Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_023063 Ehrlichia muris AS145, complete sequence 3 crisprs DEDDh 1 0 0 0

Results visualization

1. NC_023063
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_023063_1 63809-63894 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_023063_2 157159-157299 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_023063_3 968541-968635 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_023063_2 2.1|157202|55|NC_023063|CRISPRCasFinder 157202-157256 55 NC_023063.1 1007239-1007293 0 1.0
NC_023063_2 2.1|157202|55|NC_023063|CRISPRCasFinder 157202-157256 55 NC_023063.1 1007506-1007560 0 1.0
NC_023063_2 2.1|157202|55|NC_023063|CRISPRCasFinder 157202-157256 55 NC_023063.1 1007640-1007694 0 1.0
NC_023063_2 2.1|157202|55|NC_023063|CRISPRCasFinder 157202-157256 55 NC_023063.1 1007774-1007828 1 0.982

1. spacer 2.1|157202|55|NC_023063|CRISPRCasFinder matches to position: 1007239-1007293, mismatch: 0, identity: 1.0

tttagtttaataatgtgtcccgtgtttctgtagttgctaagtaaaaaaagagctt	CRISPR spacer
tttagtttaataatgtgtcccgtgtttctgtagttgctaagtaaaaaaagagctt	Protospacer
*******************************************************

2. spacer 2.1|157202|55|NC_023063|CRISPRCasFinder matches to position: 1007506-1007560, mismatch: 0, identity: 1.0

tttagtttaataatgtgtcccgtgtttctgtagttgctaagtaaaaaaagagctt	CRISPR spacer
tttagtttaataatgtgtcccgtgtttctgtagttgctaagtaaaaaaagagctt	Protospacer
*******************************************************

3. spacer 2.1|157202|55|NC_023063|CRISPRCasFinder matches to position: 1007640-1007694, mismatch: 0, identity: 1.0

tttagtttaataatgtgtcccgtgtttctgtagttgctaagtaaaaaaagagctt	CRISPR spacer
tttagtttaataatgtgtcccgtgtttctgtagttgctaagtaaaaaaagagctt	Protospacer
*******************************************************

4. spacer 2.1|157202|55|NC_023063|CRISPRCasFinder matches to position: 1007774-1007828, mismatch: 1, identity: 0.982

tttagtttaataatgtgtcccgtgtttctgtagttgctaagtaaaaaaagagctt	CRISPR spacer
tttaatttaataatgtgtcccgtgtttctgtagttgctaagtaaaaaaagagctt	Protospacer
****.**************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage