Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_023018 Pandoraea pnomenusa, complete sequence 1 crisprs csa3,DEDDh,DinG,cas3,WYL 0 1 4 0

Results visualization

1. NC_023018
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_023018_1 3847727-3847898 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_023018_1 1.2|3847836|32|NC_023018|PILER-CR 3847836-3847867 32 NZ_CP005193 Sphingobium sp. MI1205 plasmid pMI4, complete sequence 9047-9078 10 0.688
NC_023018_1 1.2|3847836|32|NC_023018|PILER-CR 3847836-3847867 32 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 393788-393819 10 0.688

1. spacer 1.2|3847836|32|NC_023018|PILER-CR matches to NZ_CP005193 (Sphingobium sp. MI1205 plasmid pMI4, complete sequence) position: , mismatch: 10, identity: 0.688

gacatcttcccgctcttgtccatgtccttacg	CRISPR spacer
atcatcgtcccgctcatgtccatgttaaaggg	Protospacer
. **** ******** *********.   . *

2. spacer 1.2|3847836|32|NC_023018|PILER-CR matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 10, identity: 0.688

gacatcttcccgctcttgtccatgtccttacg	CRISPR spacer
atcatcgtcccgctcatgtccatgttaaaggg	Protospacer
. **** ******** *********.   . *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1713305 : 1824706 111 Acidithiobacillus_phage(24.32%) tRNA,tail,head,integrase,portal,transposase,terminase,capsid attL 1709574:1709592|attR 1812951:1812969
DBSCAN-SWA_2 2150757 : 2157802 8 Pseudomonas_virus(33.33%) transposase NA
DBSCAN-SWA_3 2170525 : 2203154 45 Burkholderia_phage(46.67%) plate,terminase,capsid,holin NA
DBSCAN-SWA_4 4686092 : 4741326 56 Micromonas_sp._RCC1109_virus(33.33%) tRNA,transposase,integrase attL 4706730:4706789|attR 4742233:4743153
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage