
**.******************. .** *
327. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693161 (Marine virus AFVG_25M297, complete genome) position: , mismatch: 7, identity: 0.767
tttttcattaactaatatttttat-tggtca CRISPR spacer
aagttcatcaactaatatttttatattatc- Protospacer
*****.*************** * .**
328. spacer 1.49|505050|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_042112 (Campylobacter phage CP81, complete genome) position: , mismatch: 7, identity: 0.767
acattttcgttcaataaaaaatccaatcta CRISPR spacer
acattttcattaaataaaaaatcatattat Protospacer
********.** *********** **.
329. spacer 1.49|505050|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MH107028 (Campylobacter phage CP39, partial genome) position: , mismatch: 7, identity: 0.767
acattttcgttcaataaaaaatccaatcta CRISPR spacer
acattttcattaaataaaaaatcatattat Protospacer
********.** *********** **.
330. spacer 1.49|505050|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_015464 (Campylobacter phage NCTC12673, complete genome) position: , mismatch: 7, identity: 0.767
acattttcgttcaataaaaaatccaatcta CRISPR spacer
acattttcattaaataaaaaatcatataat Protospacer
********.** *********** **
331. spacer 1.49|505050|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KF148616 (Campylobacter phage CP8, complete genome) position: , mismatch: 7, identity: 0.767
acattttcgttcaataaaaaatccaatcta CRISPR spacer
acattttcattaaataaaaaatcatattat Protospacer
********.** *********** **.
332. spacer 1.49|505050|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_016562 (Campylobacter phage CPX, complete genome) position: , mismatch: 7, identity: 0.767
acattttcgttcaataaaaaatccaatcta CRISPR spacer
acattttcattaaataaaaaatcatattat Protospacer
********.** *********** **.
333. spacer 1.49|505050|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KX236333 (Campylobacter phage PC14, complete genome) position: , mismatch: 7, identity: 0.767
acattttcgttcaataaaaaatccaatcta CRISPR spacer
acattttcattaaataaaaaatcatataat Protospacer
********.** *********** **
334. spacer 1.49|505050|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to JX569801 (Campylobacter phage CP30A, complete genome) position: , mismatch: 7, identity: 0.767
acattttcgttcaataaaaaatccaatcta CRISPR spacer
acattttcattaaataaaaaatcatattat Protospacer
********.** *********** **.
335. spacer 1.50|505116|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_017507 (Marinobacter adhaerens HP15 plasmid pHP-187, complete sequence) position: , mismatch: 7, identity: 0.767
agtgaaaacaaagtatccgcatctatttga CRISPR spacer
ggatcgaacaaaatatccgcatcaatttga Protospacer
.* .******.********** ******
336. spacer 1.54|505382|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to AP014008 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C62A-MedDCM-OCT-S41-C20, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767
ttagatttaaataattacgaaacaaataat CRISPR spacer
accaaattaaatatgtacgaaacaaataat Protospacer
. .* ******* ***************
337. spacer 1.54|505382|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_047711 (Uncultured phage_MedDCM-OCT-S28-C10 DNA, complete genome, group G8, isolate: uvMED-CGR-C62A-MedDCM-OCT-S28-C10) position: , mismatch: 7, identity: 0.767
ttagatttaaataattacgaaacaaataat CRISPR spacer
accaaattaaatatgtacgaaacaaataat Protospacer
. .* ******* ***************
338. spacer 1.54|505382|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to AP014009 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C62A-MedDCM-OCT-S45-C17, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767
ttagatttaaataattacgaaacaaataat CRISPR spacer
accaaattaaatatgtacgaaacaaataat Protospacer
. .* ******* ***************
339. spacer 1.54|505382|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN694292 (Marine virus AFVG_250M289, complete genome) position: , mismatch: 7, identity: 0.767
ttagatttaaataattacgaaacaaataat CRISPR spacer
ctttatttaaaaaattaccaaacaaatcct Protospacer
.* ******* ****** ******** *
340. spacer 1.54|505382|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028327 (Lactobacillus sp. D1501 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
ttagatttaaataattacgaaacaaataat CRISPR spacer
aaaaaaataaatagttacgaaacaattaat Protospacer
*.* ******.*********** ****
341. spacer 1.6|502215|30|NC_022998|CRISPRCasFinder,CRT matches to KT372714 (Bacillus phage vB_BtS_BMBtp16, complete genome) position: , mismatch: 8, identity: 0.733
attttgccgataaaggatttgcaagttgaa CRISPR spacer
tgattgcagataaaggatttgcaacaggag Protospacer
**** **************** **.
342. spacer 1.6|502215|30|NC_022998|CRISPRCasFinder,CRT matches to MN065183 (Bacillus phage vB_BthS-HD29phi, complete genome) position: , mismatch: 8, identity: 0.733
attttgccgataaaggatttgcaagttgaa CRISPR spacer
tgattgctgataaaggatttgcaacaggag Protospacer
****.**************** **.
343. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035407 (Bacillus subtilis strain SRCM103612 plasmid unnamed1) position: , mismatch: 8, identity: 0.733
ataactttaaaaaatattgacaattattat CRISPR spacer
ttggagttaaaaaatattgtcaattcttac Protospacer
*.. ************* ***** ***.
344. spacer 1.8|502347|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KU522583 (Enterobacteria phage ECGD1, complete genome) position: , mismatch: 8, identity: 0.733
ataactttaaaaaatattgacaattattat CRISPR spacer
tatgctttaaaaaatattgaggattatctt Protospacer
.**************** .*****. *
345. spacer 1.9|502413|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041195 (Weissella cibaria strain CBA3612 plasmid pCBA3612-02, complete sequence) position: , mismatch: 8, identity: 0.733
aaacttaagatatttgctatcgtaactttt CRISPR spacer
ttggtaaagatatttgctaacgtaccttta Protospacer
. * ************* **** ****
346. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_014508 (Enterococcus faecalis plasmid pEF-01, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
347. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX274135 (Staphylococcus arlettae strain SA-01 plasmid pSA-01, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
348. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK798157 (Enterococcus hirae strain fas4 plasmid pfas4-1, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
349. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020005 (Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
aataattacaaatataataaaaaatactat Protospacer
.*********** ********* ...*. *
350. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028839 (Enterococcus faecalis strain FC plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
351. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN831412 (Enterococcus faecalis strain M18/0011 plasmid pM18/0011, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
352. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP037957 (Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_2, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
353. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038165 (Enterococcus faecium strain HB2-2 plasmid pHB2-2, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
354. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038167 (Enterococcus faecium strain SC3-1 plasmid pSC3-1, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
355. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038171 (Enterococcus faecium strain SDGJP3 plasmid pSDGJP3, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
356. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038162 (Enterococcus faecium strain GZ8 plasmid pGZ8, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
357. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038176 (Enterococcus faecium strain HN11 plasmid pHN11, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
358. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT074685 (Enterococcus faecium strain T-E1077-31 plasmid pT-E1077-31, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
359. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT074685 (Enterococcus faecium strain T-E1077-31 plasmid pT-E1077-31, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
360. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT074684 (Enterococcus faecium strain E1077 plasmid pE1077-23, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
361. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH784601 (Enterococcus faecium strain 25 plasmid pC25-1, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
362. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH784602 (Enterococcus faecium strain 27 plasmid pC27-2, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
363. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK140642 (Enterococcus faecalis strain E076 plasmid pE076, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
364. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK140641 (Enterococcus faecalis strain E035 plasmid pE035, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
365. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK861852 (Enterococcus faecalis strain C10 plasmid pC10, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaattaaaaaaataatcaaatgcaaaat Protospacer
. ****** ********* ******. *
366. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG205643 (Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
gataatttaaaaaataataaaatagcatat Protospacer
******* **************. . *
367. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693124 (Marine virus AFVG_25M44, complete genome) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
gattattacaaaaataaaaaaattgaaact Protospacer
*** ************* ***** . .*
368. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_014663 (Acinetobacter phage Acj9, complete genome) position: , mismatch: 8, identity: 0.733
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attgattacaaaaatgctaaaatgcgctgc Protospacer
. *.***********. **********. .
369. spacer 1.13|502678|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KX456209 (Lactococcus phage 56701, complete genome) position: , mismatch: 8, identity: 0.733
acctgttttaaaaaaaccaattgaaggtgt CRISPR spacer
atatgttttaaaaaaagcaattgaattaaa Protospacer
*. ************* ******** .
370. spacer 1.13|502678|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to AP013388 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G15, isolate: uvMED-CGR-C54-MedDCM-OCT-S36-C37) position: , mismatch: 8, identity: 0.733
acctgttttaaaaaaaccaattgaaggtgt CRISPR spacer
taaaaatttaaaaaaaccaaatgaaggtat Protospacer
. ************** *******.*
371. spacer 1.13|502678|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KX456213 (Lactococcus phage 98201, complete genome) position: , mismatch: 8, identity: 0.733
acctgttttaaaaaaaccaattgaaggtgt CRISPR spacer
atatgttttaaaaaaagcaattgaattaaa Protospacer
*. ************* ******** .
372. spacer 1.13|502678|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_002799 (Lactococcus lactis plasmid pCRL291.1, complete sequence) position: , mismatch: 8, identity: 0.733
acctgttttaaaaaaaccaattgaaggtgt CRISPR spacer
gaatgtgttaaaaaaagcaattgaagaaat Protospacer
. *** ********* *********. .*
373. spacer 1.14|502744|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 8, identity: 0.733
gattttgtcatcatagacataatcgttgta CRISPR spacer
cgtagcttcatcatagacataatcgtcgtt Protospacer
.* . *******************.**
374. spacer 1.14|502744|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK448818 (Streptococcus phage Javan597, complete genome) position: , mismatch: 8, identity: 0.733
gattttgtcatcatagacataatcgttgta CRISPR spacer
acaacagtcaagatagacataatcgttgta Protospacer
. . **** ******************
375. spacer 1.14|502744|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 8, identity: 0.733
gattttgtcatcatagacataatcgttgta CRISPR spacer
gattttgtcatcaaagaaataataaattcc Protospacer
************* *** ***** . * .
376. spacer 1.16|502876|30|NC_022998|CRISPRCasFinder,CRT matches to CP042209 (Acinetobacter baumannii strain DS002 plasmid pTS37365, complete sequence) position: , mismatch: 8, identity: 0.733
tttttcaataactaatatttttattagttg CRISPR spacer
gttttctataactaatatttatatgaaagc Protospacer
***** ************* *** *.
377. spacer 1.16|502876|30|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP034470 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence) position: , mismatch: 8, identity: 0.733
tttttcaataactaatatttttattagttg CRISPR spacer
tttttcaataaataatctttttaccttctt Protospacer
*********** **** ******.. .*
378. spacer 1.16|502876|30|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP034475 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence) position: , mismatch: 8, identity: 0.733
tttttcaataactaatatttttattagttg CRISPR spacer
tttttcaataaataatctttttaccttctt Protospacer
*********** **** ******.. .*
379. spacer 1.16|502876|30|NC_022998|CRISPRCasFinder,CRT matches to AP014503 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S42-C30, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 8, identity: 0.733
tttttcaataactaatatttttattagttg CRISPR spacer
ctaaacaataactaatatttgtattattaa Protospacer
.* *************** ***** * .
380. spacer 1.22|503268|29|NC_022998|CRISPRCasFinder,CRT matches to MN693705 (Marine virus AFVG_250M220, complete genome) position: , mismatch: 8, identity: 0.724
aaaatatgaatacaatgcagacggaaaag CRISPR spacer
taaatatgaatacaatgaagatggctcta Protospacer
**************** ***.** .
381. spacer 1.24|503399|31|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK288022 (Bacillus phage pW4, complete genome) position: , mismatch: 8, identity: 0.742
tttttttcaatacataattacttgttcataa CRISPR spacer
tttttttctatacataattattttgactttt Protospacer
******** ***********.** * *
382. spacer 1.24|503399|31|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KT070866 (Bacillus phage PBC4, complete genome) position: , mismatch: 8, identity: 0.742
tttttttcaatacataattacttgttcataa CRISPR spacer
tttttttctatacataattattttgactttt Protospacer
******** ***********.** * *
383. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MW067001 (CrAssphage sp. C0521BW15, complete genome) position: , mismatch: 8, identity: 0.733
attaaaattgaaattaataatcatatttga CRISPR spacer
tttaaaactgaaattaataatcttaaaaat Protospacer
******.************** ** .
384. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MW067003 (CrAssphage sp. C0531BW4, complete genome) position: , mismatch: 8, identity: 0.733
attaaaattgaaattaataatcatatttga CRISPR spacer
tttaaaactgaaattaataatcttaaaaat Protospacer
******.************** ** .
385. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK238400 (CrAssphage ZA, complete genome) position: , mismatch: 8, identity: 0.733
attaaaattgaaattaataatcatatttga CRISPR spacer
tttaaaactgaaattaataatcttaaaaat Protospacer
******.************** ** .
386. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MW067000 (CrAssphage sp. C0521BD4, complete genome) position: , mismatch: 8, identity: 0.733
attaaaattgaaattaataatcatatttga CRISPR spacer
tttaaaactgaaattaataatcttaaaaat Protospacer
******.************** ** .
387. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK069403 (UNVERIFIED: CrAssphage sp. O-152, partial genome) position: , mismatch: 8, identity: 0.733
attaaaattgaaattaataatcatatttga CRISPR spacer
tttaaaactgaaattaataatcttaaaaat Protospacer
******.************** ** .
388. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to BK010471 (TPA_asm: Uncultured crAssphage, complete genome) position: , mismatch: 8, identity: 0.733
attaaaattgaaattaataatcatatttga CRISPR spacer
tttaaaactgaaattaataatcttaaaaat Protospacer
******.************** ** .
389. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MW067002 (CrAssphage sp. C0526BW15, complete genome) position: , mismatch: 8, identity: 0.733
attaaaattgaaattaataatcatatttga CRISPR spacer
tttaaaactgaaattaataatcttaaaaat Protospacer
******.************** ** .
390. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_024711 (Uncultured crAssphage, complete genome) position: , mismatch: 8, identity: 0.733
attaaaattgaaattaataatcatatttga CRISPR spacer
tttaaaactgaaattaataatcttaaaaat Protospacer
******.************** ** .
391. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to JQ995537 (Uncultured phage crAssphage, complete genome) position: , mismatch: 8, identity: 0.733
attaaaattgaaattaataatcatatttga CRISPR spacer
tttaaaactgaaattaataatcttaaaaat Protospacer
******.************** ** .
392. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT006214 (CrAssphage LMMB, complete genome) position: , mismatch: 8, identity: 0.733
attaaaattgaaattaataatcatatttga CRISPR spacer
tttaaaactgaaattaataatcttaaaaat Protospacer
******.************** ** .
393. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK415404 (CrAssphage FA1-2_000172F, complete genome) position: , mismatch: 8, identity: 0.733
attaaaattgaaattaataatcatatttga CRISPR spacer
tttaaaactgaaattaataatcttaaaaat Protospacer
******.************** ** .
394. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK415403 (CrAssphage ES_ALL_000190F, complete genome) position: , mismatch: 8, identity: 0.733
attaaaattgaaattaataatcatatttga CRISPR spacer
tttaaaactgaaattaataatcttaaaaat Protospacer
******.************** ** .
395. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK415410 (CrAssphage YS1-2_2437, complete genome) position: , mismatch: 8, identity: 0.733
attaaaattgaaattaataatcatatttga CRISPR spacer
tttaaaactgaaattaataatcttaaaaat Protospacer
******.************** ** .
396. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK415399 (CrAssphage apr34_000142F, complete genome) position: , mismatch: 8, identity: 0.733
attaaaattgaaattaataatcatatttga CRISPR spacer
tttaaaactgaaattaataatcttaaaaat Protospacer
******.************** ** .
397. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK415408 (CrAssphage GF1-2_000079F, complete genome) position: , mismatch: 8, identity: 0.733
attaaaattgaaattaataatcatatttga CRISPR spacer
tttaaaactgaaattaataatcttaaaaat Protospacer
******.************** ** .
398. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 8, identity: 0.733
attaaaattgaaattaataatcatatttga CRISPR spacer
ttaattatagaaattaataatcatattatt Protospacer
* * ** ******************
399. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT773554 (Myoviridae sp. isolate BML_2 genomic sequence) position: , mismatch: 8, identity: 0.733
attaaaattgaaattaataatcatatttga CRISPR spacer
gagattattgaaattaatgatcatattcaa Protospacer
. * ************.********..*
400. spacer 1.27|503598|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MH616667 (Microviridae sp. isolate ctcb952, complete genome) position: , mismatch: 8, identity: 0.733
attaaaattgaaattaataatcatatttga CRISPR spacer
actaaaaatgaaattaataaccataacaat Protospacer
*.***** ************.**** . .
401. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 8, identity: 0.733
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
tcttcatttttcaataaaaaattcaattta Protospacer
* . *. ******************.**
402. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053953 (Bacillus cereus strain FDAARGOS_798 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
acgattttgttcaataaataattttactct Protospacer
*******.********** ****. *...
403. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048772 (Campylobacter jejuni strain ZS007 plasmid pCJ145K, complete sequence) position: , mismatch: 8, identity: 0.733
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
tctatttcgttaaataaaaaattctccttg Protospacer
* ******** ************ ..*.
404. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053950 (Bacillus cereus strain FDAARGOS_799 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
acgattttgttcaataaataattttactct Protospacer
*******.********** ****. *...
405. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN270261 (Streptococcus phage phi-SsuFJNP8_rum, complete genome) position: , mismatch: 8, identity: 0.733
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
gaggcttcgttcagtaaaaaaatcaatcgg Protospacer
. *..********.******* ****** .
406. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KT001919 (Klebsiella phage Miro, complete genome) position: , mismatch: 8, identity: 0.733
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
tcgatttcgatcaagaaaaaattcgcaatg Protospacer
******** **** *********. *.
407. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KT001918 (Klebsiella phage Matisse, complete genome) position: , mismatch: 8, identity: 0.733
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
tcgatttcgatcaagaaaaaattcgcaatg Protospacer
******** **** *********. *.
408. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN508621 (UNVERIFIED: Enterobacter phage EC-W1, complete genome) position: , mismatch: 8, identity: 0.733
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
tcgatttcgatcaagaaaaaattcgcaatg Protospacer
******** **** *********. *.
409. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT341500 (Enterobacter phage EBPL, complete genome) position: , mismatch: 8, identity: 0.733
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
tcgatttcgatcaagaaaaaattcgcaatg Protospacer
******** **** *********. *.
410. spacer 1.29|503730|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014581 (Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence) position: , mismatch: 8, identity: 0.733
atctatttcatccgtcacacttaccacatt CRISPR spacer
ctggttttaatccgccacacttaccacaag Protospacer
* *** *****.*************
411. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015326 (Bacillus filamentosus strain Hbe603 plasmid pBEH4, complete sequence) position: , mismatch: 8, identity: 0.733
aataaagaaatagtaaaaattgaaattata CRISPR spacer
tctaaagaaataggaaaaattgatgtttac Protospacer
*********** ********* .**
412. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028161 (Lactococcus lactis subsp. lactis strain 14B4 plasmid p14B4, complete sequence) position: , mismatch: 8, identity: 0.733
aataaagaaatagtaaaaattgaaattata CRISPR spacer
aataaagaaattgaaaaaattgagcgaaag Protospacer
*********** * *********. * .
413. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016589 (Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence) position: , mismatch: 8, identity: 0.733
aataaagaaatagtaaaaattgaaattata CRISPR spacer
aataaagaaatagtaaaatttcacgtacct Protospacer
****************** ** * .* .
414. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KC821624 (Cellulophaga phage phi14:2, complete genome) position: , mismatch: 8, identity: 0.733
aataaagaaatagtaaaaattgaaattata CRISPR spacer
cgggaagaaatagaaaaaatagaaattgaa Protospacer
. .********* ****** ******. *
415. spacer 1.35|504126|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KF114880 (Leptospira phage LinZ_10, complete genome) position: , mismatch: 8, identity: 0.733
taataagttatatttcttagctaaagatgg CRISPR spacer
cgataatttatttttcttagctaaatcgcg Protospacer
..**** **** ************* *
416. spacer 1.35|504126|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KF114879 (Leptospira phage LbrZ_5399, complete genome) position: , mismatch: 8, identity: 0.733
taataagttatatttcttagctaaagatgg CRISPR spacer
cgataatttatttttcttagctaaatcgcg Protospacer
..**** **** ************* *
417. spacer 1.35|504126|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KX656785 (UNVERIFIED: Leptospira phage Lin_34, complete genome) position: , mismatch: 8, identity: 0.733
taataagttatatttcttagctaaagatgg CRISPR spacer
cgataatttatttttcttagctaaatcgcg Protospacer
..**** **** ************* *
418. spacer 1.36|504192|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_011775 (Bacillus cereus G9842 plasmid pG9842_209, complete sequence) position: , mismatch: 8, identity: 0.733
gaacctattaaaaatagtacaactaataga CRISPR spacer
gtttagtttaaaaattgtactactaataga Protospacer
* . ******** **** *********
419. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KR131710 (Fusobacterium phage Funu1, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggttg CRISPR spacer
aagttcattaactaatttttttattctatc Protospacer
************* ******** *
420. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_021277 (Fusobacterium nucleatum subsp. animalis 4_8 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcatctactaatatttttaaattctt Protospacer
********. ************* .*
421. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693957 (Marine virus AFVG_250M449, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggttg CRISPR spacer
tttttcattaactaaaattttagtatgacc Protospacer
*************** ***** .* * .
422. spacer 1.44|504720|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN966730 (Vibrio phage Cilsick, complete genome) position: , mismatch: 8, identity: 0.733
ggttcatagcttttgaacaaccacaacttt CRISPR spacer
ttaacttaggttttgaacaaccactacttg Protospacer
* *** ************** ****
423. spacer 1.44|504720|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT460516 (Vibrio phage Quinn, complete genome) position: , mismatch: 8, identity: 0.733
ggttcatagcttttgaacaaccacaacttt CRISPR spacer
ttaacttaggttttgaacaaccactacttg Protospacer
* *** ************** ****
424. spacer 1.44|504720|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT460515 (Vibrio phage Cody, complete genome) position: , mismatch: 8, identity: 0.733
ggttcatagcttttgaacaaccacaacttt CRISPR spacer
ttaacttaggttttgaacaaccactacttg Protospacer
* *** ************** ****
425. spacer 1.44|504720|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT448616 (Vibrio phage BBMuffin, complete genome) position: , mismatch: 8, identity: 0.733
ggttcatagcttttgaacaaccacaacttt CRISPR spacer
ttaacttaggttttgaacaaccactacttg Protospacer
* *** ************** ****
426. spacer 1.44|504720|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT460514 (Vibrio phage AG74, complete genome) position: , mismatch: 8, identity: 0.733
ggttcatagcttttgaacaaccacaacttt CRISPR spacer
ttaacttaggttttgaacaaccactacttg Protospacer
* *** ************** ****
427. spacer 1.44|504720|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK796244 (Vibrio phage Achelous, complete genome) position: , mismatch: 8, identity: 0.733
ggttcatagcttttgaacaaccacaacttt CRISPR spacer
ttaacttaggttttgaacaaccactacttg Protospacer
* *** ************** ****
428. spacer 1.44|504720|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT460518 (Vibrio phage Direpillow8, complete genome) position: , mismatch: 8, identity: 0.733
ggttcatagcttttgaacaaccacaacttt CRISPR spacer
ttaacttaggttttgaacaaccactacttg Protospacer
* *** ************** ****
429. spacer 1.44|504720|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN966731 (Vibrio phage Chazly21, complete genome) position: , mismatch: 8, identity: 0.733
ggttcatagcttttgaacaaccacaacttt CRISPR spacer
ttaacttaggttttgaacaaccactacttg Protospacer
* *** ************** ****
430. spacer 1.44|504720|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK907780 (Vibrio phage Pontus, complete genome) position: , mismatch: 8, identity: 0.733
ggttcatagcttttgaacaaccacaacttt CRISPR spacer
ttaacttaggttttgaacaaccactacttg Protospacer
* *** ************** ****
431. spacer 1.44|504720|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK895508 (Vibrio phage Brizo, complete genome) position: , mismatch: 8, identity: 0.733
ggttcatagcttttgaacaaccacaacttt CRISPR spacer
ttaacttaggttttgaacaaccactacttg Protospacer
* *** ************** ****
432. spacer 1.44|504720|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN958086 (Vibrio phage Bennett, complete genome) position: , mismatch: 8, identity: 0.733
ggttcatagcttttgaacaaccacaacttt CRISPR spacer
ttaacttaggttttgaacaaccactacttg Protospacer
* *** ************** ****
433. spacer 1.44|504720|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT460517 (Vibrio phage Athena, complete genome) position: , mismatch: 8, identity: 0.733
ggttcatagcttttgaacaaccacaacttt CRISPR spacer
ttaacttaggttttgaacaaccactacttg Protospacer
* *** ************** ****
434. spacer 1.44|504720|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT459144 (Vibrio phage Dax, complete genome) position: , mismatch: 8, identity: 0.733
ggttcatagcttttgaacaaccacaacttt CRISPR spacer
ttaacttaggttttgaacaaccactacttg Protospacer
* *** ************** ****
435. spacer 1.44|504720|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN966732 (Vibrio phage Chester, complete genome) position: , mismatch: 8, identity: 0.733
ggttcatagcttttgaacaaccacaacttt CRISPR spacer
ttaacttaggttttgaacaaccactacttg Protospacer
* *** ************** ****
436. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014569 (Campylobacter fetus subsp. venerealis strain 01/165 plasmid mp1, complete sequence) position: , mismatch: 8, identity: 0.733
tttttttcattttaaaacctttccatttct CRISPR spacer
tttttttcattttaaatccttagttgttaa Protospacer
**************** **** . **
437. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007066 (Fusobacterium nucleatum subsp. vincentii 3_1_27 plasmid, complete sequence) position: , mismatch: 8, identity: 0.733
tttttttcattttaaaacctttccatttct CRISPR spacer
atctttttattctaaaacctttccataaag Protospacer
*.****.***.**************
438. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to CP002030 (Campylobacter jejuni subsp. jejuni ICDCCJ07001 plasmid pTet, complete sequence) position: , mismatch: 8, identity: 0.733
tttttttcattttaaaacctttccatttct CRISPR spacer
tttttttcattttaaatccttgtatttaaa Protospacer
**************** **** . **
439. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK496721 (Capybara microvirus Cap1_SP_135, complete genome) position: , mismatch: 8, identity: 0.733
tttttttcattttaaaacctttccatttct CRISPR spacer
tttttttcattttatgacctttcacagtaa Protospacer
************** .******* *
440. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045273 (Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence) position: , mismatch: 8, identity: 0.733
tttttttcattttaaaacctttccatttct CRISPR spacer
tttttttcatttaaagacctttctttgata Protospacer
************ **.*******. * .
441. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026601 (Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
tttttttcattttaaaacctttccatttct CRISPR spacer
attttttcattttaaaacttttttaataac Protospacer
*****************.***..* * .
442. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007000 (Campylobacter fetus subsp. venerealis cfvi03/293 plasmid pCfviMP1, complete sequence) position: , mismatch: 8, identity: 0.733
tttttttcattttaaaacctttccatttct CRISPR spacer
tttttttcattttaaatccttagttgttaa Protospacer
**************** **** . **
443. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP019824 (Leptotrichia hofstadii strain JCM16775 plasmid pJCM16775-1, complete sequence) position: , mismatch: 8, identity: 0.733
tttttttcattttaaaacctttccatttct CRISPR spacer
tttttctcattttaaaaccttctttcgtcc Protospacer
*****.***************... . **.
444. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053316 (Bacillus circulans strain GN03 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacaaatattttaaagtatag Protospacer
************ ******** * .* .
445. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to LN835295 (Clostridium perfringens plasmid pJIR4150, complete sequence, strain JIR12708) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
agtcccattaataaatatttttattggttg Protospacer
*..******. ***************..
446. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN539736 (UNVERIFIED: Staphylococcus phage vB_SauM-A, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
447. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KY581279 (Staphylococcus phage pSa-3, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
448. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT411892 (Staphylococcus phage Metroid, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacaaataattttactttatt Protospacer
************ **** *****.* .
449. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KJ206562 (Staphylococcus phage 812 isolate host-range mutant 812F1, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
450. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK417514 (Staphylococcus virus Sa83, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
451. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK584893 (Staphylococcus phage vBSM-A1, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
452. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN336263 (Staphylococcus phage Sb1M_9832, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
453. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN694094 (Marine virus AFVG_250M290, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttctttacctaatatttttaaagaatt Protospacer
****** *** ************ *. .
454. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MH107769 (Staphylococcus phage vB_SauM_0414_108, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
455. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN336262 (Staphylococcus phage Sb1M_6168, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
456. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to AY954969 (Bacteriophage G1, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
457. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN539738 (UNVERIFIED: Staphylococcus phage vB_SauM-D, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
458. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK331931 (Staphylococcus phage Sa30, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
459. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT080600 (UNVERIFIED: Staphylococcus phage vB_SauM_EW71, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
460. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KJ206563 (Staphylococcus phage 812 isolate host-range mutant K1/420, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
461. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to JX080302 (Staphylococcus phage 676Z, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
462. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN045228 (Staphylococcus phage Maine, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
463. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN047438 (Staphylococcus phage vB_SauM-515A1) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
464. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MF405094 (Staphylococcus phage JA1, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
465. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KY779849 (Staphylococcus phage qdsa002, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
466. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN336261 (Staphylococcus phage Sb1_8383, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
467. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN539737 (UNVERIFIED: Staphylococcus phage vB_SauM-C, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
468. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to EU418428 (Staphylococcus phage A5W, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
469. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KP687431 (Staphylococcus phage IME-SA1, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
470. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK417516 (Staphylococcus virus J-Sa36, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
471. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT080602 (UNVERIFIED: Staphylococcus phage vB_SauM_EW74, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
472. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_019726 (Staphylococcus phage JD007, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacaaataattttactttatt Protospacer
************ **** *****.* .
473. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KJ206561 (Staphylococcus phage 812 isolate host-range mutant K1, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
474. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_047721 (Staphylococcus phage SA5, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
475. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KP687432 (Staphylococcus phage IME-SA2, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
476. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_047722 (Staphylococcus phage Staph1N, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
477. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK656892 (Staphylococcus phage vBSP-A20, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
478. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_047723 (Staphylococcus phage A3R, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
479. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_047720 (Staphylococcus phage ISP complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
480. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to JX080303 (Staphylococcus phage Fi200W, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
481. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MG656408 (Staphylococcus phage B1, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
482. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KF766114 (Staphylococcus phage K, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
483. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to LR215719 (Staphylococcus phage Stab21 genome assembly, chromosome: I) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacaaataattttactttatt Protospacer
************ **** *****.* .
484. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KR902361 (Staphylococcus phage IME-SA118, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
485. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to AB853331 (Staphylococcus phage S25-4 DNA, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacaaataattttactttatt Protospacer
************ **** *****.* .
486. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MH844529 (Staphylococcus phage 812h1, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
487. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KC012913 (Staphylococcus phage Team1, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
488. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK331930 (Staphylococcus phage CH1, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
489. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to JX080305 (Staphylococcus phage P4W, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
490. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KJ206560 (Staphylococcus phage 812 isolate host-range mutant 812a, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
491. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MF398190 (Staphylococcus phage vB_SauM-fRuSau02, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
492. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to EF136589 (Staphylococcus phage 812 strain phi812 putative exonuclease, hypothetical protein, putative nuclease, hypothetical protein, putative primase, hypothetical proteins, putative ribonucleotide reduction-related protein, putative ribonucleotide reductase large subunit, putative ribonucleotide reductase minor subunit, hypothetical protein, putative oxidoreductase, hypothetical protein, and putative integration host factor genes, complete cds; and hypothetical protein gene, partial cds) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
493. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KR908644 (Staphylococcus phage IME-SA119, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
494. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT554104 (Staphylococcus phage ESa1, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
495. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK417515 (Staphylococcus virus Sa87, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
496. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MH844528 (Staphylococcus phage 812, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
497. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_007066 (Staphylococcus phage G1, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
498. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_022920 (Staphylococcus phage S25-3 DNA, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacaaataattttactttatt Protospacer
************ **** *****.* .
499. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to JX080304 (Staphylococcus phage MSA6, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
500. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_023573 (Staphylococcus phage phiSA012 DNA, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacaaataattttactttatt Protospacer
************ **** *****.* .
501. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MH136584 (Staphylococcus phage HYZ21, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
502. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_019448 (Staphylococcus phage GH15, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
503. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_023009 (Staphylococcus phage Sb-1, complete genome) position: , mismatch: 8, identity: 0.733
tttttcattaactaatatttttattggtca CRISPR spacer
tttttcattaacgaataattttactttatt Protospacer
************ **** *****.* .
504. spacer 1.49|505050|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR135312 (Enterococcus faecium isolate E7240 plasmid 6) position: , mismatch: 8, identity: 0.733
acattttcgttcaataaaaaatccaatcta CRISPR spacer
aatttttctttcgataaaaaatccaaaacc Protospacer
* ***** ***.************* .
505. spacer 1.52|505248|32|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 8, identity: 0.75
gcaataagcatttttacatcatgttaggggtt CRISPR spacer
ttaatatgcatatttacatcatgttaaaagtg Protospacer
.**** **** **************...**
506. spacer 1.54|505382|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043614 (Lactobacillus buchneri strain MGB0786 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733
ttagatttaaataattacgaaacaaataat CRISPR spacer
gcgcttttaattaattacgaaaaaaataaa Protospacer
.. ***** *********** ******
507. spacer 1.54|505382|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN694539 (Marine virus AFVG_250M1194, complete genome) position: , mismatch: 8, identity: 0.733
ttagatttaaataattacgaaacaaataat CRISPR spacer
cataacagaaataattacgaaaaaaataat Protospacer
. .*. ************** *******
508. spacer 1.58|502149|29|NC_022998|PILER-CR matches to NZ_CP016549 (Escherichia coli strain O177:H21 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.724
ctatttttataaacaaagtacctatcatt CRISPR spacer
gattcgcgataaacaaaatacctatcatt Protospacer
*. . *********.***********
509. spacer 1.58|502149|29|NC_022998|PILER-CR matches to NZ_CP016549 (Escherichia coli strain O177:H21 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.724
ctatttttataaacaaagtacctatcatt CRISPR spacer
gattcgcgataaacaaaatacctatcatt Protospacer
*. . *********.***********
510. spacer 1.5|502149|30|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP016549 (Escherichia coli strain O177:H21 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7
ctatttttataaacaaagtacctatcatta CRISPR spacer
gattcgcgataaacaaaatacctatcattg Protospacer
*. . *********.***********.
511. spacer 1.5|502149|30|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP016549 (Escherichia coli strain O177:H21 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7
ctatttttataaacaaagtacctatcatta CRISPR spacer
gattcgcgataaacaaaatacctatcattg Protospacer
*. . *********.***********.
512. spacer 1.7|502281|30|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP021170 (Paenibacillus bovis strain BD3526 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
gaaatgtatttcaatagttatattataaca CRISPR spacer
cggactctttttaatagttatattataact Protospacer
..*. . ***.*****************
513. spacer 1.7|502281|30|NC_022998|CRISPRCasFinder,CRT matches to NZ_AP014816 (Geminocystis sp. NIES-3708 plasmid pGM01, complete sequence) position: , mismatch: 9, identity: 0.7
gaaatgtatttcaatagttatattataaca CRISPR spacer
tctttatatttcaataattatattatattt Protospacer
*.**********.********** .
514. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134433 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 24) position: , mismatch: 9, identity: 0.7
gataattacaaaaataataaaatgcgcctt CRISPR spacer
aataattacaaaagtaataaaagccattcc Protospacer
.************.******** *.....
515. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028887 (Borrelia turcica IST7 plasmid lp32-B, complete sequence) position: , mismatch: 9, identity: 0.7
gataattacaaaaataataaaatgcgcctt CRISPR spacer
attaataacaaaaataataaaattaaattg Protospacer
. **** **************** . .*
516. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013684 (Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence) position: , mismatch: 9, identity: 0.7
gataattacaaaaataataaaatgcgcctt CRISPR spacer
aataattgcaaaaataataagatgtaagca Protospacer
.******.************.***.. .
517. spacer 1.10|502479|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053689 (Arthrobacter citreus strain NEB 577 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
gataattacaaaaataataaaatgcgcctt CRISPR spacer
gataataacaaaaataataaagtaaatagg Protospacer
****** **************.*. ..
518. spacer 1.11|502545|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693024 (Marine virus AFVG_117M49, complete genome) position: , mismatch: 9, identity: 0.7
attattgtaatactcgcttgcttgtaccaa CRISPR spacer
catattgtaatactcgcctgcttcagcagc Protospacer
***************.***** .* .
519. spacer 1.11|502545|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693007 (Marine virus AFVG_117M43, complete genome) position: , mismatch: 9, identity: 0.7
attattgtaatactcgcttgcttgtaccaa CRISPR spacer
catattgtaatactcgcctgcttcagcagc Protospacer
***************.***** .* .
520. spacer 1.13|502678|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KX160220 (Lactococcus phage Dub35A, complete genome) position: , mismatch: 9, identity: 0.7
acctgttttaaaaaaaccaattgaaggtgt CRISPR spacer
atacgttttaaaaaaagcaattgaattaaa Protospacer
*. .************ ******** .
521. spacer 1.14|502744|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.7
gattttgtcatcatagacataatcgttgta CRISPR spacer
atgagtgtcatcatagacgtaatcgatgct Protospacer
. *************.****** **.
522. spacer 1.16|502876|30|NC_022998|CRISPRCasFinder,CRT matches to MH830339 (Proteus phage Stubb, complete genome) position: , mismatch: 9, identity: 0.7
tttttcaataactaatatttttattagttg CRISPR spacer
agcgaagttaactaatatatttattagttg Protospacer
. . ********** ***********
523. spacer 1.16|502876|30|NC_022998|CRISPRCasFinder,CRT matches to NC_018878 (Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence) position: , mismatch: 9, identity: 0.7
tttttcaataactaatatttttattagttg CRISPR spacer
aggctctataactaatatttttattcttgt Protospacer
.** ****************** *
524. spacer 1.16|502876|30|NC_022998|CRISPRCasFinder,CRT matches to NC_025137 (Acinetobacter pittii strain MS32 plasmid pMS32-3, complete sequence) position: , mismatch: 9, identity: 0.7
tttttcaataactaatatttttattagttg CRISPR spacer
aatttcaataactaatctttgtattccccc Protospacer
************** *** **** ..
525. spacer 1.17|502942|30|NC_022998|CRISPRCasFinder,CRT matches to NZ_CP017081 (Bacillus muralis strain G25-68 plasmid pG25-68, complete sequence) position: , mismatch: 9, identity: 0.7
aaaaaggttattattagcattctacaagcc CRISPR spacer
tcaaaggtttttattagcattctgtagttt Protospacer
******* *************..*. ..
526. spacer 1.23|503333|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY978631 (Klebsiella pneumoniae strain 447 plasmid p447-IMP, complete sequence) position: , mismatch: 9, identity: 0.7
ttatctttaaactactaatttgtaaactag CRISPR spacer
tagaaattaaactactaatttgaaaaccta Protospacer
* . **************** ****. .
527. spacer 1.23|503333|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KY653116 (Staphylococcus phage IME1318_01, complete genome) position: , mismatch: 9, identity: 0.7
ttatctttaaactactaatttgtaaactag CRISPR spacer
cactatttaaactgctaatttgtaaagggt Protospacer
. * ********.************ .
528. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021485 (Pediococcus acidilactici strain SRCM100424 plasmid pPl424-1, complete sequence) position: , mismatch: 9, identity: 0.7
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
gtagttgcgttcaataaaaaattcacgttt Protospacer
....** ****************** .*
529. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021530 (Pediococcus acidilactici strain SRCM101189 plasmid pPL1189-1, complete sequence) position: , mismatch: 9, identity: 0.7
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
gtagttgcgttcaataaaaaattcacgttt Protospacer
....** ****************** .*
530. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028248 (Pediococcus acidilactici strain SRCM102731 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
gtagttgcgttcaataaaaaattcacgttt Protospacer
....** ****************** .*
531. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028250 (Pediococcus acidilactici strain SRCM102732 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
gtagttgcgttcaataaaaaattcacgttt Protospacer
....** ****************** .*
532. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035155 (Pediococcus acidilactici strain SRCM103387 plasmid unnamed1) position: , mismatch: 9, identity: 0.7
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
gtagttgcgttcaataaaaaattcacgttt Protospacer
....** ****************** .*
533. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018765 (Pediococcus acidilactici strain BCC1 plasmid pbcp2, complete sequence) position: , mismatch: 9, identity: 0.7
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
gtagttgcgttcaataaaaaattcacgttt Protospacer
....** ****************** .*
534. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021488 (Pediococcus acidilactici strain SRCM100313 plasmid pPl313-1, complete sequence) position: , mismatch: 9, identity: 0.7
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
gtagttgcgttcaataaaaaattcacgttt Protospacer
....** ****************** .*
535. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021488 (Pediococcus acidilactici strain SRCM100313 plasmid pPl313-1, complete sequence) position: , mismatch: 9, identity: 0.7
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
gtagttgcgttcaataaaaaattcacgttt Protospacer
....** ****************** .*
536. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035153 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed2) position: , mismatch: 9, identity: 0.7
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
gtagttgcgttcaataaaaaattcacgttt Protospacer
....** ****************** .*
537. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KT321315 (Enterobacter phage phiEap-3, complete genome) position: , mismatch: 9, identity: 0.7
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
tcgatttcgatcaagaaaaaattcgtaacg Protospacer
******** **** *********. ..
538. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to HQ698922 (Acinetobacter phage ZZ1, complete genome) position: , mismatch: 9, identity: 0.7
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
gtcctttcgttcaatataaaatttaatgct Protospacer
.. ************ ******.*** .
539. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK240351 (Acinetobacter phage Henu6, complete genome) position: , mismatch: 9, identity: 0.7
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
gtcctttcgttcaatataaaatttaatgct Protospacer
.. ************ ******.*** .
540. spacer 1.28|503664|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to GU295964 (Klebsiella phage KP15, complete genome) position: , mismatch: 9, identity: 0.7
acgatttcgttcaataaaaaattcaatcta CRISPR spacer
tcgatttcgatcaagaaaaaattcgtaacg Protospacer
******** **** *********. ..
541. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY436021 (Staphylococcus aureus strain NRL 99/049 plasmid pETB049, complete sequence) position: , mismatch: 9, identity: 0.7
aataaagaaatagtaaaaattgaaattata CRISPR spacer
ggtaaggaaatagtaaaaattgacgctgct Protospacer
..***.***************** ..*..
542. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY436022 (Staphylococcus aureus strain NRL 03/459 plasmid pETB459, complete sequence) position: , mismatch: 9, identity: 0.7
aataaagaaatagtaaaaattgaaattata CRISPR spacer
ggtaaggaaatagtaaaaattgacgctgct Protospacer
..***.***************** ..*..
543. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY436024 (Staphylococcus aureus strain NRL 13/791 plasmid pETB791, complete sequence) position: , mismatch: 9, identity: 0.7
aataaagaaatagtaaaaattgaaattata CRISPR spacer
ggtaaggaaatagtaaaaattgacgctgct Protospacer
..***.***************** ..*..
544. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY436025 (Staphylococcus aureus strain NRL 08/797 plasmid pETB797, complete sequence) position: , mismatch: 9, identity: 0.7
aataaagaaatagtaaaaattgaaattata CRISPR spacer
ggtaaggaaatagtaaaaattgacgctgct Protospacer
..***.***************** ..*..
545. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_022598 (Staphylococcus aureus TY825 plasmid pETB DNA, complete sequence) position: , mismatch: 9, identity: 0.7
aataaagaaatagtaaaaattgaaattata CRISPR spacer
ggtaaggaaatagtaaaaattgacgctgct Protospacer
..***.***************** ..*..
546. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_013334 (Staphylococcus aureus plasmid SAP057A, complete sequence) position: , mismatch: 9, identity: 0.7
aataaagaaatagtaaaaattgaaattata CRISPR spacer
ggtaaggaaatagtaaaaattgacgctgct Protospacer
..***.***************** ..*..
547. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016847 (Carnobacterium maltaromaticum strain TMW 2.1581 plasmid pL21581-3, complete sequence) position: , mismatch: 9, identity: 0.7
aataaagaaatagtaaaaattgaaattata CRISPR spacer
ggcaaagaaacagtaaaaattgatatacag Protospacer
...*******.************ ** .
548. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_003265 (Staphylococcus aureus TY4 plasmid pETB, complete sequence) position: , mismatch: 9, identity: 0.7
aataaagaaatagtaaaaattgaaattata CRISPR spacer
ggtaaggaaatagtaaaaattgacgctgct Protospacer
..***.***************** ..*..
549. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022683 (Staphylococcus aureus strain 78 plasmid pPS00085.1A.1, complete sequence) position: , mismatch: 9, identity: 0.7
aataaagaaatagtaaaaattgaaattata CRISPR spacer
ggtaaggaaatagtaaaaattgacgctgct Protospacer
..***.***************** ..*..
550. spacer 1.31|503862|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN694201 (Marine virus AFVG_250M801, complete genome) position: , mismatch: 9, identity: 0.7
aataaagaaatagtaaaaattgaaattata CRISPR spacer
ggtaaagaaataataaaaatagaaacagac Protospacer
..**********.******* ****. .
551. spacer 1.33|503994|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to CP034667 (Proteus vulgaris strain PvSC3 plasmid pPvSC3, complete sequence) position: , mismatch: 9, identity: 0.7
cagtatttaaaacgcaatatttttcccata CRISPR spacer
atttatttaaaaagcaatattttttgccag Protospacer
********* ***********. * .
552. spacer 1.36|504192|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693030 (Marine virus AFVG_117M28, complete genome) position: , mismatch: 9, identity: 0.7
gaacctattaaaaatagtacaactaataga CRISPR spacer
cctactattaaaaatagtacaaattatttt Protospacer
****************** * **
553. spacer 1.36|504192|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_005207 (Staphylococcus warneri plasmid pPI-1, complete sequence) position: , mismatch: 9, identity: 0.7
gaacctattaaaaatagtacaactaataga CRISPR spacer
agtgatattaaaaatagtataactaaataa Protospacer
.. **************.****** .*
554. spacer 1.36|504192|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MT840185 (Bacteriophage sp. Joined_contig_19 genomic sequence) position: , mismatch: 9, identity: 0.7
gaacctattaaaaatagtacaactaataga CRISPR spacer
cgctatccaaaaaatagtgcaactaataga Protospacer
. . * . *********.***********
555. spacer 1.36|504192|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693784 (Marine virus AFVG_250M892, complete genome) position: , mismatch: 9, identity: 0.7
gaacctattaaaaatagtacaactaataga CRISPR spacer
cctactattaaaaatagtacaaattatttt Protospacer
****************** * **
556. spacer 1.37|504258|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015798 (Borrelia mayonii strain MN14-1539 plasmid cp32-1, complete sequence) position: , mismatch: 9, identity: 0.7
tcaatagttagtttctcaacgaactctttt CRISPR spacer
atcccttttattttctcaacaaactctttt Protospacer
. . *** *********.*********
557. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250021 (Prevotella phage Lak-B2, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggttg CRISPR spacer
ttttttattaaataatatttttagaaaggt Protospacer
*****.***** *********** ..
558. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250024 (Prevotella phage Lak-B5, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggttg CRISPR spacer
ttttttattaaataatatttttagaaaggt Protospacer
*****.***** *********** ..
559. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250028 (Prevotella phage Lak-B9, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggttg CRISPR spacer
ttttttattaaataatatttttagaaaggt Protospacer
*****.***** *********** ..
560. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250023 (Prevotella phage Lak-B4, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggttg CRISPR spacer
ttttttattaaataatatttttagaaaggt Protospacer
*****.***** *********** ..
561. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MH830339 (Proteus phage Stubb, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggttg CRISPR spacer
agcgaagttaactaatatatttattagttg Protospacer
. .*********** ******.****
562. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250025 (Prevotella phage Lak-B6, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggttg CRISPR spacer
ttttttattaaataatatttttagaaaggt Protospacer
*****.***** *********** ..
563. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250022 (Prevotella phage Lak-B3, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggttg CRISPR spacer
ttttttattaaataatatttttagaaaggt Protospacer
*****.***** *********** ..
564. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250027 (Prevotella phage Lak-B8, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggttg CRISPR spacer
ttttttattaaataatatttttagaaaggt Protospacer
*****.***** *********** ..
565. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN693161 (Marine virus AFVG_25M297, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggttg CRISPR spacer
aagttcatcaactaatatttttatattatc Protospacer
*****.*************** *
566. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250026 (Prevotella phage Lak-B7, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggttg CRISPR spacer
ttttttattaaataatatttttagaaaggt Protospacer
*****.***** *********** ..
567. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250020 (Prevotella phage Lak-B1, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggttg CRISPR spacer
ttttttattaaataatatttttagaaaggt Protospacer
*****.***** *********** ..
568. spacer 1.38|504324|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to AP013399 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G15, isolate: uvMED-CGR-U-MedDCM-OCT-S40-C42) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggttg CRISPR spacer
gagcacattagataatatttttattggtca Protospacer
. *****. ****************..
569. spacer 1.39|504390|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034365 (Pantoea sp. CCBC3-3-1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
tcgtaaattgttcgttataagtcttcattt CRISPR spacer
tcgtaaattgttccttataagaaagtggct Protospacer
************* ******* .. .*
570. spacer 1.43|504654|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 9, identity: 0.7
gtcattgaaaaacttttattagaggtaatt CRISPR spacer
atgtaaataaaacttttgttagaggtaata Protospacer
.* . *********.***********
571. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN692994 (Marine virus AFVG_117M61, complete genome) position: , mismatch: 9, identity: 0.7
tttttttca-------ttttaaaacctttccatttct CRISPR spacer
-------tagaaaagtttttaaaacctttccacttct Protospacer
.* ****************.****
572. spacer 1.47|504918|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MN692961 (Marine virus AFVG_117M41, complete genome) position: , mismatch: 9, identity: 0.7
tttttttca-------ttttaaaacctttccatttct CRISPR spacer
-------tagaaaaatttttaaaacctttccacttct Protospacer
.* ****************.****
573. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to KR131710 (Fusobacterium phage Funu1, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggtca CRISPR spacer
aagttcattaactaatttttttattctatc Protospacer
************* ******** .
574. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250021 (Prevotella phage Lak-B2, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggtca CRISPR spacer
ttttttattaaataatatttttagaaaggt Protospacer
*****.***** *********** ..
575. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250024 (Prevotella phage Lak-B5, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggtca CRISPR spacer
ttttttattaaataatatttttagaaaggt Protospacer
*****.***** *********** ..
576. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250028 (Prevotella phage Lak-B9, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggtca CRISPR spacer
ttttttattaaataatatttttagaaaggt Protospacer
*****.***** *********** ..
577. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250023 (Prevotella phage Lak-B4, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggtca CRISPR spacer
ttttttattaaataatatttttagaaaggt Protospacer
*****.***** *********** ..
578. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250025 (Prevotella phage Lak-B6, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggtca CRISPR spacer
ttttttattaaataatatttttagaaaggt Protospacer
*****.***** *********** ..
579. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250022 (Prevotella phage Lak-B3, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggtca CRISPR spacer
ttttttattaaataatatttttagaaaggt Protospacer
*****.***** *********** ..
580. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250027 (Prevotella phage Lak-B8, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggtca CRISPR spacer
ttttttattaaataatatttttagaaaggt Protospacer
*****.***** *********** ..
581. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250026 (Prevotella phage Lak-B7, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggtca CRISPR spacer
ttttttattaaataatatttttagaaaggt Protospacer
*****.***** *********** ..
582. spacer 1.48|504984|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to MK250020 (Prevotella phage Lak-B1, complete genome) position: , mismatch: 9, identity: 0.7
tttttcattaactaatatttttattggtca CRISPR spacer
ttttttattaaataatatttttagaaaggt Protospacer
*****.***** *********** ..
583. spacer 1.13|502678|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034581 (Lactococcus lactis subsp. lactis strain UC06 plasmid pUC06F, complete sequence) position: , mismatch: 10, identity: 0.667
acctgttttaaaaaaaccaattgaaggtgt CRISPR spacer
taaaattttaaaaaaagcaattgaagacag Protospacer
.*********** *********...
584. spacer 1.13|502678|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to CP029292 (Lactococcus lactis subsp. lactis KLDS 4.0325 plasmid unnamed5) position: , mismatch: 10, identity: 0.667
acctgttttaaaaaaaccaattgaaggtgt CRISPR spacer
taaaattttaaaaaaagcaattgaagacag Protospacer
.*********** *********...
585. spacer 1.13|502678|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to CP034582 (Lactococcus lactis subsp. lactis strain C10 plasmid pC10B, complete sequence) position: , mismatch: 10, identity: 0.667
acctgttttaaaaaaaccaattgaaggtgt CRISPR spacer
taaaattttaaaaaaagcaattgaagacag Protospacer
.*********** *********...
586. spacer 1.44|504720|30|NC_022998|CRISPRCasFinder,CRT,PILER-CR matches to NC_003276 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence) position: , mismatch: 10, identity: 0.667
ggttcatagcttttgaacaaccacaacttt CRISPR spacer
tacaactagcttttgaacaacaacaacaga Protospacer
.. *************** *****
