Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_022795 Pseudothermotoga hypogea DSM 11164 = NBRC 106472, complete genome 4 crisprs cas2,cas6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas1,cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cmr1gr7,csx1,DEDDh,cas3,cas5,cas7,cas8b1,cas4,csa3,Cas14b_CAS-V-F,cas14k 0 3 0 0

Results visualization

1. NC_022795
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022795_1 263259-264346 TypeIII NA
15 spacers
csx1,cas2,cas6,csm5gr7,csm4gr5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022795_2 278670-279551 TypeIII NA
12 spacers
cas1,cas10,csm2gr11,csm3gr7,csm4gr5,csm5gr7,cas6,cas2,cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cmr1gr7,csx1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022795_3 340779-345855 TypeI-B NA
77 spacers
cas3,cas5,cas7,cas8b1,cas2,cas1,cas4,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022795_4 439364-441308 TypeV NA
29 spacers
cas2,cas1,cas4,cas3,cas5,cas7,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_022795_3 3.59|344613|37|NC_022795|PILER-CR,CRISPRCasFinder,CRT 344613-344649 37 NZ_CP027853 Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence 288779-288815 8 0.784
NC_022795_4 4.26|441045|35|NC_022795|PILER-CR,CRISPRCasFinder,CRT 441045-441079 35 MN856030 Myoviridae sp. isolate 303, complete genome 6324-6358 8 0.771
NC_022795_3 3.36|343109|36|NC_022795|PILER-CR,CRISPRCasFinder,CRT 343109-343144 36 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 766857-766892 10 0.722

1. spacer 3.59|344613|37|NC_022795|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027853 (Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence) position: , mismatch: 8, identity: 0.784

tttcaaagcccgcatcaaagcgggcttttcttttgtt	CRISPR spacer
acaaaaagcccgcatcaatgcgggcttttctttttag	Protospacer
 .  ************** ***************   

2. spacer 4.26|441045|35|NC_022795|PILER-CR,CRISPRCasFinder,CRT matches to MN856030 (Myoviridae sp. isolate 303, complete genome) position: , mismatch: 8, identity: 0.771

ttgagtgtgtttagaacatgtttattggtatcaga--	CRISPR spacer
ttcagtgtgttttgaacatgtttatcag--tcaattc	Protospacer
** ********* ************..*  ***.   

3. spacer 3.36|343109|36|NC_022795|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.722

tcgctccgcttccgatgcgcattcgctcgcgtacgc	CRISPR spacer
ggaggccgcttccgattcgcatacgctcgcgttcat	Protospacer
  .  *********** ***** ********* *..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage